Analysis of the effects of mutant hairless genes in chimeric mice

The autosomal recessive gene hairless (hr) is responsible for the complete hairlessness in mice homozygous for this gene. Hair shedding that begins at the age of 10 days is caused by an abnormal cycle of hair follicle development disturbed at the catagen stage. This results in enhanced programmed cell death (apoptosis) and ultimately leads to the complete hair follicle destruction and shedding of all hairs by the age of three weeks. To study the phenotypic expression of the hr gene in a chimeric organism, we have obtained 12 chimeric mice hr/hr <--> +/+ by means of aggregation of early embryos hr/hr and +/+. In chimeric mice, the hair shedding has begun two days later than in the hr/hr mice. By day 23 of postnatal development, hairless areas were present on the coat of chimeric mice or the latter were completely hairless depending on the percentage of the hr/hr mutant component. In four chimeras with high content of the mutant component (68-76%), the hair shedding process was similar to that in the hr/hr mice, though it was accomplished two days later. In three chimeras with 48-51% of the mutant component, alternating hairless and hair-covered bands were observed. These data suggest that the hr gene acts in epidermal cells of a hair follicle, because epidermal cell clones in embryonic skin migrate in the lateral-ventral direction coherently and without mixing. However, some chimeras displayed a pattern which was not so clear-cut: the band borders were illegible and hairs partly covered the hairless areas. In some chimeras, the uniform thinning of the coat was observed. Analysis of the effects of the hr mutant gene in chimeric mice differing in the ratio between mutant (hr/hr) and normal (+/+) components in tissues suggests that the hr gene acts in the epidermal cells of the hair follicle. The interactions between cells have an essential effect on the mode and degree of the hr gene expression, which leads to distortion of the "ectodermal" coat pattern in chimeras.     

Effects of the Mutant Gene wellhaarig in the Chimeric Mice

The mutant genewellhaarig(we) controls the formation of the waved coat in mice, which is most pronounced in homozygotes at 10 to 21 days of postnatal development. Abnormal hair growth and structure in the we/we mutant mice results from defective cell differentiation in the inner root sheath of a hair follicle. To localize the site of the we gene action, we obtained ten chimeric mice by aggregation of the early C57BL/6-2we/we and BALB/c embryos. The chimera coat was waved, shaggy, or almost normal depending on the percentage of the mutant component. In the we/we +/+ chimeric animals of the first generation (G1) aged 21 days, both mutant and normal hair phenotypes were observed, which was especially discernible in zigzag hair. Note that none of the chimeras exhibited the alternating patterns of transversely oriented stripes or patches of either mutant or normal hair; i.e., they had a mixed parental hair phenotype. We also did not observe the animals with an intermediate phenotype, which suggests a discontinuous hair formation in chimeras according to the all or nothing principle. The data obtained indicate that the dermal papilla cells of a hair follicle are the sites for the we gene action. During the embryonic development, dermal cells are strongly mixed, which accounts for the lack of the clear-cut transverse stripes of either mutant or normal hair. The mutant genewe is probably responsible for a disrupted induction signal from the dermal papilla towards ectodermal cells of a hair follicle.     

Effects of the mutant gene wellhaarig in chimeric mice

The mutant gene wellhaaring (we) confers the waved coat in mice, which is most pronounced in homozygotes at 10 to 21 days of postnatal development. Abnormal hair growth and structure in the we/we mutant mice results from defective cell differentiation in the inner root sheath of a hair follicle. To localize the site of the we gene action, we obtained ten chimeric mice by aggregation of the early C57BL/6-2we/we and BALB/c embryos. The chimera coat was waved, shaggy, or almost normal depending on the percentage of the mutant component. In the we/we +/+ chimeric animals of the first generation (G1) aged 21 days, both mutant and normal hair phenotypes were observed, which was especially discernible in zigzag hair. Note that none of the chimeras exhibited the alternating patterns of transversely oriented stripes or patches of either mutant or normal hair; i.e., they had a mixed parental hair phenotype. We also did not observe the animals with an intermediate phenotype, which suggests a discontinuous hair formation in chimeras according to the "all or nothing" principle. The data obtained indicate that the dermal papilla cells of a hair follicle are the sites for the we gene action. During the embryonic development, dermal cells are strongly mixed, which accounts for the lack of the clear-cut transverse stripes of either mutant or normal hair. The mutant gene we is probably responsible for a disrupted induction signal from the dermal papilla towards ectodermal cells of a hair follicle.     

