共查询到20条相似文献,搜索用时 484 毫秒
1.
Zhao Xin‐feng Huang Jing‐jing Li Qian Wei Lu‐sha Zheng Jian‐bin Zheng Xiao‐hui Li Zi‐jian Zhang You‐yi 《Journal of molecular recognition : JMR》2013,26(5):252-257
The development of new approaches to study the affinity between ligands and G‐protein‐coupled receptors proves to be of growing interest for pharmacologists, chemists, and biologists. The aim of this work was to determine the binding of seven drugs to β2‐adrenoceptors by frontal analysis using immobilized receptor stationary phase. The dissociation constants (Kd) were determined to be (3.16 ± 0.09) × 10?4 M for salbutamol, (4.29 ± 0.12) × 10?4 M for terbutaline, (6.19 ± 0.16) × 10?4 M for methoxyphenamine, (2.11 ± 0.07) × 10?4 M for tulobuterol, (1.82 ± 0.11) × 10?4 M for fenoterol, (9.75 ± 0.24) × 10?6 M formoterol, and (9.84 ± 0.26) × 10?5 M for clenbuterol. These results showed a good correlation with the data determined by radioligand binding assay. Further investigations revealed that the dissociation constant mainly attributed to the number of hydrogen bonds in the structures of ligands. This study indicates that affinity chromatography using immobilized receptor stationary phase can be used for the direct determination of drug‐receptor binding interactions and has the potential to become a reliable alternative for quantitative studies of ligand–receptor interactions. Copyright © 2013 John Wiley & Sons, Ltd. 相似文献
2.
Ajish S. R. Potty Katerina Kourentzi Han Fang George W. Jackson Xing Zhang Glen B. Legge Richard C. Willson 《Biopolymers》2009,91(2):145-156
The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF165) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant kon = 4.79 ± 0.03 × 104 M?1 s?1 and a dissociation rate constant koff = 5.21 ± 0.02 × 10?4 s?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com 相似文献
3.
Vascular endothelial growth factor receptor 2 (VEGFR‐2) plays a critical role in tumor angiogenesis. None therapeutic antibodies targeting VEGFR‐2 are available in clinical use. Herein, we describe the screening of a new single‐chain antibody fragment (scFv) targeting extracellular domain 3 of human VEGFR‐2 (kinase insert domain‐containing receptor [KDR]3) from Griffin phage display scFv library. A comprehensive sequence analysis was performed to assign the framework and complementary‐determining regions. The scFv exerted particular binding sites to KDR3 on molecular docking, and the binding affinity was further convinced by binding analysis both in quantitative ELISA and real‐time kinetic determination by biosensors (KD = 40 nM). Finally, the scFv was revealed to inhibit VEGF‐stimulated proliferation of human umbilical vein endothelial cells (HUVECs; IC50 = 5 nM) and to inhibit HUVEC migration significantly at 17 nM. Taken together, our results indicate that we have successfully isolated a scFv which differentially recognizes KDR3 and has potential clinical applications in the treatment of angiogenesis related diseases. © 2012 American Institute of Chemical Engineers Biotechnol. Prog., 28: 981–989, 2012 相似文献
4.
Que‐Tien Tran Robert A. Pearlstein Sarah Williams John Reilly Thomas Krucker Gül Erdemli 《Proteins》2014,82(11):2998-3012
The emergence of Gram‐negative “superbugs” exhibiting resistance to known antibacterials poses a major public health concern. Low molecular weight Gram‐negative antibacterials are believed to penetrate the outer bacterial membrane (OM) through porin channels. Therefore, intracellular exposure needed to drive antibacterial target occupancy should depend critically on the translocation rates through these proteins and avoidance of efflux pumps. We used electrophysiology to study the structure‐translocation kinetics relationships of a set of carbapenem antibacterials through purified porin OmpC reconstituted in phospholipid bilayers. We also studied the relative susceptibility of OmpC+ and OmpC‐ E. coli to these compounds as an orthogonal test of translocation. Carbapenems exhibit good efficacy in OmpC‐expressing E. coli cells compared with other known antibacterials. Ertapenem, which contains an additional acidic group compared to other analogs, exhibits the fastest entry into OmpC (kon ≈ 2 × 104 M?1 s?1). Zwitterionic compounds with highly polar groups attached to the penem‐2 ring, including panipenem, imipenem and doripenem exhibit faster kon (>104 M?1 s?1), while meropenem and biapenem with fewer exposed polar groups exhibit slower kon (~5 × 103 M?1 s?1). Tebipenem pivoxil and razupenem exhibit ~13‐fold slower kon (~1.5 × 103 M?1 s?1) than ertapenem. Overall, our results suggest that (a) OmpC serves as an important route of entry of these antibacterials into E. coli cells; and (b) that the structure‐kinetic relationships of carbapenem translocation are governed by H‐bond acceptor/donor composition (in accordance with our previous findings that the enthalpic cost of transferring water from the constriction zone to bulk solvent increases in the presence of exposed nonpolar groups). Proteins 2014; 82:2998–3012. © 2014 Wiley Periodicals, Inc. 相似文献
5.
