Biophysical studies of a ruthenium(II) polypyridyl complex binding to DNA and RNA prove that nucleic acid structure has significant effects on binding behaviors

The interactions of a metal complex [Ru(phen)(2)PMIP](2+) {Ru=ruthenium, phen=1,10-phenanthroline, PMIP=2-(4-methylphenyl)imidazo[4,5-f]1,10-phenanthroline} with yeast tRNA and calf thymus DNA (CT DNA) have been investigated comparatively by UV-vis spectroscopy, fluorescence spectroscopy, viscosity measurements, isothermal titration calorimetry (ITC), as well as equilibrium dialysis and circular dichroism (CD). Spectroscopic studies together with ITC and viscosity measurements indicate that both binding modes of the Ru(II) polypyridyl complex to yeast tRNA and CT DNA are intercalation and yeast tRNA binding of the complex is stronger than CT DNA binding. ITC experiments show that the interaction of the complex with yeast tRNA is driven by a moderately favorable enthalpy decrease in combination with a moderately favorable entropy increase, while the binding of the complex to CT DNA is driven by a large favorable enthalpy decrease with a less favorable entropy increase. The results from equilibrium dialysis and CD suggest that both interactions are enantioselective and the Delta enantiomer of the complex may bind more favorably to both yeast tRNA and CT DNA than the Lambda enantiomer does, and that the complex is a better candidate for an enantioselective binder to yeast tRNA than to CT DNA. Taken together, these results indicate that the structures of nucleic acids have significant effects on the binding behaviors of metal complexes.     

DNA-DNA cross-linking mediated by bifunctional [SalenAlIII]+ complex

The aluminum (III) complex [SalenAl(III)]Cl (1), (Salen=(R,R)-N,N'-bis[5-methyl-3-(4-methylpiperazinyl)-salicylidene]-1,2-diphenylethanediamine) has been synthesized and characterized by elemental analysis, FT-IR, (1)H and (13)C NMR measurements. The interaction of complex (1) with calf thymus (CT) DNA has been studied extensively by experimental techniques. Thermal denaturation study of DNA with (1) revealed the DeltaT(m) of 5+/-0.2 degrees C. Viscosity and steady-state fluorescence measurements showed that the complex cross-links DNA and the metal center is interacting with DNA during the cross-linking. Also, the phenyl ring in the complex may intercalate between the base pairs of the DNA during the cross-linking. Competitive binding study shows that the enhanced emission intensity of ethidium bromide (EB) in the presence of DNA was quenched by the addition of the metal complex indicating that it displaces EB from its binding site in DNA and the apparent binding constant has been estimated to be (2.8+/-0.2)x10(5) M(-1). Further, time-resolved fluorescence experiments confirm the binding of (1) with DNA and its cross-linking nature. Aluminum ions shown to precipitate DNA completely above the pH 6.0, but no such precipitation was observed with complex (1). The DNA-DNA cross-linking mediated by (1) is further confirmed by gel electrophoresis.     

Dissecting the metal ion dependence of DNA binding by PvuII endonuclease.

Divalent cations can provide an effective means of modulating the behavior of nucleic acid binding proteins. As a result, there is strong interest in understanding the role of metal ions in the function of both nucleic acid binding proteins and their enzymes. We have applied complementary fluorescence spectroscopic and nitrocellulose filter binding assays to quantitate the role of metal ions in mediating DNA binding and sequence specificity by the representative PvuII endonuclease. At pH 7.5 in the presence of the catalytically nonsupportive Ca(II), this enzyme binds the PvuII target sequence with a K(d) of 50 pM. Under strict metal-free conditions, the enzyme exhibits a K(d) of only 300 nM for the cognate sequence, an affinity which is weak relative to those measured for other systems in the absence of metal ions. This represents a 6000-fold increase in PvuII affinity for cognate DNA upon the addition of Ca(II). The pH dependences of both metal ion-dependent and metal ion-independent DNA binding are remarkably shallow throughout the physiological range; other characterized restriction enzymes exhibit more pronounced pH dependences of DNA binding even in the absence of metal ions. Similar measurements with noncognate sequences indicate that divalent metal ions are not important to nonspecific DNA binding; K(d) values are approximately equal to 200 nM throughout the physiological pH range, a behavior shared with other endonucleases. While some of these results extend somewhat the range of expected behavior for restriction enzymes, these results indicate that PvuII endonuclease shares with other characterized systems a mechanism by which cognate affinity and sequence discrimination are most effectively achieved in the presence of divalent metal ions.     