Gene <Emphasis Type="Italic">angora</Emphasis> as a modifier of the <Emphasis Type="Italic">hairless</Emphasis> gene in mouse

The interaction between mouse angora-Y (Fgf5 ^go-Y) and hairless (hr) genes have been studied. Homozygous mutant gene Fgf5 ^go-Y increases length of all hair types, while homozygotes for the h gene lose hair completely starting on day 14 after birth. We obtained mice with genotypes +/+ hr/hr F₂, +/Fgf5 ^go-Y hr/hr and Fgf5 ^go-Y/Fgf5 ^go-Y hr/hr. Both +/Fgf5 ^go-Y hr/hr and +/+ hr/hr mice began to loose hair from their heads on day 14. This further extended on the whole body. On day 21 the mice were completely deprived of hair. Therefore a single dose of gene Fgf5 ^go-Y does not modify alopecia in mice homozygous for hr. However in double homozygotes Fgf5 ^go-Y/Fgf5 ^go-Y hr/hr alopecia started 4 days later, namely on day 18. It usually finished 10–12 days after detection of first bald patches. On days 28–30 double homozygotes lose coat completely. Hair loss in double homozygous mice was 1.5-fold slower than in +/+ hr/hr mice. This resulted from a significant extension of anagen phase induced by a mutant homozygous gene Fgf5 ^go-Y in morphogenesis of the hair follicle. The hr gene was expressed at the transmission phase from anagen to catagen. Our data shows that the angora gene is a modifier of the hairless gene and this results in a strong repression of alopecia progression in double homozygous mice compared to +/+ hr/hr animals.     

The we Gene is a Modifier of the walGene in Mice

Interaction of gene wellhaarig (we) with genes waved alopecia(wal) and hairless (hr) was studied in mice. The mutant gene weis responsible for the development of a specific waved coat in homozygotes. Homozygous mice carrying mutant gene walalso have a wavy coat, though a partial alopecia develops with time in these animals. In homozygotes for thehr gene, hair loss is observed beginning from the age of ten days. A series of crosses we/weand wal/wal yielded animals with we/+wal/wal and we/we wal/wal genotypes. In micewe/+wal/wal carrying gene we at a single dose, alopecia is accelerated significantly as compared to the single-dose homozygotes +/+wal/wal. In we/we wal/wal mice, alopecia starts earlier than in we/+wal/wal mice; by the age of one month, the double homozygotes are almost hairless except for small body areas covered with a sparse coat. In addition, curliness of the first-generation hair in mice we/we wal/wal is much more expressed than in +/+wal/wal and we/we+/+ mice. The obtained evidence suggests that the wegene is a modifier of the wal gene because the former enhances the effects of the walgene, which is confirmed by the earlier onset of alopecia and progression of the latter in mice having the we/+wal/wal genotype and especially in we/we wal/wal animals. The we/we hr/+ mice do not differ in coat from we/we+/+ mice; in both cases, the coat is wavy. The coat of double homozygotes we/we hr/hr, is similar to that of we/we+/+ mice until ten days of age, when the signs of alopecia appear. By the age of 21 days, mice we/we hr/hr have lost their coat completely like mice +/+ hr/hr. Hence, the we gene is a modifier of the walgene though it does not interact with hrgene during the coat formation.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Genomic organization and analysis of the <Emphasis Type="Italic">hairless</Emphasis> gene in four hypotrichotic rat strains

