2‐Hydroxynaphthalene‐1‐carbaldehyde‐ and 2‐(Aminomethyl)pyridine‐Based Schiff Base CuII Complexes for DNA Binding and Cleavage

Three mononuclear Cu^II complexes, [CuCl(naph‐pa)] ( 1 ), [Cu(bipy)(naph‐pa)]Cl ( 2 ), and [Cu(naph‐pa)(phen)]Cl ( 3 ) ((naph‐pa)=Schiff base derived from the condensation of 2‐hydroxynaphthalene‐1‐carbaldehyde and 2‐picolylamine (=2‐(aminomethyl)pyridine), bipy=2,2′‐bypiridine, and phen=1,10‐phenanthroline) were synthesized and characterized. Complex 1 exhibits square‐planar geometry, and 2 and 3 exhibit square pyramidal geometry, where Schiff base and bipy/phen act as NNO and as NN donor ligands, respectively. CT (Calf thymus)‐DNA‐binding studies revealed that the complexes bind through intercalative mode and show good binding propensity (intrinsic binding constant K_b: 0.98×10⁵, 2.22×10⁵, and 2.67×10⁵ M ^?1 for 1 – 3 , resp.). The oxidative and hydrolytic DNA‐cleavage activity of these complexes has been studied by gel electrophoresis: all the complexes displayed chemical nuclease activity in the presence and absence of H₂O₂. From the kinetic experiments, hydrolytic DNA cleavage rate constants were determined as 2.48, 3.32, and 4.10 h^?1 for 1 – 3 , respectively. It amounts to (0.68–1.14)×10⁸‐fold rate enhancement compared to non‐catalyzed DNA cleavage, which is impressive. The complexes display binding and cleavage propensity to DNA in the order of 3 > 2 > 1 .     

1,2,3‐Triazole Tagged 3H‐Pyrano[2,3‐d]pyrimidine‐6‐carboxylate Derivatives: Synthesis,in Vitro Cytotoxicity,Molecular Docking and DNA Interaction Studies

A series of novel ethyl 2,7‐dimethyl‐4‐oxo‐3‐[(1‐phenyl‐1H‐1,2,3‐triazol‐4‐yl)methyl]‐4,5‐dihydro‐3H‐pyrano[2,3‐d]pyrimidine‐6‐carboxylate derivatives 7a – 7m were efficiently synthesized employing click chemistry approach and evaluated for in vitro cytotoxic activity against four tumor cell lines: A549 (human lung adenocarcinoma cell line), HepG2 (human hematoma), MCF‐7 (human breast adenocarcinoma), and SKOV3 (human ovarian carcinoma cell line). Among the compounds tested, the compounds 7a , 7b , 7f , 7l , and 7m have shown potential and selective activity against human lung adenocarcinoma cell line (A549) with IC₅₀ ranging from 0.69 to 6.74 μm . Molecular docking studies revealed that the compounds 7a , 7b , 7f , 7l , and 7m are potent inhibitors of human DNA topoisomerase‐II and also showed compliance with stranded parameters of drug likeness. The calculated binding constants, k_b, from UV/VIS absorptional binding studies of 7a and 7l with CT‐DNA were 10.77 × 10⁴, 6.48 × 10⁴, respectively. Viscosity measurements revealed that the binding could be surface binding mainly due to groove binding. DNA cleavage study showed that 7a and 7l have the potential to cleave pBR322 plasmid DNA without any external agents.     

Fine tuning of the catalytic activity of colicin E7 nuclease domain by systematic N‐terminal mutations

The nuclease domain of colicin E7 (NColE7) promotes the nonspecific cleavage of nucleic acids at its C‐terminal HNH motif. Interestingly, the deletion of four N‐terminal residues (446–449 NColE7 = KRNK) resulted in complete loss of the enzyme activity. R447A mutation was reported to decrease the nuclease activity, but a detailed analysis of the role of the highly positive and flexible N‐terminus is still missing. Here, we present the study of four mutants, with a decreased activity in the following order: NColE7  >> KGNK > KGNG ～ GGNK > GGNG. At the same time, the folding, the metal‐ion, and the DNA‐binding affinity were unaffected by the mutations as revealed by linear and circular dichroism spectroscopy, isothermal calorimetric titrations, and gel mobility shift experiments. Semiempirical quantum chemical calculations and molecular dynamics simulations revealed that K446, K449, and/or the N‐terminal amino group are able to approach the active centre in the absence of the other positively charged residues. The results suggested a complex role of the N‐terminus in the catalytic process that could be exploited in the design of a controlled nuclease.     