Paola Magotti Daniel Ricklin Hongchang Qu You‐Qiang Wu Yiannis N. Kaznessis John D. Lambris 《Journal of molecular recognition : JMR》2009,22(6):495-505
Compstatin is a 13‐residue peptide that inhibits activation of the complement system by binding to the central component C3 and its fragments C3b and C3c. A combination of theoretical and experimental approaches has previously allowed us to develop analogs of the original compstatin peptide with up to 264‐fold higher activity; one of these analogs is now in clinical trials for the treatment of age‐related macular degeneration (AMD). Here we used functional assays, surface plasmon resonance (SPR), and isothermal titration calorimetry (ITC) to assess the effect of modifications at three key residues (Trp‐4, Asp‐6, Ala‐9) on the affinity and activity of compstatin and its analogs, and we correlated our findings to the recently reported co‐crystal structure of compstatin and C3c. The KD values for the panel of tested analogs ranged from 10?6 to 10?8 M. These differences in binding affinity could be attributed mainly to differences in dissociation rather than association rates, with a >4‐fold range in kon values (2–10 × 105 M?1 s?1) and a koff variation of >35‐fold (1–37 × 10?2 s?1) being observed. The stability of the C3b‐compstatin complex seemed to be highly dependent on hydrophobic effects at position 4, and even small changes at position 6 resulted in a loss of complex formation. Induction of a β‐turn shift by an A9P modification resulted in a more favorable entropy but a loss of binding specificity and stability. The results obtained by the three methods utilized here were highly correlated with regard to the activity/affinity of the analogs. Thus, our analyses have identified essential structural features of compstatin and provided important information to support the development of analogs with improved efficacy. Copyright © 2009 John Wiley & Sons, Ltd. 相似文献
6.
Irene Schaffner Stefan Hofbauer Michael Krutzler Katharina F. Pirker Marzia Bellei Gerhard Stadlmayr Georg Mlynek Kristina Djinovic‐Carugo Gianantonio Battistuzzi Paul G. Furtmüller Holger Daims Christian Obinger 《Molecular microbiology》2015,96(5):1053-1068
It is demonstrated that cyanobacteria (both azotrophic and non‐azotrophic) contain heme b oxidoreductases that can convert chlorite to chloride and molecular oxygen (incorrectly denominated chlorite ‘dismutase’, Cld). Beside the water‐splitting manganese complex of photosystem II, this metalloenzyme is the second known enzyme that catalyses the formation of a covalent oxygen–oxygen bond. All cyanobacterial Clds have a truncated N‐terminus and are dimeric (i.e. clade 2) proteins. As model protein, Cld from Cyanothece sp. PCC7425 (CCld) was recombinantly produced in Escherichia coli and shown to efficiently degrade chlorite with an activity optimum at pH 5.0 [kcat 1144 ± 23.8 s?1, KM 162 ± 10.0 μM, catalytic efficiency (7.1 ± 0.6) × 106 M?1 s?1]. The resting ferric high‐spin axially symmetric heme enzyme has a standard reduction potential of the Fe(III)/Fe(II) couple of ?126 ± 1.9 mV at pH 7.0. Cyanide mediates the formation of a low‐spin complex with kon = (1.6 ± 0.1) × 105 M?1 s?1 and koff = 1.4 ± 2.9 s?1 (KD ~ 8.6 μM). Both, thermal and chemical unfolding follows a non‐two‐state unfolding pathway with the first transition being related to the release of the prosthetic group. The obtained data are discussed with respect to known structure–function relationships of Clds. We ask for the physiological substrate and putative function of these O2‐producing proteins in (nitrogen‐fixing) cyanobacteria. 相似文献
7.