Spectroscopic and calorimetric studies on the DNA recognition of pyrrolo[2,1-c][1,4]benzodiazepine hybrids

DNA binding of two hybrid ligands composed of an alkylating pyrrolo[2,1-c][1,4]benzodiazepine (PBD) moiety tethered to either a naphthalimide or a phenyl benzimidazole chromophore was studied by DNA melting experiments, UV and fluorescence titrations, CD spectroscopy and isothermal titration calorimetry (ITC). Binding of both hybrids results in a remarkable thermal stabilization with an increase of DNA melting temperatures by up to 40 °C for duplexes that allow for a covalent attachment of the PBD moiety to guanine bases in their minor groove. CD spectroscopic measurements suggest that the naphthalimide moiety of the drug interacts through intercalation. In contrast, the PBD-benzimidazole hybrid binds in the DNA minor groove with a preference for (A,T)₄G sequences. Whereas the binding of both ligands is enthalpy-driven and associated with a negative entropy, the benzimidazole hybrid exhibits a less favourable binding enthalpy that is counterbalanced by a more favourable entropic term when compared to the naphthalimide hybrid.     

DNA binding studies of antibiotic drug cephalexin using spectroscopic and molecular docking techniques

The purpose of this study was to explore an accurate characterization of the binding interaction of antibiotic drug cephalexin with calf thymus DNA (CT-DNA) as a relevant biological target by using UV absorption, fluorescence spectroscopy and circular dichroism (CD) in vitro under simulated physiological conditions (pH = 7.4) and also through a molecular modeling study. The results showed that the drug interacts with the DNA helix via a minor groove binding mode. The thermodynamic parameters were calculated and showed that the reaction between the drug and CT-DNA was exothermic. In addition, the drug enforced traceable changes in the viscosity of DNA. The molecular modeling results indicated that cephalexin forcefully binds to the minor groove of DNA with a relative binding energy of ?21.02?kJ mol^?1. The obtained theoretical results were in good agreement with those obtained from experimental studies.     

Plasma aluminum is bound to transferrin

Aluminum ion is bound to at least one of the two specific iron binding sites of serum transferrin and also to serum albumin, as shown by in vivo competition studies with 67-Ga, gel filtration chromatography and ultraviolet difference spectroscopy. Binding of aluminum to transferrin requires CO2 and therefore involves a specific iron site. Samples of commercial transferrin contained large amounts of aluminum. Aluminum may cause anemia by entering pathways of iron distribution and metabolism.     

The energetics of HMG box interactions with DNA: thermodynamics of the DNA binding of the HMG box from mouse sox-5

The energetics of the Sox-5 HMG box interaction with DNA duplexes, containing the recognition sequence AACAAT, were studied by fluorescence spectroscopy, isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC). Fluorescence titration showed that the association constant of this HMG box with the duplexes is of the order 4x10(7) M(-1), increasing somewhat with temperature rise, i.e. the Gibbs energy is -40 kJ mol(-1) at 5 degrees C, decreasing to -48 kJ mol(-1) at 32 degrees C. ITC measurements of the enthalpy of association over this temperature range showed an endothermic effect below 17 degrees C and an exothermic effect above, suggesting a heat capacity change on binding of about -4 kJ K(-1) mol(-1), a value twice larger than expected from structural considerations. A straightforward interpretation of ITC data in heat capacity terms assumes, however, that the heat capacities of all participants in the association reaction do not change over the considered temperature range. Our previous studies showed that over the temperature range of the ITC experiments the HMG box of Sox-5 starts to unfold, absorbing heat and the heat capacities of the DNA duplexes also increase significantly. These heat capacity effects differ from that of the DNA/Sox-5 complex. Correcting the ITC measured binding enthalpies for the heat capacity changes of the components and complex yielded the net enthalpies which exhibit a temperature dependence of about -2 kJ K(-1) mol(-1), in good agreement with that predicted on the basis of dehydration of the protein-DNA interface. Using the derived heat capacity change and the enthalpy and Gibbs energy of association measured at 5 degrees C, the net enthalpy and entropy of association of the fully folded HMG box with the target DNA duplexes was determined over a broad temperature range. These functions were compared with those for other known cases of sequence specific DNA/protein association. It appears that the enthalpy and entropy of association of minor groove binding proteins are more positive than for proteins binding in the major groove. The observed thermodynamic characteristics of protein binding to the A+T-rich minor groove of DNA might result from dehydration of both polar and non-polar groups at the interface and release of counterions. The expected entropy of dehydration was calculated and found to be too large to be compensated by the negative entropy of reduction of translational/rotational freedom. This implies that DNA/HMG box association proceeds with significant decrease of conformational entropy, i.e. reduction in conformational mobility.     