More than 25 different hypotrichotic mutations have been described in laboratory rats, yet the molecular basis for these mutations has not been determined for most of these phenotypes. Their similarity to the hairless (hr) mutations described in mice suggests a possible role for the hairless gene in the formation of rat hypotrichotic phenotypes, though whether hr is responsible for these rat phenotypes has yet to be determined. Therefore, in order to understand the basis for the rat hypotrichotic phenotypes and their relationship to the hr gene, we determined the genomic organization of the hr gene and subsequently analyzed the coding sequence in four hypotrichotic rat strains. Analysis revealed that the first two exons of the mouse, monkey, and human hr gene were fused in the rat gene, while the rest of the gene showed strong evolutionary conservation. Despite their designation as hairless, no mutations within the coding sequences were identified, indicating that the hairless phenotype in all four hypotrichotic rat strains are not allelic with hr.     

<Emphasis Type="Italic">Gsdma3</Emphasis> gene is needed for the induction of apoptosis-driven catagen during mouse hair follicle cycle

Gsdm is a newly found gene family, which is restricted in its expression to the gastrointestinal tract and the skin epithelium. As a main member of the Gsdma subfamily, Gsdma3 is expressed specifically in the hair follicle of mouse skin, but its function remains largely unclear. By hematoxylin and eosin staining, we showed that Gsdma3 gene mutation caused an abnormal catagen phase with unshortened length and unshrunk structure of the hair follicle, in which the development of catagen phase was inhibited. TUNEL staining further revealed that the apoptosis of the hair follicle was obviously decreased in mutant mice. Caspase-3 downregulation was also detected by immunofluorescence, Western blot and RT-PCR in the hair follicle of the mutant mice. After intradermal injection of Gsdma3 gene expression plasmid, apoptosis as well as Caspase-3 expression in the hair follicle of mutant mice was enhanced, and so the catagen retardation of Gsdma3-mutant mice was rescued. Our results confirmed that Gsdma3 gene mutation interfered with catagen formation during mouse hair follicle cycle and, by upregulation of Caspase-3 expression and promotion of apoptosis, Gsdma3 gene could play an essential role in normal catagen induction.     

Notch signaling regulates late-stage epidermal differentiation and maintains postnatal hair cycle homeostasis

Background

Notch signaling involves ligand-receptor interactions through direct cell-cell contact. Multiple Notch receptors and ligands are expressed in the epidermis and hair follicles during embryonic development and the adult stage. Although Notch signaling plays an important role in regulating differentiation of the epidermis and hair follicles, it remains unclear how Notch signaling participates in late-stage epidermal differentiation and postnatal hair cycle homeostasis.

Methodology and Principal Findings

We applied Cre/loxP system to generate conditional gene targeted mice that allow inactivation of critical components of Notch signaling pathway in the skin. Rbpj, the core component of all four Notch receptors, and Pofut1, an essential factor for ligand-receptor interactions, were inactivated in hair follicle lineages and suprabasal layer of the epidermis using the Tgfb3-Cre mouse line. Rbpj conditional inactivation resulted in granular parakeratosis and reactive epidermal hyperplasia. Pofut1 conditional inactivation led to ultrastructural abnormalities in the granular layer and altered filaggrin processing in the epidermis, suggesting a perturbation of the granular layer differentiation. Disruption of Pofut1 in hair follicle lineages resulted in aberrant telogen morphology, a decrease of bulge stem cell markers, and a concomitant increase of K14-positive keratinocytes in the isthmus of mutant hair follicles. Pofut1-deficent hair follicles displayed a delay in anagen re-entry and dysregulation of proliferation and apoptosis during the hair cycle transition. Moreover, increased DNA double stand breaks were detected in Pofut1-deficent hair follicles, and real time PCR analyses on bulge keratinocytes isolated by FACS revealed an induction of DNA damage response and a paucity of DNA repair machinery in mutant bulge keratinocytes.