Expression of scFv‐Mel‐Gal4 triple fusion protein as a targeted DNA‐carrier in Escherichia Coli

Liver‐directed gene therapy has become a promising treatment for many liver diseases. In this study, we constructed a multi‐functional targeting molecule, which maintains targeting, endosome‐escaping, and DNA‐binding abilities for gene delivery. Two single oligonucleotide chains of Melittin (M) were synthesized. The full‐length cDNA encoding anti‐hepatic asialoglycoprotein receptor scFv C1 (C1) was purified from C1/pIT2. The GAL4 (G) gene was amplified from pSW50‐Gal4 by polymerase chain reaction. M, C1 and G were inserted into plasmid pGC4C26H to product the recombinant plasmid pGC‐C1MG. The fused gene C1MG was subsequently subcloned into plasmid pET32c to product the recombinant plasmid C1MG/pET32c and expressed in Escherichia coli BL21. The scFv‐Mel‐Gal4 triple fusion protein (C1MG) was purified with a Ni²⁺ chelating HiTrap HP column. The fusion protein C1MG of roughly 64 kD was expressed in inclusion bodies; 4.5 mg/ml C1MG was prepared with Ni²⁺ column purification. Western blot and immunohistochemistry showed the antigen‐binding ability of C1MG to the cell surface of the liver‐derived cell line and liver tissue slices. Hemolysis testing showed that C1MG maintained membrane‐disrupting activity. DNA‐binding capacity was substantiated by luciferase assay, suggesting that C1MG could deliver the DNA into cells efficiently on the basis of C1MG. Successful expression of C1MG was achieved in E. coli, and C1MG recombinant protein confers targeting, endosome‐escaping and DNA‐binding capacity, which makes it probable to further study its liver‐specific DNA delivery efficacy in vivo. Copyright © 2013 John Wiley & Sons, Ltd.     

Mass‐spectrometric characterization of phospholipids and their primary peroxidation products in rat cortical neurons during staurosporine‐induced apoptosis

The molecular diversity of phospholipids is essential for their structural and signaling functions in cell membranes. In the current work, we present, the results of mass spectrometric characterization of individual molecular species in major classes of phospholipids – phosphatidylcholine (PtdCho), phosphatidylethanolamine (PtdEtn), phosphatidylserine (PtdSer), phosphatidylinositol (PtdIns), sphingomyelin (CerPCho), and cardiolipin (Ptd₂Gro) – and their oxidation products during apoptosis induced in neurons by staurosporine (STS). The diversity of molecular species of phospholipids in rat cortical neurons followed the order Ptd₂Gro > PtdEtn >> PtdCho >> PtdSer > PtdIns > CerPCho. The number of polyunsaturated oxidizable species decreased in the order Ptd₂Gro >> PtdEtn > PtdCho > PtdSer > PtdIns > CerPCho. Thus a relatively minor class of phospholipids, Ptd₂Gro, was represented in cortical neurons by the greatest variety of both total and peroxidizable molecular species. Quantitative fluorescence HPLC analysis employed to assess the oxidation of different classes of phospholipids in neuronal cells during intrinsic apoptosis induced by STS revealed that three anionic phospholipids – Ptd₂Gro >> PtdSer > PtdIns – underwent robust oxidation. No significant oxidation in the most dominant phospholipid classes – PtdCho and PtdEtn – was detected. MS‐studies revealed the presence of hydroxy‐, hydroperoxy‐ as well as hydroxy‐/hydroperoxy‐species of Ptd₂Gro, PtdSer, and PtdIns. Experiments in model systems where total cortex Ptd₂Gro and PtdSer fractions were incubated in the presence of cytochrome c (cyt c) and H₂O₂, confirmed that molecular identities of the products formed were similar to the ones generated during STS‐induced neuronal apoptosis. The temporal sequence of biomarkers of STS‐induced apoptosis and phospholipid peroxidation combined with recently demonstrated redox catalytic properties of cyt c realized through its interactions with Ptd₂Gro and PtdSer suggest that cyt c acts as a catalyst of selective peroxidation of anionic phospholipids yielding Ptd₂Gro and PtdSer peroxidation products. These oxidation products participate in mitochondrial membrane permeability transition and in PtdSer externalization leading to recognition and uptake of apoptotic cells by professional phagocytes.     