Yuxin An Xia Li Huanmei Sun Wenhai Bian Zijian Li Youyi Zhang Xinfeng Zhao Xiaohui Zheng 《Journal of molecular recognition : JMR》2015,28(10):628-634
The bioactive ingredients in Semen sinapis were rapidly screened by immobilized β2‐adrenoceptor (β2‐AR) and target‐directed molecular docking. The methods involved the attachment of β2‐AR using any amino group in the receptor, the simultaneous separation and identification of the retention compounds by high‐performance affinity chromatography; the binding mechanism of the interesting compound to the receptor was investigated by zonal elution and molecular docking. Sinapine in Semen sinapis was proved to be the bioactive compound that specifically binds to the immobilized receptor. The association constant of sinapine to β2‐AR was determined to be 1.36 × 105 M?1 with a value of 1.27 × 10?6 M for the number of binding sites. Ionic bond was believed to be the driving force during the interaction between sinapine and β2‐AR. It is possible to become a powerful alternative for rapid screening of bioactive compounds from a complex matrix such as traditional Chinese medicine and further investigation on the drug–receptor interaction. Copyright © 2015 John Wiley & Sons, Ltd. 相似文献
8.
Yu. D. Ivanov A. V. Ivanov N. A. Petushkova O. G. Gara V. Yu. Kuznetsov A. V. Podoplelov A. I. Archakov 《Biochemistry (Moscow) Supplemental Series B: Biomedical Chemistry》2008,2(4):367-372
The interactions between cytochrome P450 2B4 (d-2B4), NADPH:cytochrome P450 reductase and cytochrome b5 have been investigated in the monomeric reconstituted P450 2B4-containing monooxygenase system in the presence of a substrate (7-pentoxyresorufin) and an electron donor, NADPH. Each partner was immobilized via its amino groups on the carboxymethyldextran biochip surface of the optical biosensor IAsys+. Such mode immobilization was not accompanied by any loss of activities of the immobilized proteins. The formation of binary d-Fp/d-2B4 complexes was registered. The association/dissociation rate constants (kon/koff) were (0.013 ± 0.005) × 106 M?1 s?1/0.05 ± 0.02 s?1, and dissociation constant (KD) was (0.26 ± 0.13) × 10?6 M. Comparison of kon, koff and KD values for d-Fp/d-2B4 complexes formed under hydroxylation (O-dealkylation) with corresponding constants obtained for the oxidized proteins of (0.10 ± 0.03) × 106 M?1 s?1/(0.14 ± 0.06) s?1, and (0.71 ± 0.37) × 10?6 M, respectively shows that the decrease in kon and an insignificant decrease in KD are associated with the increase of complex lifetime during transition from the oxidized to hydroxylation conditions. Complex formation between d-Fp and d-b5 was not registered in both hydroxylation conditions and in the case of oxidized forms of these proteins. In both cases formation of the ternary d-Fp/d-2B4/d-b5 complexes occurred. 相似文献
9.
In our previous work, we proposed that desolvation and resolvation of the binding sites of proteins can serve as the slowest steps during ligand association and dissociation, respectively, and tested this hypothesis on two protein‐ligand systems with known binding kinetics behavior. In the present work, we test this hypothesis on another kinetically‐determined protein‐ligand system—that of p38α and eight Type II BIRB 796 inhibitor analogs. The kon values among the inhibitor analogs are narrowly distributed (104 ≤ kon ≤ 105 M?1 s?1), suggesting a common rate‐determining step, whereas the koff values are widely distributed (10?1 ≤ koff ≤ 10?6 s?1), suggesting a spectrum of rate‐determining steps. We calculated the solvation properties of the DFG‐out protein conformation using an explicit solvent molecular dynamics simulation and thermodynamic analysis method implemented in WaterMap to predict the enthalpic and entropic costs of water transfer to and from bulk solvent incurred upon association and dissociation of each inhibitor. The results suggest that the rate‐determining step for association consists of the transfer of a common set of enthalpically favorable solvating water molecules from the binding site to bulk solvent. The rate‐determining step for inhibitor dissociation consists of the transfer of water from bulk solvent to specific binding site positions that are unfavorably solvated in the apo protein, and evacuated during ligand association. Different sets of unfavorable solvation are evacuated by each ligand, and the observed dissociation barriers are qualitatively consistent with the calculated solvation free energies of those sets. 相似文献
10.