Significance

our data reveal a role for Notch signaling in regulating late-stage epidermal differentiation. Notch signaling is required for postnatal hair cycle homeostasis by maintaining proper proliferation and differentiation of hair follicle stem cells.     

Molecular Basis for the rhino (hr)Phenotype: A Nonsense Mutation in the MousehairlessGene

The hairless (hr) and rhino (hr^rh) mutations are autosomal recessive allelic mutations that map to mouse Chromosome 14. Both hairless and rhino mice have a number of skin and nail abnormalities and develop a striking form of total alopecia at approximately 3–4 weeks of age. The molecular basis of the hairless mouse phenotype was previously found to be the result of a murine leukemia proviral insertion in intron 6 of thehrgene that resulted in aberrant splicing. In this study, we report a 2-bp substitution in exon 4 of thehrgene in a second allele ofhr,rhino 8J (hr^rh-8J), leading to a nonsense mutation. These findings document the molecular basis of the rhino phenotype for the first time and suggest that rhino is a functional knock-out of thehrgene.     

Interaction of mutant genes Fgf5go-Y, we, and wal changes the duration of hair growth cycles in mice

Mutant gene wallhaarig (wa) was acting as a modifier of the mutant gene waved alopecia (wal), substantially increasing hair loss rate in mice, as was previously shown in our laboratory. The current paper is devoted to a study of mutant gene angora-Y (Fgf5 ^go-Y ), which had extended anagen stage of the first and second generations hair growth cycles in triple heterozygotes (Fgf5 ^go-Y /Fgf5 ^go-Y we/we wal/wal). First generation guard hair in triple homozygotes had their anagen stage 4 days longer than the same stage in double homozygotes (+/+ we/we wal/wal). Hair loss started at a catagen stage in double homozygotes, while it started in triple homozygotes at the end of the same stage or even in a telogen. Such mutant gene interaction in hair follicle morphogenesis led to a partial recovery of a body hair coat in triple homozygotes.     

Shh is required for Tabby hair follicle development

In embryonic Eda mutant (“Tabby”) mice, the development of one of the two major types of hair, “primary” hair fails, but other “secondary” hairs develop in normal numbers, though shorter and slightly aberrant. In Tabby mice, Shh is undetectable in skin early on, but is activated during secondary hair formation. We inferred that Shh may be involved in primary hair formation, activated normally by Eda, and also possibly in secondary hair formation, activated by an Eda-independent pathway. Varying the dosage of Shh now supports these inferences. In Shh knockout mice, mice were totally hairless: primary and secondary hair follicle germs were formed, but further progression failed. Consistent with these findings, when Shh loss was restricted to the skin, secondary hair follicle germs were initiated on time in Tabby mice, but their subsequent development (down-growth) failed. An Shh transgene expressed in Tabby skin could not restore induction of primary hair follicles, but restored normal length to the somewhat aberrant secondary hair that was formed and prolonged the anagen phase of hair cycling. Thus, Shh is required for primary and secondary hair downgrowth and full secondary hair length, but is not itself sufficient to replace Eda or make fully normal secondary hair.Key words: Eda, Shh, Wnt, hair follicle subtypes, Tabby     

Skin Abnormalities in Mice Transgenic for Plasminogen Activator Inhibitor 1: Implications for the Regulation of Desquamation and Follicular Neogenesis by Plasminogen Activator Enzymes

Plasminogen activator enzymes have been implicated in the regulation of growth, migration, and differentiation which occur continually in normal epidermis and cyclically in the hair follicle. To elucidate further the importance of plasminogen activation in epidermal physiology, studies were conducted using mice transgenic for human plasminogen activator inhibitor 1 (PAI-1). The epidermis of the newborn (4-7 days) transgenic mice was flaky and showed delayed hair growth compared to that of their control littermates. Histologic analyses revealed a greatly thickened stratum corneum in the transgenics. By 2 weeks after birth, no differences in epidermal morphology were apparent between transgenic and control littermates. Using in situ hybridization, immunocytochemistry, and in situ reverse zymography techniques, epidermal PAI-1 expression was correlated temporally with the aberrant epidermal morphology. These data implicate plasminogen activator activity in the regulation of epidermal shedding and follicular neogenesis.     

