The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Structure and evolution of ribosomes

Ribosomes are the only cell organelles occurring in all organisms. E. coli ribosomes, which are the best characterized particles, consist of three RNAs and 53 proteins. All components have been isolated and characterized by chemical, physical and immunological methods. The primary structures of the RNAs and of all the proteins are known. Information about the secondary structure of the proteins derives from circular dichroism measurements and from secondary structure prediction methods. The tertiary structure is being studied by limited proteolysis, proton magnetic resonance and crystallization followed by X-ray analysis. Various methods are being used to elucidate the architecture of the ribosomal particle: three-dimensional image reconstruction of crystals of bacterial ribosomes and/or their subunits; immune electron microscopy; neutron scattering; protein-protein, protein-RNA and RNA-RNA crosslinking; total reconstitution of ribosomal subunits. The results from these studies yield valuable information on the architecture of the ribosomal particle. Many mutants have been isolated in which one or a few ribosomal proteins are altered or even deleted. The genetic and biochemical characterization of these mutants allows conclusions about the importance of these proteins for the function of the ribosome. Ribosomal proteins from various prokaryotic and eukaryotic species have been compared by two-dimensional gel electrophoresis, immunological methods, reconstitution and amino acid sequence analysis. These studies show a strong homology among prokaryotic ribosomal proteins but only a weak homology between proteins from prokaryotic and eukaryotic ribosomes. Comparison of the primary and secondary structures of the ribosomal RNAs from various organisms shows that the secondary structure of the RNA molecules has been strongly conserved throughout evolution.     

Predicting common foldings of homologous RNAs.

A new approach is proposed for determining common RNA secondary structures within a set of homologous RNAs. The approach is a combination of phylogenetic and thermodynamic methods which is based on the prediction of optimal and suboptimal secondary structures, topological similarity searches and phylogenetic comparative analysis. The optimal and suboptimal RNA secondary structures are predicted by energy minimization. Structural comparison of the predicted RNA secondary structures is used to find conserved structures that are topologically similar in all these homologous RNAs. The validity of the conserved structural elements found is then checked by phylogenetic comparison of the sequences. This procedure is used to predict common structures of ribonuclease P (RNAase P) RNAs.     

Prediction of common folding structures of homologous RNAs.

We have developed an algorithm and a computer program for simultaneously folding homologous RNA sequences. Given an alignment of M homologous sequences of length N, the program performs phylogenetic comparative analysis and predicts a common secondary structure conserved in the sequences. When the structure is not uniquely determined, it infers multiple structures which appear most plausible. This method is superior to energy minimization methods in the sense that it is not sensitive to point mutation of a sequence. It is also superior to usual phylogenetic comparative methods in that it does not require manual scrutiny for covariation or secondary structures. The most plausible 1-5 structures are produced in O(MN2 + N3) time and O(N2) space, which are the same requirements as those of widely used dynamic programs based on energy minimization for folding a single sequence. This is the first algorithm probably practical both in terms of time and space for finding secondary structures of homologous RNA sequences. The algorithm has been implemented in C on a Sun SparcStation, and has been verified by testing on tRNAs, 5S rRNAs, 16S rRNAs, TAR RNAs of human immunodeficiency virus type 1 (HIV-1), and RRE RNAs of HIV-1. We have also applied the program to cis-acting packaging sequences of HIV-1, for which no generally accepted structures yet exist, and propose potentially stable structures. Simulation of the program with random sequences with the same base composition and the same degree of similarity as the above sequences shows that structures common to homologous sequences are very unlikely to occur by chance in random sequences.     

Use of linear regression model to compare RNA secondary structures

With more and more ribonucleic acid (RNA) secondary structures accumulated, the need for comparing different RNA secondary structures often arises in function prediction and evolutionary analysis. Numerous efficient algorithms were developed for comparing different RNA secondary structures, but challenges remain. In this paper, six new models based on the linear regression model were proposed for the comparison of RNA secondary structures. The proposed models were tested on a mixed data, containing six secondary structures from RNase P RNAs, three secondary structures from SSU rRNA and five secondary structures from 16S ribosomal RNAs. The results have shown the effectiveness of the proposed models. Moreover, the time complexity of our models is favorable by comparing with that of the existing methods which solve the similar problem.     

Lead-catalysed specific cleavage of ribosomal RNAs.