Investigations on the interactions between naphthalimide‐based anti‐tumor drugs and human serum albumin by spectroscopic and molecular modeling methods

The interactions between the three kinds of naphthalimide‐based anti‐tumor drugs (NADA, NADB, NADC) and human serum albumin (HSA) under simulated physiological conditions were investigated by fluorescence spectroscopy, circular dichroism spectroscopy and molecular modeling. The results of the fluorescence quenching spectroscopy showed that the quenching mechanisms for different drugs were static and their affinity was in a descending order of NADA > NADB > NADC. The relative thermodynamic parameters indicated that hydrophobic force was the predominant intermolecular force in the binding of NAD to HSA, while van der Waals interactions and hydrogen bonds could not be ignored. The results of site marker competitive experiment confirmed that the binding site of HSA primarily took place in site I. Furthermore, the molecular modeling study was consistent with these results. The study of circular dichroism spectra demonstrated that the presence of NADs decreased the α‐helical content of HSA and induced the change of the secondary structure of HSA. Copyright © 2015 John Wiley & Sons, Ltd.     

Analysis of marker compounds with anti‐platelet aggregation effects in mailuoning injection using platelet binding assay combined with HPLC‐DAD‐ESI‐MS and solid‐phase extraction technique

Introduction – Mailuoning is prepared from a traditional formula of Chinese medicines and widely used as an antithrombotic agent. In this study, the platelet binding assay was used as a novel biospecific separation and analysis method to explore its active constituents, which could be considered as marker compounds for quality control. Objective – To establish a rapid and simple method to predict marker compounds in herbal medicine injection and evaluate the effects of those compounds. Material and methods – Platelets were used to bind and separate constituents. Binding constituents were analysed and taken as potential active compounds for further evaluation. Solid‐phase‐extraction was adopted to improve sensitivity. HPLC‐DAD and ESI‐MS were used to determine the binding constituents. Results – Five compounds were extracted through the platelet binding process and identified as neochlorogenic acid, caffeic acid, isochlorogenic acid and their isomers. Caffeic acid was selected for the flow cytometric assay to test its effect on platelets activation, which was determined by CD62P (P‐selectin) expression. The results indicated that caffeic acid could significantly inhibit platelet activation while chlorogenic acid did not. Conclusion – Caffeic acid could be considered as a marker compound of Mailuoning injection due to its anti‐platelet effect. The study also suggested that platelet binding assay combined with some preconcentration technique could be efficiently used to predict anti‐platelet compounds in complicated herbal medicines. Copyright © 2010 John Wiley & Sons, Ltd.     

Biophysical probing of the binding properties of a Cu(II) complex with G‐quadruplex DNA: an experimental and computational study

Telomerase inhibition through G‐quadruplex stabilization by small molecules is of great interest as a novel anticancer therapeutic strategy. Here, we show that newly synthesized Cu‐complex binds to G‐quadruplex DNA and induces changes in its stability. This biophysical interaction was investigated in vitro using spectroscopic, voltammetric and computational techniques. The binding constant for this complex to G‐quadruplex using spectroscopic and electrochemical methods is in the order of 10⁵. The binding stoichiometry was investigated using spectroscopic techniques and corresponded to a ratio of 1: 1. Fluorescence titration results reveal that Cu‐complex is quenched in the presence of G‐quadruplex DNA. Analysis of the fluorescence emission at different temperatures shows that ΔH° > 0, ΔS° > 0 and ΔG° < 0, and indicates that hydrophobic interactions played a major role in the binding processes. MD simulation results suggested that this ligand could stabilize the G‐quadruplex structure. An optimized docked model of the G‐quadruplex–ligand mixture confirmed the experimental results. Based on the results, we conclude that Cu‐complex as an anticancer candidate can bind and stabilize the G‐quadruplex DNA structure. Copyright © 2015 John Wiley & Sons, Ltd.     