Spectral studies on aluminum ion binding to the ligands with phenolic group(s): implications for the differences between N- and C-terminal binding sites of human serum apotransferrin

Both the binding and releasing of ferric ions in C-, and N-terminal binding sites of human serum transferrin are different. To understand the difference here the interactions of aluminum with the ligands containing phenolic group(s), including 8-hydroxyquinoline, salicylic acid, N,N'-di(2-hydroxybenzyl)ethylenediamine-N,N'-diacetic acid, N,N'-ethylenebis[2-(o-hydroxyphenolic)glycine], and human serum apotransferrin, respectively, are investigated by using UV difference and fluorescence spectra methods in 0.1 M N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid at pH 7.4. Aluminum binding produces a UV difference peak near 235 nm that is characteristic of phenolic groups binding to aluminum. The peak at 235 nm has been used to determine conditional binding constants of log K(Al-HBED)=8.88+/-0.74 and log K(Al-EHPG)=9.38+/-0.03. However, the effects of aluminum binding on the fluorescence intensity of N,N'-ethylenebis[2-(o-hydroxyphenolic)glycine], salicylic acid and N,N'-di(2-hydroxybenzyl) ethylenediamine-N,N'-diacetic acid, 8-hydroxyquinoline are disparate, the former showing a decrease and the latter an increase. At pH 7.4, there is N cdots, three dots, centered H-O type intramolecular hydrogen bond in 8-hydroxyquinoline, N,N'-di(2-hydroxybenzyl) ethylenediamine-N,N'-diacetic acid and O cdots, three dots, centered H-O type intramolecular hydrogen bond in salicylic acid, N,N'-ethylenebis[2-(o-hydroxyphenolic)glycine]. The effects of salts on the fluorescence intensity of the ligands containing phenolic group(s) show that fluorescence emission increases with the breaking of an N cdots, three dots, centered H-O type intramolecular hydrogen bond and fluorescence emission decreases with the breaking of an O cdots, three dots, centered H-O type intramolecular hydrogen bond. Fluorescence titrations of apotransferrin and both forms of monoferric transferrin with aluminum indicated that there is O cdots, three dots, centered H-O type intramolecular hydrogen bonds for the phenolic groups of Tyr426 and Tyr517 in the C-terminal binding site. While N cdots, three dots, centered H-O type intramolecular hydrogen bonds are found for the phenolic groups of Tyr95 and Tyr188 in the N-terminal binding site.     

Induction of aluminum tolerance in wheat seedlings by low doses of aluminum in the nutrient solution

Preincubation of wheat (Triticum aestivum L. Thell.) seedlings in a nutrient solution containing low doses of aluminum (0.5 microgram per milliliter for tolerant cultivar Atlas 66 and 0.1 microgram per milliliter for the sensitive cultivar Grana) enabled substantial root regrowth of varieties grown in a lethal aluminum concentration, despite an increased accumulation of aluminum in root tissue of the pretreated seedlings. The distribution of aluminum in the subcellular fractions remained unchanged. The increase in tolerance was completely abolished by the addition of cycloheximide. Aluminum ions at sublethal concentrations significantly increased the incorporation of [¹⁴C]valine and [³H]thymidine in roots. The possible role of the synthesis of the inducible aluminum binding protein in the mechanism of aluminum tolerance is discussed.     

Calorimetric and spectroscopic studies of aminoglycoside binding to AT-rich DNA triple helices