Ribosomes have long been known to require divalent metal ions for their functional integrity. Pb2+-induced cleavage of the sugar-phosphate backbone has now been used to probe for metal binding sites in rRNA. Only three prominent Pb2+cleavages have been detected, with cleavage sites 5' of G240 in 16S rRNA and two sites 5' of A505 and C2347 in 23S rRNA. All cleavages occur in non-paired regions of the secondary structure models of the rRNAs and can be competed for by high concentrations of Mg2+, Mn2+, Ca2+ and Zn2+ ions, suggesting that lead is bound to general metal binding sites. Although Pb2+ cleavage is very efficient, ribosomes with fragmented RNAs are still functional in binding tRNA and in peptidyl transferase activity, indicating that the scissions do not significantly alter ribosomal structure. One of the lead cleavage sites (C2347 in 23S RNA) occurs in the vicinity of a region which is implicated in tRNA binding and peptidyl transferase activity. These results are discussed in the light of a recent model which proposes that peptide bond formation might be a metal-catalysed process.     

A dynamic programming approach for finding common patterns in RNAs.

We developed a dynamic programming approach of computing common sequence structure patterns among two RNAs given their primary sequences and their secondary structures. Common patterns between two RNAs are defined to share the same local sequential and structural properties. The locality is based on the connections of nucleotides given by their phosphodiester and hydrogen bonds. The idea of interpreting secondary structures as chains of structure elements leads us to develop an efficient dynamic programming approach in time O(nm) and space O(nm), where n and m are the lengths of the RNAs. The biological motivation is given by detecting common, local regions of RNAs, although they do not necessarily share global sequential and structural properties. This might happen if RNAs fold into different structures but share a lot of local, stable regions. Here, we illustrate our algorithm on Hepatitis C virus internal ribosome entry sites. Our method is useful for detecting and describing local motifs as well. An implementation in C++ is available and can be obtained by contacting one of the authors.     

Cytoplasmic location of undermethylated messenger RNA in Novikoff cells.

Novikoff cells in culture were labeled with L-[methyl-3H]methionine and [U-14C]uridine in the presence of (a) TubHcy2, (b) AdoHcy, (c) homocysteine, (d) tubercidin, or (e) without any additions. Only in cultures labeled in the presence of TubHcy were undermethylated cap structures observed to represent a significant portion of [3H]methyl radioactivity. Novikoff cells in culture were then simultaneously labeled with L-[methyl-3H]methionine and [32P]orthophosphate in the presence or absence of TubHcy. Total cytoplasmic, polysomal and monosomal poly(A)-containing RNAs were analyzed. Both monosomal and polysomal mRNA fractions from TubHcy-treated cells contain partially methylated cap structures, suggesting that 2'-O-methylation of the nucleoside adjacent to the pyrophosphate linkage in caps is not required for transport, ribosomal binding or translation. Comparison of nuclear and cytoplasmic cap structures from normal and inhibited cultures indicate that an altered mRNA population is generated in the presence of TubHcy.     

Cation-induced conformational changes in tRNA molecules

The uv absorption spectra and melting profiles of an initially ion-free solution of E. coli unfractionated tRNA are significantly modified by the addition of either Na⁺, Mg²⁺, or Mn²⁺ or of other first-series transition-metal ions such as Ni²⁺, Co²⁺, and Zn²⁺. The main effect of the addition of all monovalent or divalent cations examined is an increase of the ordered and stacking stabilized tRNA structure, as revealed by a drop in the absorption near 260 nm, as well as in the 4-TU absorption region. Sharp differences have, however, been detected in the 290–305-nm range in the presence of the various ions studied. When transition-metal ions were added to a tRNA solution, an absorption peak appeared at 294 nm. This effect is interpreted as a perturbation of the electronic structure of the bases due to direct binding of metal ions to the bases. An analysis of the variation in the spectrum as a function of metal concentration and of the thermal melting reversibility in the presence of various metal ions supports the conclusion that while all ions investigated are involved in binding to the phosphate groups of tRNA, transition-metal ions are also able to bind directly to the bases.     

Complete DNA sequence coding for the large ribosomal RNA of yeast mitochondria.