Dermal cysts participate in reparative regeneration of epidermis in Hrhr/Hrhr mice

One of the phenotypic effects of mutation in the Hr gene in mice is disintegration of hair follicles and their degeneration into open funnel-shaped structures (utricles) opened on skin surface and cysts located in the depth of the dermis. The aim of the current study consists in analysis of the process of reparative regeneration of skin in homozygotous mice with one of the mutant alleles of the Hr gene—Hr ^hr . It is shown that epithelial cells that constitute the inner pavement of cysts take part in the process of epithelization of deep skin wounds. This indicates that the competence of ectodermal cells in relation to inductive signals from injured skin remains in Hr ^hr homozygote mice, in spite of the significant anatomic abnormalities of the hair follicles.     

Response of murine epidermis to 2,3,7,8-tetrachlorodibenzo-p-dioxin: Interaction of the Ah and hr loci

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related halogenated aromatic hydrocarbons produce epidermal hyperplasia, hyperkeratosis and sebaceous gland metaplasia in the skin of mice bearing the recessive mutation (hr/hr) hairless. This response is mediated through the cytosol receptor protein: the structure-activity relationship for receptor binding corresponds to that for production of the skin lesion, and these histopathological changes segregate with the genetic polymorphism at the Ah locus, the locus determining the cytosol receptor. In HRS/J mice, an inbred strain segregating for the hr locus, both hairless (hr/hr) and haired (hr/ +) mice possess the high-affinity cytosol receptor and respond to TCDD with the induction of epidermal aryl hydrocarbon hydroxylase activity, a receptor-mediated biochemical response; however, only hr/hr mice develop the proliferative/metaplastic skin response. We propose a genetic model for the interaction of the Ah and hr loci, to account for the differential response to TCDD observed in the skin of HRS/J hr/hr and hr/ + mice.     

The mutant gene "wal" is active in cells of mouse hair follicles

In order to determine the place of action of the mutant gene waved alopecia (wal), we have obtained chimeric wal/wal c/c Gpi-1aa<-->+/+ C/C Gpi-1bb animals by aggregation of eight-cellular embryos of BALB/c-wal/wal mice and CBA (+/+) mice. The presence or absence of the chimeric structure was determined from the mosaic nature of fur color and hair structure, as well as on the basis of the presence of electrophoretically distinct variants of glucosephosphate isomerase in blood. Chimeras had alternating transverse patches of different lengths and widths consisting of curly (genotype wal/wal) or straight (genotype +/+) hairs. The percentage of cells with wal/wal mutant genotype in chimeras established on the basis of glucosephosphate isomerase isozymes varied from 10 to 80%. A higher percentage of the parental wal/wal component in chimeras correlated with the number of patches having wavy hairs. Analysis of the fur pattern represented by the alternation of transverse patches of wavy or straight hairs in chimeric wal/wal (+/+ mice has shown that mutant gene wal acts in ectodermal cells of hair follicles.     

Cathepsin L deficiency as molecular defect of furless: hyperproliferation of keratinocytes and pertubation of hair follicle cycling.