Identification of a functional SNP in the 3′‐UTR of caprine MTHFR gene that is associated with milk protein levels

Xinong Saanen (n = 305) and Guanzhong (n = 317) dairy goats were used to detect SNPs in the caprine MTHFR 3′‐UTR by DNA sequencing. One novel SNP (c.*2494G>A) was identified in the said region. Individuals with the AA genotype had greater milk protein levels than did those with the GG genotype at the c.*2494 G>A locus in both dairy goat breeds (P < 0.05). Functional assays indicated that the MTHFR:c.2494G>A substitution could increase the binding activity of bta‐miR‐370 with the MTHFR 3′‐UTR. In addition, we observed a significant increase in the MTHFR protein level of AA carriers relative to that of GG carriers. These altered levels of MTHFR protein may account for the association of the SNP with milk protein level.     

Spectra,stability and labeling of 1‐(5‐carboxypentyl)‐4‐(2‐(N‐ethyl‐carbazole‐3‐yl) vinyl) pyridinium bromide with a large Stokes shift

Carbazole and its derivatives have been widely utilized as a functional building block in the fabrication of the organic medicine, pesticides, materials, etc., because of their excellent solubility, stability and biological activity. In this paper, 1‐(5‐carboxypentyl)‐4‐(2‐(N‐ethyl‐carbazole‐3‐yl) vinyl) pyridinium bromide with a large Stokes shift was synthesized and characterized by ¹H NMR and MS. The UV/vis absorption and fluorescence spectra in different solvents and at different pH values were investigated preliminarily. The photostability and thermostability were also studied and the results showed that the compound was stable. The compound was also used to label bovine serum albumin (BSA) and calf thymus (ct)DNA. The results showed that the fluorescence intensity is enhanced when labeling with BSA and the binding ability is stronger than ctDNA, making it may be used as a biological probe. Copyright © 2015 John Wiley & Sons, Ltd.     

Understanding the binding interaction between phenyl boronic acid P1 and sugars: determination of association and dissociation constants using S–V plots,steady‐state spectroscopic methods and molecular docking

Continuous monitoring of glucose and sugar sensing plays a vital role in diabetes control. The drawbacks of the present enzyme‐based sugar sensors have encouraged the investigation into alternate approaches to design new sensors. The popularity of fluorescence sensors is due to their ability to bind reversibly to compounds containing diol. In this study we investigated the binding ability of phenyl boronic acid P1 for monosaccharides and disaccharides (sugars) in aqueous medium at physiological pH 7.4 using steady‐state fluorescence and absorbance. P1 fluorescence was quenched due to formation of esters with sugars. Absorbance and fluorescence measurements led to results that indicated that the sugars studied could be ordered in terms of their affinity to P1, as stated: sucrose > lactose > galactose > xylose > ribose > arabinose. In each case, the slope of modified Stern–Volmer plots was nearly 1, indicating the presence of only a single binding site in boronic acids for sugars. Docking studies were carried out using Schrodinger Maestro v.11.2 software. The binding affinity of phenyl boronic acid P1 with periplasmic protein (PDB ID 2IPM and 2IPL) was estimated using GlideScore.     

Novel Oxaliplatin Derivatives with 1‐(Substituted Benzyl)azetidine‐3,3‐dicarboxylate Anions. Synthesis,Cytotoxicity, and Interaction with DNA

A series of oxaliplatin derivatives with (1R,2R)‐N¹‐alkyl‐1,2‐cyclohexane‐1,2‐diamine (alkyl=Bu or ⁱPr) as carrier ligands and 1‐(methoxy‐ or methyl‐substituted benzyl)azetidine‐3,3‐dicarboxylate anions as leaving groups were synthesized and spectrally characterized. Generally, Complexes 10 – 15 with an ⁱPr substituent at N(1) showed higher activities in vitro than carboplatin against MCF‐7 human breast carcinoma and A549 human non‐small‐cell lung cell lines, although they were less potent than oxaliplatin. The typical complex 14 exhibited cytotoxicity superior to that of carboplatin and comparable to that of oxaliplatin against two selected tumor cell lines. Additionally, agarose gel electrophoresis was applied to investigate the DNA‐cleavage ability of complex 14 , which demonstrated that it has a different mode of DNA distortion from that of oxaliplatin.     