Christopher M. Bianchetti George C. Blouin Eduard Bitto John S. Olson George N. Phillips Jr. 《Proteins》2010,78(4):917-931
The protein from Arabidopsis thaliana gene locus At1g79260.1 is comprised of 166‐residues and is of previously unknown function. Initial structural studies by the Center for Eukaryotic Structural Genomics (CESG) suggested that this protein might bind heme, and consequently, the crystal structures of apo and heme‐bound forms were solved to near atomic resolution of 1.32 Å and 1.36 Å, respectively. The rate of hemin loss from the protein was measured to be 3.6 × 10?5 s?1, demonstrating that it binds heme specifically and with high affinity. The protein forms a compact 10‐stranded β‐barrel that is structurally similar to the lipocalins and fatty acid binding proteins (FABPs). One group of lipocalins, the nitrophorins (NP), are heme proteins involved in nitric oxide (NO) transport and show both sequence and structural similarity to the protein from At1g79260.1 and two human homologues, all of which contain a proximal histidine capable of coordinating a heme iron. Rapid‐mixing and laser photolysis techniques were used to determine the rate constants for carbon monoxide (CO) binding to the ferrous form of the protein (k′CO = 0.23 μM?1 s?1, kCO = 0.050 s?1) and NO binding to the ferric form (k′NO = 1.2 μM–1 s–1, kNO = 73 s?1). Based on both structural and functional similarity to the nitrophorins, we have named the protein nitrobindin and hypothesized that it plays a role in NO transport. However, one of the two human homologs of nitrobindin contains a THAP domain, implying a possible role in apoptosis. Proteins 2010. © 2009 Wiley‐Liss, Inc. 相似文献
11.
Tangting Chen Jinling Dong Haiyan Zhou Xin Deng Rong Li Ni Chen Mao Luo Yongjie Li Jianbo Wu Liqun Wang 《Journal of cellular and molecular medicine》2020,24(16):9154-9164
Glycation of extracellular matrix proteins has been demonstrated to contribute to the pathogenesis of vascular complications. However, no previous report has shown the role of glycated fibronectin (FN) in vascular endothelial growth factor (VEGF)‐induced angiogenesis. Thus, this study aimed to investigate the effects of glycated FN on VEGF signalling and to clarify the molecular mechanisms involved. FN was incubated with methylglyoxal (MGO) in vitro to synthesize glycated FN, and human umbilical vein endothelial cells (HUVECs) were seeded onto unmodified and MGO‐glycated FN. Then, VEGF‐induced angiogenesis and VEGF‐induced VEGF receptor‐2 (VEGFR‐2) signalling activation were measured. The results demonstrated that normal FN‐positive bands (260 kD) vanished and advanced glycation end products (AGEs) appeared in MGO‐glycated FN and glycated FN clearly changed to a higher molecular mass. The glycation of FN inhibited VEGF‐induced VEGF receptor‐2 (VEGFR‐2), Akt and ERK1/2 activation and VEGF‐induced cell migration, proliferation and tube formation. The glycation of FN also inhibited the recruitment of c‐Src to VEGFR‐2 by sequestering c‐Src through receptor for AGEs (RAGE) and the anti‐RAGE antibody restored VEGF‐induced VEGFR‐2, Akt and ERK1/2 phosphorylation, endothelial cell migration, proliferation and tube formation. Furthermore, the glycation of FN significantly inhibited VEGF‐induced neovascularization in the Matrigel plugs implanted into subcutaneous tissue of mice. Taken together, these data suggest that the glycation of FN may inhibit VEGF signalling and VEGF‐induced angiogenesis by uncoupling VEGFR‐2‐c‐Src interaction. This may provide a novel mechanism for the impaired angiogenesis in diabetic ischaemic diseases. 相似文献
12.