The mitochondrial gene coding for the large ribosomal RNA (21S) has been isolated from a rho- clone of Saccharomyces cerevisiae. A DNA segment of about 5500 base pairs has been sequenced which included the totality of the sequence coding for the mature ribosomal RNA and the intron. The mature RNA sequence corresponds to a length of 3273 nucleotides. Despite the very low guanine-cytosine content (20.5%), many stretches of sequence are homologous to the corresponding Escherichia coli 23S ribosomal RNA. The sequence can be folded into a secondary structure according to the general models for prokaryotic and eukaryotic large ribosomal RNAs. Like the E.coli gene, the mitochondrial gene contains the sequences that look like the eukaryotic 5.8S and the chloroplastic 4.5S ribosomal RNAs. The 5' and 3' end regions show a complementarity over fourteen nucleotides.     

Pattern analysis of RNA secondary structure similarity and consensus of minimal-energy folding

We describe an automated procedure to search for consensus structures or substructures in a set of homologous or related RNA molecules. The procedure is based on the calculation of optimal and sub-optimal secondary structures using thermodynamic rules for base-pairing by energy-minimization. A linear representation of the secondary structures of the related RNAs is used so that they can be compared and classified using standard alignment and clusterings programs. We illustrate the method by means of two sets of homologous small RNAs, U2 and U3, and a set of alpha-globin mRNAs and show that biologically interesting consensus structures are obtained.     

Biochemical analysis of hatchet self-cleaving ribozymes

Hatchet RNAs are members of a novel self-cleaving ribozyme class that was recently discovered by using a bioinformatics search strategy. The consensus sequence and secondary structure of this class includes 13 highly conserved and numerous other modestly conserved nucleotides interspersed among bulges linking four base-paired substructures. A representative hatchet ribozyme from a metagenomic source requires divalent ions such as Mg²⁺ to promote RNA strand scission with a maximum rate constant of ∼4 min⁻¹. As with all other small self-cleaving ribozymes discovered to date, hatchet ribozymes employ a general mechanism for catalysis involving the nucleophilic attack of a ribose 2′-oxygen atom on an adjacent phosphorus center. Kinetic characteristics of the reaction demonstrate that members of this ribozyme class have an essential requirement for divalent metal ions and that they might have a complex active site that employs multiple catalytic strategies to accelerate RNA cleavage by internal phosphoester transfer.     

Complementary metal ion specificity of the metal-citrate transporters CitM and CitH of Bacillus subtilis

Citrate uptake in Bacillus subtilis is stimulated by a wide range of divalent metal ions. The metal ions were separated into two groups based on the expression pattern of the uptake system. The two groups correlated with the metal ion specificity of two homologous B. subtilis secondary citrate transporters, CitM and CitH, upon expression in Escherichia coli. CitM transported citrate in complex with Mg(2+), Ni(2+), Mn(2+), Co(2+), and Zn(2+) but not in complex with Ca(2+), Ba(2+), and Sr(2+). CitH transported citrate in complex with Ca(2+), Ba(2+), and Sr(2+) but not in complex with Mg(2+), Ni(2+), Mn(2+), Co(2+), and Zn(2+). Both transporters did not transport free citrate. Nevertheless, free citrate uptake could be demonstrated in B. subtilis, indicating the expression of at least a third citrate transporter, whose identity is not known. For both the CitM and CitH transporters it was demonstrated that the metal ion promoted citrate uptake and, vice versa, that citrate promoted uptake of the metal ion, indicating that the complex is the transported species. The results indicate that CitM and CitH are secondary transporters that transport complexes of divalent metal ions and citrate but with a complementary metal ion specificity. The potential physiological function of the two transporters is discussed.     

Nucleotide sequences of three poriferan 5 S ribosomal RNAs.

We have determined the nucleotide sequences of 5 S ribosomal RNAs isolated from the sponges Halichondria panicea, Hymeniacidon sanguinea, and Haliclona oculata. The structures can be fitted in a universal five-helix secondary structure model (De Wachter, Chen and Vandenberghe (1982) Biochimie 64, 311-329) applicable to all 5 S RNAs hitherto sequenced. The base pairing scheme proves to be extremely conserved throughout the metazoan kingdom, yet four slightly different variants of the model may be distinguished among the 5 S RNAs from the seven animal phyla investigated until now.     

Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules, we were able to distinguish between primary and secondary cutting positions and also to establish the relative degree of cutting. The data reveal the predicted similarities of the higher order structure in the two RNAs but also demonstrate a few significant differences. The data also provide direct evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18.     

Computer-aided prediction of RNA secondary structures.

A brief survey of computer algorithms that have been developed to generate predictions of the secondary structures of RNA molecules is presented. Two particular methods are described in some detail. The first utilizes a thermodynamic energy minimization algorithm that takes into account the likelihood that short-range folding tends to be favored over long-range interactions. The second utilizes an interactive computer graphic modelling algorithm that enables the user to consider thermodynamic criteria as well as structural data obtained by nuclease susceptibility, chemical reactivity and phylogenetic studies. Examples of structures for prokaryotic 16S and 23S ribosomal RNAs, several eukaryotic 5S ribosomal RNAs and rabbit beta-globin messenger RNA are presented as case studies in order to describe the two techniques. Anm argument is made for integrating the two approaches presented in this paper, enabling the user to generate proposed structures using thermodynamic criteria, allowing interactive refinement of these structures through the application of experimentally derived data.     

Formation of a hexagonal lattice structure by an R-form lipopolysaccharide of Klebsiella: effect of various divalent cations on the lattice formation

The R-form lipopolysaccharide from Klebsiella pneumoniae strain LEN-111 (O3-:K1-), from which cationic material had been removed by electrodialysis, was previously shown to form a hexagonal lattice structure with the lattice constant of 14 to 15 nm when suspended in 50 mM tris(hydroxymethyl)aminomethane buffer at pH 8.5 containing 10 mM Mg2+. Under this experimental condition, effects of other divalent metal cations on the hexagonal assembly of the electrodialyzed LPS were compared with that of Mg2+. The Zn2+, Hg2+, Cu2+, and Ni2+ could produce essentially the same hexagonal lattice structure with the lattice constant of 14.5 to 15.0 nm as that formed with Mg2+. The Cd2+, Co2+, and Fe2+ produced the hexagonal lattice structure with the lattice constant of 15.5 to 16.0 nm, and Ba2+, Sr2+, and Ca2+ produced that with the lattice constant of 18 to 19 nm. In addition, the hexagonal lattice structures formed with the latter three cations were less orderly than those formed with the other cations. When the higher concentrations of Ba2+, Sr2+, and Ca2+ were used, the lattice constants were not shortened. The length of lattice constants of the hexagonal lattice structures formed with the divalent cations did not relate to the quantity of the cations bound to the LPS. Among the divalent cations tested, Hg2+ was bound to the LPS in the smallest amount (its atomic ratio to P, 0.07), and Zn2+ and Fe2+ were bound in very large amounts (their atomic ratios to P, 2.94 and 8.28, respectively).     

Metal ion probing of rRNAs: evidence for evolutionarily conserved divalent cation binding pockets.

Ribosomes are multifunctional RNP complexes whose catalytic activities absolutely depend on divalent metal ions. It is assumed that structurally and functionally important metal ions are coordinated to highly ordered RNA structures that form metal ion binding pockets. One potent tool to identify the structural surroundings of high-affinity metal ion binding pockets is metal ion-induced cleavage of RNA. Exposure of ribosomes to divalent metal ions, such as Pb2+, Mg2+, Mn2+, and Ca2+, resulted in site-specific cleavage of rRNAs. Sites of strand scission catalyzed by different cations accumulate at distinct positions, indicating the existence of general metal ion binding centers in the highly folded rRNAs in close proximity to the cleavage sites. Two of the most efficient cleavage sites are located in the 5' domain of both 23S and 16S rRNA, regions that are known to self-fold even in the absence of ribosomal proteins. Some of the efficient cleavage sites were mapped to the peptidyl transferase center located in the large ribosomal subunit. Furthermore, one of these cleavages was clearly diminished upon AcPhe-tRNA binding to the P site, but was not affected by uncharged tRNA. This provides evidence for a close physical proximity of a metal ion to the amino acid moiety of charged tRNAs. Interestingly, comparison of the metal ion cleavage pattern of eubacterial 70S with that of human 80S ribosomes showed that certain cleavage sites are evolutionarily highly conserved, thus demonstrating an identical location of a nearby metal ion. This suggests that cations, bound to evolutionarily constrained binding sites, are reasonable candidates for being of structural or functional importance.