Calorimetric and fluorescence techniques were used to characterize the binding of aminoglycosides-neomycin, paromomycin, and ribostamycin, with 5′-dA₁₂-x-dT₁₂-x-dT₁₂-3′ intramolecular DNA triplex (x = hexaethylene glycol) and poly(dA)·2poly(dT) triplex. Our results demonstrate the following features: (1) UV thermal analysis reveals that the T_m for triplex decreases with increasing pH value in the presence of neomycin, while the T_m for the duplex remains unchanged. (2) The binding affinity of neomycin decreases with increased pH, although there is an increase in observed binding enthalpy. (3) ITC studies conducted in two buffers (sodium cacodylate and MOPS) yield the number of protonated drug amino groups (Δn) as 0.29 and 0.40 for neomycin and paromomycin interaction with 5′-dA₁₂-x-dT₁₂-x-dT₁₂-3′, respectively. (4) The specific heat capacity change (ΔC_p) determined by ITC studies is negative, with more negative values at lower salt concentrations. From 100 mM to 250 mM KCl, the ΔC_p ranges from −402 to −60 cal/(mol K) for neomycin. At pH 5.5, a more positive ΔC_p is observed, with a value of −98 cal/(mol K) at 100 mM KCl. ΔC_p is not significantly affected by ionic strength. (5) Salt dependence studies reveal that there are at least three amino groups of neomycin participating in the electrostatic interactions with the triplex. (6) FID studies using thiazole orange were used to derive the AC₅₀ (aminoglycoside concentration needed to displace 50% of the dye from the triplex) values. Neomycin shows a seven fold higher affinity than paromomycin and eleven fold higher affinity than ribostamycin at pH 6.8. (7) Modeling studies, consistent with UV and ITC results, show the importance of an additional positive charge in triplex recognition by neomycin. The modeling and thermodynamic studies indicate that neomycin binding to the DNA triplex depends upon significant contributions from charge as well as shape complementarity of the drug to the DNA triplex Watson–Hoogsteen groove.     

Influence of copper(II) and magnesium(II) ions on the ciprofloxacin binding to DNA

The influence of magnesium(II) and copper(II) ions on the binding of ciprofloxacin to double stranded calf thymus DNA was studied by fluorescence emission spectroscopy, ultraviolet- and circular dichroism (CD) spectroscopy. The interaction of ciprofloxacin and copper(II) ions was followed by strong fluorescence quenching which was almost unaffected by the presence of DNA. On the other hand, only a slight decrease in fluorescence emission intensity, which was enhanced in the presence of DNA, was observed for ciprofloxacin interaction with magnesium(II) ions. Furthermore, magnesium(II) ions increase the thermal stability of the DNA, while, in the presence of ciprofloxacin, the degree of stabilisation is smaller. In contrast, copper(II) ions destabilise double helical DNA to heat, while ciprofloxacin slightly affects only the second transition of the biphasic melting curve of calf thymus DNA. Magnesium(II) ions at 25 degrees C induce conformational transitions of DNA at concentrations of 1.5 mM and 2.5 M, as monitored by CD. On the other hand copper(II) ions induce only one conformational transition, at a concentration of 12.7 microM. At higher concentrations of copper(II) ions (c>700 microM) DNA starts to precipitate. Significant changes in the CD spectra of DNA were observed after addition of ciprofloxacin to a solution containing DNA and copper(II) ions, but not to DNA and magnesium(II) ions. Based on our spectroscopic results, we propose that copper(II) ions are not directly involved into ciprofloxacin binding to DNA via phosphate groups as it has been suggested for magnesium(II) ions.     

Defining the secondary structural requirements of a cocaine-binding aptamer by a thermodynamic and mutation study

Isothermal titration calorimetry (ITC) was used to measure the binding affinity and thermodynamics of a cocaine-binding aptamer as a function of pH and NaCl concentration. Tightest binding was achieved at a pH value of 7.4 and under conditions of no added NaCl. These data indicate that ionic interactions occur in the ligand binding mechanism. ITC was also used to measure the binding thermodynamics of a variety of sequence variants of the cocaine-binding aptamer that analyzed which regions and nucleotides of the aptamer are important for maintaining high-affinity binding. Individually, each of the three stems can be shortened, resulting in a reduced binding affinity. If all three stems are shortened, no binding occurs. If all three of the stems in the aptamer are lengthened by five base pairs ligand affinity increases. Changes in nucleotide identity at the three-way junction all decrease the affinity of the aptamer to cocaine. The greatest decrease in affinity results from changes that disrupt the GA base pairs and the identity of T19.     

The effect of dimerization on the interaction of ibuprofen drug with calf thymus DNA: Molecularmodeling and spectroscopic investigation