D.B. Roberts 《FEBS letters》1983,156(1):193-196
Interaction of peanut agglutinin with MeUmbβGalβ(1→3)GalNAc was followed with the stopped-flow technique. The mechanism is a simple bimolecular association with k+ = 7.1 × 103 M?1. s?1 and k? = 0.24 s?1 at 25°C. The very slow dissociation rate of the complex strongly supports earlier conclusions that the combining site of peanut agglutinin is complementary to the Galβ(1→3)GalNac structure. 相似文献
13.
Identifying the antiasthmatic target of doxofylline using immobilized β2‐adrenoceptor based high‐performance affinity chromatography and site‐directed molecular docking 下载免费PDF全文
Yajun Zhang Kaizhu Zeng Jing Wang Haiyang Gao Yefei Nan Xiaohui Zheng 《Journal of molecular recognition : JMR》2016,29(10):492-498
As a xanthine derivative, doxofylline is believed to be dominant for fighting against asthma in practice. Unlike other xanthines, the antiasthmatic effects of doxofylline lack any definite proof of target and mediating mechanism according to previous reports. In this work, the interaction between doxofylline and β2‐AR was investigated by high performance affinity chromatography using frontal analysis and nonlinear model. The methodology involved the immobilization of β2‐AR on the silica gel by a random linking method, the determination of the binding parameters by frontal analysis and nonlinear chromatography and the exploration of the binding mechanism by site‐directed molecular docking. The association constant for doxofylline binding to immobilized β2‐AR was determined to be 7.70 × 104 M?1 by nonlinear chromatography and 5.91 × 104 M?1 by frontal analysis. Ser169 and Ser173 were the binding sites for the receptor–drug interaction on which hydrogen bond was believed to be the main driven force during the interaction. These results indicated that the antiasthmatic effects of doxofylline may be behind the mediating mechanism of β2‐AR. High performance affinity chromatography based on immobilized receptor has potential to become an alternative for drug target confirmation and drug–receptor interaction analysis. Copyright © 2016 John Wiley & Sons, Ltd. 相似文献
14.
Eric Sulpice Shunli Ding Béatrice Muscatelli‐Groux Mathieu Bergé Zhong Chao Han Jean Plouet Gérard Tobelem Tatyana Merkulova‐Rainon 《Biology of the cell / under the auspices of the European Cell Biology Organization》2009,101(9):525-539
Background information. Endothelial cells play a major role in angiogenesis, the process by which new blood vessels arise from a pre‐existing vascular bed. VEGF‐A (vascular endothelial growth factor‐A) is a key regulator of angiogenesis during both development and in adults. HGF (hepatocyte growth factor) is a pleiotropic cytokine that may promote VEGF‐A‐driven angiogenesis, although the signalling mechanisms underlying this co‐operation are not completely understood. Results. We analysed the effects of the combination of VEGF‐A and HGF on the activation of VEGFR‐2 (VEGF receptor‐2) and c‐met receptors, and on the stimulation of downstream signalling pathways in endothelial cells. We found that VEGFR‐2 and c‐met do not physically associate and do not transphosphorylate each other, suggesting that co‐operation involves signalling events more distal from receptor activation. We demonstrate that the VEGF isoform VEGF‐A165 and HGF stimulate a similar set of MAPKs (mitogen‐activated protein kinases), although the kinetics and strengths of the activation differ depending on the growth factor and pathway. An enhanced activation of the signalling was observed when endothelial cells were stimulated by the combination of VEGF‐A165 and HGF. Moreover, the combination of VEGF‐A and HGF results in a statistically significant synergistic activation of ERK1/2 (extracellular‐signal‐regulated kinase 1/2) and p38 kinases. We demonstrated that VEGF‐A165 and HGF activate FAK (focal adhesion kinase) with different kinetics and stimulate the recruitment of phosphorylated FAK to different subsets of focal adhesions. VEGF‐A165 and HGF regulate distinct morphogenic aspects of the cytoskeletal remodelling that are associated with the preferential activation of Rho or Rac respectively, and induce structurally distinct vascular‐like patterns in vitro in a Rho‐ or Rac‐dependent manner. Conclusions. Under angiogenic conditions, combining VEGF‐A with HGF can promote neovascularization by enhancing intracellular signalling and allowing more finely regulated control of the signalling molecules involved in the regulation of the cytoskeleton and cellular migration and morphogenesis. 相似文献
15.