High‐efficiency affinity precipitation of multiple industrial mAbs and Fc‐fusion proteins from cell culture harvests using Z‐ELP‐E2 nanocages

Affinity precipitation using Z‐elastin‐like polypeptide‐functionalized E2 protein nanocages has been shown to be a promising alternative to Protein A chromatography for monoclonal antibody (mAb) purification. We have previously described a high‐yielding, affinity precipitation process capable of rapidly capturing mAbs from cell culture through spontaneous, multivalent crosslinking into large aggregates. To challenge the capabilities of this technology, nanocage affinity precipitation was investigated using four industrial mAbs (mAbs A–D) and one Fc fusion protein (Fc A) with diverse molecular properties. A molar binding ratio of 3:1 Z:mAb was sufficient to precipitate >95% mAb in solution for all molecules evaluated at ambient temperature without added salt. The effect of solution pH on aggregation kinetics was studied using a simplified two‐step model to investigate the protein interactions that occur during mAb–nanocage crosslinking and to determine the optimal solution pH for precipitation. After centrifugation, the pelleted mAb–nanocage complex remained insoluble and was capable of being washed at pH ≥ 5 and eluted with at pH < 4 with >90% mAb recovery for all molecules. The four mAbs and one Fc fusion were purified from cell culture using optimal process conditions, and >94% yield and >97% monomer content were obtained. mAb A–D purification resulted in a 99.9% reduction in host cell protein and >99.99% reduction in DNA from the cell culture fluids. Nanocage affinity precipitation was equivalent to or exceeded expected Protein A chromatography performance. This study highlights the benefits of nanoparticle crosslinking for enhanced affinity capture and presents a robust platform that can be applied to any target mAb or Fc‐containing proteins with minimal optimization of process parameters.     

Design,Synthesis, and Cholinesterase Inhibition Assay of Coumarin‐3‐carboxamide‐N‐morpholine Hybrids as New Anti‐Alzheimer Agents

A new series of coumarin‐3‐carboxamide‐N‐morpholine hybrids 5a – 5l was designed and synthesized as cholinesterases inhibitors. The synthetic approach for title compounds was started from the reaction between 2‐hydroxybenzaldehyde derivatives and Meldrum's acid to afford corresponding coumarin‐3‐carboxylic acids. Then, amidation of the latter compounds with 2‐morpholinoethylamine or N‐(3‐aminopropyl)morpholine led to the formation of the compounds 5a – 5l . The in vitro inhibition screen against acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE) revealed that most of the synthesized compounds had potent AChE inhibitory while their BuChE inhibitions are moderate to weak. Among them, propylmorpholine derivative 5g (N‐[3‐(morpholin‐4‐yl)propyl]‐2‐oxo‐2H‐chromene‐3‐carboxamide) bearing an unsubstituted coumarin moiety and ethylmorpholine derivative 5d (6‐bromo‐N‐[2‐(morpholin‐4‐yl)ethyl]‐2‐oxo‐2H‐chromene‐3‐carboxamide) bearing a 6‐bromocoumarin moiety showed the most activity against AChE and BuChE, respectively. The inhibitory activity of compound 5g against AChE was 1.78 times more than that of rivastigmine and anti‐BuChE activity of compound 5d is approximately same as rivastigmine. Kinetic and docking studies confirmed the dual binding site ability of compound 5g to inhibit AChE.     

Synergetic DNA‐Cleaving Activities of the Metal Complexes of a Polyether‐Tethered Pyrrole‐polyamide Dimer

A simple polyether‐tethered pyrrole‐polyamide dimer 1 was synthesized in 50% yield from the reaction of 2,2,2‐trichloro‐1‐(1‐methyl‐4‐nitro‐1H‐pyrrol‐2‐yl)ethanone with 2,2′‐[1,2‐ethanediylbis(oxy)]bisethanamine, and fully characterized on the basis of ¹H‐ and ¹³C‐NMR, MS, HR‐MS, and IR data. Agarose gel‐electrophoresis study of the cleavage of plasmid pBR322 DNA by the complexes of compound 1 with seven metal ions indicated that most of the metal complexes were capable of efficiently cleaving DNA at pH 7.0 and 37°. Among them, the Cu^II complex exhibited the highest activity, with the maximal catalytic rate constant k_max and Michaelis constant K_M being 5.61 h^?1 and 7.30 mM , respectively. Spectroscopic, ESI‐MS, ethidium‐bromide (EB) displacement, and viscosity experiments indicated that compound 1 could form a 1 : 1 complex with Cu^II ion, and that this complex showed moderate binding affinity toward calf‐thymus DNA.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.