Lysosomal cysteine proteinases of the papain family are involved in lysosomal bulk proteolysis, major histocompatibility complex class II mediated antigen presentation, prohormone processing, and extracellular matrix remodeling. Cathepsin L (CTSL) is a ubiquitously expressed major representative of the papain-like family of cysteine proteinases. To investigate CTSL in vivo functions, the gene was inactivated by gene targeting in embryonic stem cells. CTSL-deficient mice develop periodic hair loss and epidermal hyperplasia, acanthosis, and hyperkeratosis. The hair loss is due to alterations of hair follicle morphogenesis and cycling, dilatation of hair follicle canals, and disturbed club hair formation. Hyperproliferation of hair follicle epithelial cells and basal epidermal keratinocytes-both of ectodermal origin-are the primary characteristics underlying the mutant phenotype. Pathological inflammatory responses have been excluded as a putative cause of the skin and hair disorder. The phenotype of CTSL-deficient mice is reminiscent of the spontaneous mouse mutant furless (fs). Analyses of the ctsl gene of fs mice revealed a G149R mutation inactivating the proteinase activity. CTSL is the first lysosomal proteinase shown to be essential for epidermal homeostasis and regular hair follicle morphogenesis and cycling.     

iRhom2 Mutation Leads to Aberrant Hair Follicle Differentiation in Mice

iRhom1 and iRhom2 are inactive homologues of rhomboid intramembrane serine proteases lacking essential catalytic residues, which are necessary for the maturation of TNFα-converting enzyme (TACE). In addition, iRhoms regulate epidermal growth factor family secretion. The functional significance of iRhom2 during mammalian development is largely unclear. We have identified a spontaneous single gene deletion mutation of iRhom2 in Uncv mice. The iRhom2^Uncv/Uncv mice exhibit hairless phenotype in a BALB/c genetic background. In this study, we observed dysplasia hair follicles in iRhom2^Uncv/Uncv mice from postnatal day 3. Further examination found decreased hair matrix proliferation and aberrant hair shaft and inner root sheath differentiation in iRhom2^Uncv/Uncv mutant hair follicles. iRhom2 is required for the maturation of TACE. Our data demonstrate that iRhom2^Uncv cannot induce the maturation of TACE in vitro and the level of mature TACE is also significantly reduced in the skin of iRhom2^Uncv/Uncv mice. The activation of Notch1, a substrate of TACE, is disturbed, associated with dramatically down-regulation of Lef1 in iRhom2^Uncv/Uncv hair follicle matrix. This study identifies iRhom2 as a novel regulator of hair shaft and inner root sheath differentiation.     

Alopecia and male infertility in oligotriche mutant mice are caused by a deletion on distal chromosome 9

The recessive mutation oligotriche (olt) affects the coat and male fertility in the mouse. In homozygous (olt/olt) mutants, the coat is sparse, most notably in the inguinal and medial femoral region. In these regions, almost all hair shafts are bent and distorted in their course through the dermis and rarely penetrate the epidermis because the hair cortex is not fully keratinized. During hair follicle morphogenesis, mutant hair follicles exit from anagen one day before those of normal littermates and show a prolongation of the catagen stage. The oligotriche (olt) locus was mapped to distal chromosome 9 within a 5-Mbp interval distal to D9Mit279. Analysis of candidate gene expression revealed that olt/olt mutant mice do not express functional phospholipase C delta 1 (Plcd1) mRNA. This deficiency is the consequence of a 234-kbp deletion involving not only the Plcd1 locus but also the chromosomal segment harboring the genes Vill (villin-like), Dlec1 (deleted in lung and esophageal cancer 1), Acaa1b (acetyl-Coenzyme A acyltransferase 1B, synonym thiolase B), and parts of the genes Ctdspl (carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase-like) and Slc22a14 (solute carrier family 22 member 14). Offspring of olt/olt females, mated with Plcd1 ^−/− knockout males, exhibit coat defects similar to those observed in homozygous olt/olt mutant mice but the spermiogenesis in male offspring is normal. We conclude that the 234-kbp deletion from chromosome 9 harbors a gene involved in spermiogenesis and we propose that the oligotriche mutant be used as a model for the study of the putative tumor suppressor genes Dlec1, Ctdspl, and Vill. We also suggest that the oligotriche locus be named Del(9Ctdspl-Slc22a14)1Pas.