A surface plasmon resonance assay for characterisation and epitope mapping of anti‐GLP‐1 antibodies 下载免费PDF全文
The incretin hormone glucagon‐like peptide‐1 (GLP‐1) has been subject to substantial pharmaceutical research regarding the treatment of type 2 diabetes mellitus. However, quantification of GLP‐1 levels remains complicated due to the low circulation concentration and concurrent existence of numerous metabolites, homologous peptides, and potentially introduced GLP‐1 receptor agonists. Surface plasmon resonance (SPR) facilitates real‐time monitoring allowing a more detailed characterisation of the interaction compared with conventional enzyme‐linked immunosorbent assays (ELISA). In this paper, we describe the development of the first SPR assays for characterisation of anti‐GLP‐1 antibodies for ELISA purposes. Binding responses were obtained on covalently immobilised anti‐GLP‐1 antibodies at 12°C, 25°C, and 40°C and fitted to a biomolecular (1:1) interaction model showing association rates of 1.01 × 103 to 4.54 × 103 M?1 s?1 and dissociation rates of 3.56 × 10?5 to 1.56 × 10?3 s?1 leading to affinities of 35.2 to 344 nM, depending on the temperature. Determination of thermodynamic properties revealed an enthalpy driven interaction (ΔH < ΔS < 0) with higher affinities at lower temperatures due to the formation and stabilisation of hydrogen bonds within the binding site primarily composed of polar amino acids (ΔCp < 0). Pair‐wise epitope mapping was performed on captured anti‐GLP‐1 antibodies followed by subsequent interaction with GLP‐1 (7‐36) and other anti‐GLP‐1 antibodies. A global evaluation of every binding response led to an epitope map elucidating the potential of various anti‐GLP‐1 antibody pairs for sandwich ELISA and hence pinpointing the optimal antibody combinations. The SPR assays proved capable of providing vital information for ELISA development endorsing it as a useful optimisation tool. 相似文献
16.
Weiwei Fan Chengxiang Li Xing Qin Shenxu Wang Hu Da Kang Cheng Ri Zhou Chao Tong Xiujuan Li Qingting Bu Congye Li Yaling Han Jun Ren Feng Cao 《Aging cell》2013,12(1):32-41
Aging population displays a much higher risk of peripheral arterial disease (PAD) possibly due to the higher susceptibility, poor prognosis, and fewer therapeutic options. This study was designed to examine the impact of combined multipotent adipose‐derived stromal cells (mADSCs) and sarpogrelate treatment on aging hindlimb ischemia and the mechanism of action involved. mADSCs (1.0 × 107) constitutively expressing enhanced green fluorescent protein (eGFP) or firefly luciferase (Fluc) reporter were engrafted into the hindlimb of aged Vegfr2‐luc transgenic or FVB/N mice subjected to unilateral femoral artery occlusion, followed by a further administration of sarpogrelate. Multimodality molecular imaging was employed to noninvasively evaluate mADSCs' survival and therapeutic efficacy against aging hindlimb ischemia. Aged Tg(Vegfr2‐luc) mice exhibited decreased inflammatory response, and downregulation of vascular endothelial growth factor (VEGF)/vascular endothelial growth factor receptor‐2 (VEGFR2) compared with young ones following hindlimb ischemia induction, resulting in angiogenesis insufficiency and decompensation for ischemia recovery. Engrafted mADSCs augmented inflammation‐induced angiogenesis to yield pro‐angiogenic/anti‐apoptotic effects partly via the VEGF/VEGFR2/mTOR/STAT3 pathway. Nonetheless, mADSCs displayed limited survival and efficacy following transplantation. Sarpogrelate treatment with mADSCs further upregulated mammalian target of rapamycin (mTOR)/STAT3 signal and modulated pro‐/anti‐inflammatory markers including IL‐1β/TNF‐α/IFN‐γ and IL‐6/IL‐10, which ultimately facilitated mADSCs' survival and therapeutic benefit in vivo. Sarpogrelate prevented mADSCs from hypoxia/reoxygenation‐induced cell death via a mTOR/STAT3‐dependent pathway in vitro. This study demonstrated a role of in vivo kinetics of VEGFR2 as a biomarker to evaluate cell‐derived therapeutic angiogenesis in aging. mADSCs and sarpogrelate synergistically restored impaired angiogenesis and inflammation modulatory capacity in aged hindlimb ischemic mice, indicating its therapeutic promise for PAD in the elderly. 相似文献
17.