The interaction between the dimer structure of ibuprofen drug (D-IB) and calf thymus DNA under simulative physiological conditions was investigated with the use of Hoechst 33258 and methylene blue dye as spectral probes by the methods of UV-visible absorption, fluorescence spectroscopy, circular dichroism spectroscopy and molecular modeling study.Using the Job's plot, a single class of binding sites for theD-IB on DNA was put in evidence. The Stern–Volmer analysis of fluorescence quenching data shows the presence of both the static and dynamic quenching mechanisms. The binding constants, K_b were calculated at different temperatures, and the thermodynamic parameters ?G^°, ?H^° and ?S^° were given. The experimental results showed that D-IB molecules could bind with DNA via groove binding mode as evidenced by: I. DNA binding constant from spectrophotometric studies of the interaction of D-IB with DNA is comparable to groove binding drugs. II. Competitive fluorimetric studies with Hoechst 33258 have shown that D-IB exhibits the ability of this complex to displace with DNA-bounded Hoechst, indicating that it binds to DNA in strong competition with Hoechst for the groove binding. III. There is no significantly change in the absorption of the MB-DNA system upon adding the D-IB, indicates that MB molecules are not released from the DNA helix after addition of the D-IB and are indicative of a non-intercalative mode of binding. IV. Small changes in DNA viscosity in the presence of D-IB, indicating weak link to DNA, which is consistent with DNA groove binding. As well as, induced CD spectral changes, and the docking results revealed that groove mechanism is followed by D-IB to bind with DNA.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Aluminum speciation studies in biological fluids. Part 7. A quantitative investigation of aluminum(III)-malate complex equilibria and their potential implications for aluminum metabolism and toxicity.

As a nonessential element, aluminum may be toxic at both environmental and therapeutic levels, depending on ligand interactions. Dietary acids that normally occur in fruits and vegetables and commonly serve as taste enhancers are good ligands of the Al(3+) ion. Malic acid is one of these and also one of the most predominant in food and beverages. The present paper reports an examination of its potential influence on aluminum bioavailability through speciation calculations based on Al(III)-malate complex formation constants especially determined for physiological conditions. According to the results obtained, malate appears to be extremely effective in maintaining Al(OH)(3) soluble over the whole pH range of the small intestine under normal dietary conditions. In addition, two neutral Al(III)--malate complexes are formed whose percentages are maximum from very low malate levels. When aluminum is administered therapeutically as its trihydroxide, the amount of metal neutralized by malate peaks as its solubility pH range regresses to its original limits in the absence of malate. The enhancing effect of malate towards aluminum absorption is therefore virtually independent of the aluminum level in the gastrointestinal tract. The presence of phosphate in the gastrointestinal juice is expected to limit the potential influence of malate on aluminum absorption. Under normal dietary conditions, phosphate effectively reduces the fraction of aluminum neutralized by malate but without nullifying it. Aluminum phosphate is predicted to precipitate when aluminum levels are raised as with the administration of aluminum hydroxide, but a significant amount of neutral aluminum malate still remains in solution. Even therapeutic aluminum phosphate is not totally safe in the presence of malate, even at low malate concentrations. As plasma simulations predict that no compensatory effect in favor of aluminum excretion may be expected from malate, simultaneous ingestion of malic acid with any therapeutic aluminum salt should preferably be avoided.     

DNA binding of tilorone: 1H NMR and calorimetric studies of the intercalation

The fluorene derivative tilorone has received great attention as a DNA intercalator and has been widely recognized as an inducer of interferon. The biological activity of tilorone is known to be related to its binding mode with DNA; however, few structural and thermodynamic studies have elaborated on this issue. This paper presents two-dimensional (2-D) NMR and isothermal titration calorimetry (ITC) for the tilorone/DNA complex, coupled with circular dichroism (CD) spectroscopy and viscosity measurements. NMR investigation suggests that tilorone binds to DNA through intercalation, showing greater affinity for insertion between AT base pairs than between CG pairs. CD spectral changes were observed for T/B (tilorone/DNA base pair molar ratio) ratios greater than the stoichiometric ratio generally expected for intercalators (i.e., T/B = 0.5, according to the neighbor-exclusion principle). However, there was a clear plateau in the CD intensity between T/B < 0.35 and T/B > 0.45. From comparison with NMR and other measurements, we postulate that CD changes below the plateau should be related to the intercalation and the latter to electrostatic interactions and nonspecific bindings. ITC data showed that DeltaH < -TDeltaS < 0, which indicated that tilorone/DNA binding is enthalpy controlled. The magnitude of Kb (the binding constant) was of the same order as that of ethidium bromide. The stoichiometric number, obtained from ITC, CD, and UV data, implied a relatively smaller value (0.28-0.35) than that of the neighbor-exclusion principle. This is because side chains located in the groove disrupt further intercalation to the adjacent sites.     