《Journal of receptor and signal transduction research》2013,33(2-3):239-254
AbstractVascular endothelial growth factor receptors (VEGFR) are considered essential for angiogenesis. The VEGFR‐family proteins consist of VEGFR‐1/Flt‐1, VEGFR‐2/KDR/Flk‐1, and VEGFR‐3/Flt‐4. Among these, VEGFR‐2 is thought to be principally responsible for angiogenesis. However, the precise role of VEGFRs1–3 in endothelial cell biology and angiogenesis remains unclear due in part to the lack of VEGFR‐specific inhibitors. We used the newly described, highly selective anilinoquinazoline inhibitor of VEGFR‐2 tyrosine kinase, ZM323881 (5‐[[7‐(benzyloxy) quinazolin‐4‐yl]amino]‐4‐fluoro‐2‐methylphenol), to explore the role of VEGFR‐2 in endothelial cell function. Consistent with its reported effects on VEGFR‐2 [IC(50) < 2 nM], ZM323881 inhibited activation of VEGFR‐2, but not of VEGFR‐1, epidermal growth factor receptor (EGFR), platelet‐derived growth factor receptor (PDGFR), or hepatocyte growth factor (HGF) receptor. We studied the effects of VEGF on human aortic endothelial cells (HAECs), which express VEGFR‐1 and VEGFR‐2, but not VEGFR‐3, in the absence or presence of ZM323881. Inhibition of VEGFR‐2 blocked activation of extracellular regulated‐kinase, p38, Akt, and endothelial nitric oxide synthetase (eNOS) by VEGF, but did not inhibit p38 activation by the VEGFR‐1‐specific ligand, placental growth factor (PlGF). Inhibition of VEGFR‐2 also perturbed VEGF‐induced membrane extension, cell migration, and tube formation by HAECs. Vascular endothelial growth factor receptor‐2 inhibition also reversed VEGF‐stimulated phosphorylation of CrkII and its Src homology 2 (SH2)‐binding protein p130Cas, which are known to play a pivotal role in regulating endothelial cell migration. Inhibition of VEGFR‐2 thus blocked all VEGF‐induced endothelial cellular responses tested, supporting that the catalytic activity of VEGFR‐2 is critical for VEGF signaling and/or that VEGFR‐2 may function in a heterodimer with VEGFR‐1 in human vascular endothelial cells. 相似文献
18.
Agneta L. Sunehag Chiara Dalla Man Gianna Toffolo Morey W. Haymond Dennis M. Bier Claudio Cobelli 《Obesity (Silver Spring, Md.)》2009,17(2):233-239
Given the increase in the incidence of insulin resistance, obesity, and type 2 diabetes in children and adolescents, it would be of paramount importance to assess quantitative indices of insulin secretion and action during a physiological perturbation, such as a meal or an oral glucose‐tolerance test (OGTT). A minimal model method is proposed to measure quantitative indices of insulin secretion and action in adolescents from an oral test. A 7 h, 21‐sample OGTT was performed in 11 adolescents. The C‐peptide minimal model was identified on C‐peptide and glucose data to quantify indices of β‐cell function: static φs and dynamic φd responsivity to glucose from which total responsivity φ was also measured. The glucose minimal model was identified on glucose and insulin data to estimate insulin sensitivity, SI, which was compared to a reference measure, SIref, provided by a tracer method. Disposition indices, which adjust insulin secretion for insulin action, were then calculated. Indices of β‐cell function were φs = 51.35 ± 8.89 × 10?9min?1, φd = 1,392 ± 258 × 10?9, and φ = 82.09 ± 17.70 × 10?9min?1. Insulin sensitivity was SI = 14.19 ± 2.73 × 10?4, not significantly different from SIref = 14.96 ± 3.04 × 10?4 dl/kg·min per µU/ml, and well correlated: r = 0.98, P < 0.0001, thus indicating that SI can be accurately measured from an oral test. Disposition indices were DIs = 1,040 ± 201 × 10?14 dl/kg/min2 per pmol/l, DId = 33,178 ± 10,720 × 10?14 dl/kg/min per pmol/l, DI = 1,844 ± 522 × 10?14 dl/kg/min2 per pmol/l. Virtually the same minimal model assessment was obtained with a reduced 3 h, 9‐sample protocol. OGTT interpreted with C‐peptide and glucose minimal model has the potential to provide novel insight regarding the regulation of glucose metabolism in adolescents, and to evaluate the effect of obesity and interventions such as diet and exercise. 相似文献
19.