Linker histone-DNA complexes: enhanced stability in the presence of aluminum lactate and implications for Alzheimer's disease

The binding of human brain linker histone proteins to a radiolabelled human Alu repetitive element was examined by mobility shift assay. Analysis of the complexes formed from protein extracts of whole neocortical nuclei, under physiological conditions in vitro revealed that linker histone H1(0) has the highest affinity for the Alu DNA sequence. The linker histone-DNA complexes assembled in the presence of aluminum lactate were more resistant to sodium chloride-induced dissociation than those formed in the presence of sodium lactate. The enhanced stability of deoxyribonucleoprotein (DNP) complexes in the presence of the aluminum cation may be of significance in neurodegenerative conditions such as Alzheimer's disease where aluminum preferentially associates with DNA containing structures of the nucleus.     

Complexity in the binding of minor groove agents: netropsin has two thermodynamically different DNA binding modes at a single site

Structural results with minor groove binding agents, such as netropsin, have provided detailed, atomic level views of DNA molecular recognition. Solution studies, however, indicate that there is complexity in the binding of minor groove agents to a single site. Netropsin, for example, has two DNA binding enthalpies in isothermal titration calorimetry (ITC) experiments that indicate the compound simultaneously forms two thermodynamically different complexes at a single AATT site. Two proposals for the origin of this unusual observation have been developed: (i) two different bound species of netropsin at single binding sites and (ii) a netropsin induced DNA hairpin to duplex transition. To develop a better understanding of DNA recognition complexity, the two proposals have been tested with several DNAs and the methods of mass spectrometry (MS), polyacrylamide gel electrophoresis (PAGE) and nuclear magnetic resonance spectroscopy in addition to ITC. All of the methods with all of the DNAs investigated clearly shows that netropsin forms two different complexes at AATT sites, and that the proposal for an induced hairpin to duplex transition in this system is incorrect.     

Inducible aluminum resistance of Acidiphilium cryptum and aluminum tolerance of other acidophilic bacteria

Aluminum ions are highly soluble in acidic environments. Toxicity of aluminum ions for heterotrophic, facultatively and obligately chemolithoautotrophic acidophilic bacteria was examined. Acidiphilium cryptum grew in glucose-mineral medium, pH 3, containing 300 mM aluminum sulfate [Al(2)(SO(4))(3)] after a lag phase of about 120 h with a doubling time of 7.6 h, as compared to 5.2 h of growth without aluminum. Precultivation with 1 mM Al(2)(SO(4))(3) and transfer to a medium with 300 mM Al(2)(SO(4))(3) reduced the lag phase from 120 to 60 h, and immediate growth was observed when A. cryptum was precultivated with 50 mM Al(2)(SO(4))(3), suggesting an aluminum-induced resistance. Aluminum resistance was not induced by Fe(3+) ions and divalent cations. Upon exposure of A. cryptum to 300 mM Al(2)(SO(4))(3), the protein profile changed significantly as determined by SDS-PAGE. When other acidophiles were cultivated with 50-200 mM aluminum sulfate, no lag phase was observed while the growth rates and the cellular yields were significantly reduced. This growth response was observed with Acidobacterium capsulatum, Acidiphilium acidophilum, Acidithiobacillus ferrooxidans, and Acidithiobacillus thiooxidans. Precultivation of these strains with aluminum ions did not alter the growth response caused by aluminum. The content of A. cryptum cultivated with 300 mM Al(2)(SO(4))(3)was 0.44 microg Al/mg cell dry weight, while that of the other strains cultivated with 50 mM Al(2)(SO(4))(3) ranged from 0.30 to 3.47 microg Al/mg cell dry weight.     

Siderophore-Mediated Aluminum Uptake by Bacillus megaterium ATCC 19213

The bacterium Bacillus megaterium ATCC 19213 is known to produce two hydroxamate siderophores, schizokinen and N-deoxyschizokinen, under iron-limited conditions. In addition to their high affinity for ferric ions, these siderophores chelate aluminum. Aluminum was absorbed by B. megaterium ATCC 19213 through the siderophore transport receptor, providing an extra pathway for aluminum accumulation into iron-deficient bacteria. At low concentrations of the metal, siderophore-mediated uptake was the dominant process for aluminum accumulation. At high concentrations of aluminum, passive transport dominated and siderophore production slowed the passive transport of aluminum into the cell. Siderophore production was affected by the aluminum content in the media. High concentrations of aluminum increased production of siderophores in iron-limited cultures, and this production continued into stationary phase. Aluminum did not stimulate siderophore production in iron-replete cultures. The production of siderophores markedly affected aluminum uptake. This has direct implications on the toxicity of heavy metals under iron-deficient conditions.