Giovanni Ferrari Brandoch D. Cook Vitaly Terushkin Giuseppe Pintucci Paolo Mignatti 《Journal of cellular physiology》2009,219(2):449-458
VEGF and TGF‐β1 induce angiogenesis but have opposing effects on endothelial cells. VEGF protects endothelial cells from apoptosis; TGF‐β1 induces apoptosis. We have previously shown that VEGF/VEGF receptor‐2 (VEGFR2) signaling mediates TGF‐β1 induction of apoptosis. This finding raised an important question: Does this mechanism stimulate or inhibit angiogenesis? Here we report that VEGF‐mediated apoptosis is required for TGF‐β1 induction of angiogenesis. In vitro the apoptotic effect of TGF‐β1 on endothelial cells is rapid and followed by a long period in which the cells are refractory to apoptosis induction by TGF‐β1. Inhibition of VEGF/VEGFR2 signaling abrogates formation of cord‐like structures by TGF‐β1 with an effect comparable to that of z‐VAD, an apoptosis inhibitor. Similarly, genetic deficiency of VEGF abolishes TGF‐β1 upregulation of endothelial cell differentiation and formation of vascular structures in embryoid bodies. In vivo TGF‐β1 induces endothelial cell apoptosis as rapidly as in vitro. Inhibition of VEGF blocks TGF‐β1 induction of both apoptosis and angiogenesis, an effect similar to that of z‐VAD. Thus, TGF‐β1 induction of angiogenesis requires a rapid and transient apoptotic effect mediated by VEGF/VEGFR2. This novel, unexpected role of VEGF and VEGFR2 indicates VEGF‐mediated apoptosis as a potential target to control angiogenesis. J. Cell. Physiol. 219: 449–458, 2009. © 2009 Wiley‐Liss, Inc. 相似文献
20.
Y.‐R. Lim R.‐Y. Yoon E.‐S. Seo Y.‐S. Kim C.‐S. Park D.‐K. Oh 《Journal of applied microbiology》2010,109(4):1188-1197
Aims: To characterize of a thermostable recombinant α‐l ‐arabinofuranosidase from Caldicellulosiruptor saccharolyticus for the hydrolysis of arabino‐oligosaccharides to l ‐arabinose. Methods and Results: A recombinant α‐l ‐arabinofuranosidase from C. saccharolyticus was purified by heat treatment and Hi‐Trap anion exchange chromatography with a specific activity of 28·2 U mg?1. The native enzyme was a 58‐kDa octamer with a molecular mass of 460 kDa, as measured by gel filtration. The catalytic residues and consensus sequences of the glycoside hydrolase 51 family of α‐l ‐arabinofuranosidases were completely conserved in α‐l ‐arabinofuranosidase from C. saccharolyticus. The maximum enzyme activity was observed at pH 5·5 and 80°C with a half‐life of 49 h at 75°C. Among aryl‐glycoside substrates, the enzyme displayed activity only for p‐nitrophenyl‐α‐l ‐arabinofuranoside [maximum kcat/Km of 220 m(mol l?1)?1 s?1] and p‐nitrophenyl‐α‐l ‐arabinopyranoside. This substrate specificity differs from those of other α‐l ‐arabinofuranosidases. In a 1 mmol l?1 solution of each sugar, arabino‐oligosaccharides with 2–5 monomer units were completely hydrolysed to l ‐arabinose within 13 h in the presence of 30 U ml?1 of enzyme at 75°C. Conclusions: The novel substrate specificity and hydrolytic properties for arabino‐oligosaccharides of α‐l ‐arabinofuranosidase from C. saccharolyticus demonstrate the potential in the commercial production of l ‐arabinose in concert with endoarabinanase and/or xylanase. Significance and Impact of the Study: The findings of this work contribute to the knowledge of hydrolytic properties for arabino‐oligosaccharides performed by thermostable α‐l ‐arabinofuranosidase. 相似文献