Subtype specific roles of mitogen activated protein kinases in L6E9 skeletal muscle cell differentiation

Role of mitogen activated protein kinases (MAPK) in skeletal muscle differentiation is not fully understood. We investigated subtype-specific functions and their interactions, if any, in the regulation of myogenic differentiation in L6E9 skeletal muscle cells. We show inhibition of extracellular signal-regulated kinase-1 and -2 (ERK-1/-2) and activation of p38 MAP kinase during the differentiation of L6E9 rat skeletal muscle cells under low serum condition. Inhibition of ERK-1/-2 activity dramatically enhanced differentiation as was evident from cellular morphology, expression of muscle differentiation specific marker proteins, suggesting that ERK-1/-2 activation may be inhibitory to initiation and progression of differentiation. In contrast, inhibition of p38 MAP kinase completely prevented differentiation; meaning p38 activation is required from the initiation till terminal differentiation of L6E9 cells. Moreover, inhibition of ERK-1/-2 activities enhanced the activation of p38 MAP kinase that resulted in enhancement of differentiation; whereas inhibition of p38 MAP kinase activity enhanced the ERK-1/-2 activities culminating in abrogation of differentiation. We conclude that ERK-1/-2 and p38 MAP kinase cascades oppositely regulate each other's function(s) thereby regulating L6E9 skeletal muscle differentiation.     

Rho‐associated coiled‐coil kinase 1 activation mediates amyloid precursor protein site‐specific Ser655 phosphorylation and triggers amyloid pathology

Rho‐associated coiled‐coil kinase 1 (ROCK1) is proposed to be implicated in Aβ suppression; however, the role for ROCK1 in amyloidogenic metabolism of amyloid precursor protein (APP) to produce Aβ was unknown. In the present study, we showed that ROCK1 kinase activity and its APP binding were enhanced in AD brain, resulting in increased β‐secretase cleavage of APP. Furthermore, we firstly confirmed that APP served as a substrate for ROCK1 and its major phosphorylation site was located at Ser655. The increased level of APP Ser655 phosphorylation was observed in the brain of APP/PS1 mice and AD patients compared to controls. Moreover, blockade of APP Ser655 phosphorylation, or inhibition of ROCK1 activity with either shRNA knockdown or Y‐27632, ameliorated amyloid pathology and improved learning and memory in APP/PS1 mice. These findings suggest that activated ROCK1 targets APP Ser655 phosphorylation, which promotes amyloid processing and pathology. Inhibition of ROCK1 could be a potential therapeutic approach for AD.     

The connexin43 gap junction protein is phosphorylated by protein kinase A and protein kinase C: In vivo and in vitro studies

There is general agreement that the connexin43 gap junction protein is a substrate for phosphorylation by protein kinase C but there is no similar consensus regarding the action of protein kinase A. Our previous studies demonstrated that channels formed by connexin43 were reversibly gated in response to microinjected protein kinase A and protein kinase C, but we did not determine whether these effects involved direct action on the connexin43 protein. Using a combination of in vivo metabolic labeling and in vitro phosphorylation of recombinant protein and synthetic peptides, we now find that connexin43 is a relatively poor substrate for purified protein kinase A compared to protein kinase C, but that phosphorylation can be accelerated by 8-Br-cAMP (8-bromoadenosine 3,5-cyclic monophosphate) which also enhances connexin43 synthesis but at a much slower rate than phosphorylation. Phosphorylation of a critical amino acid, Ser364, by protein kinase A, appears to be necessary for subsequent multiple phosphorylations by protein kinase C. However, protein kinase C can phosphorylate connexin43 at a reduced level in the absence of prior phosphorylation. The results suggest that the correct regulation of channels formed by connexin43 may require sequential phosphorylations of this protein by protein kinase A and protein kinase C.     

Analysis of protein phosphorylation: methods and strategies for studying kinases and substrates

Protein phosphorylation is a highly conserved mechanism for regulating protein function, being found in all prokaryotes and eukaryotes examined. Phosphorylation can alter protein activity or subcellular localization, target proteins for degradation and effect dynamic changes in protein complexes. In many cases, different kinases may be involved in each of these processes for a single protein, allowing a large degree of combinatorial regulation at the post-translational level. Therefore, knowing which kinases are activated during a response and which proteins are substrates is integral to understanding the mechanistic regulation of a wide range of biological processes. In this paper, I will describe methods for monitoring kinase activity, investigating kinase-substrate specificity, examining phosphorylation in planta and the determination of phosphorylation sites in a protein. In addition, strategic considerations for experimental design and variables will be discussed.     

The flip side of phospho‐signalling: Regulation of protein dephosphorylation and the protein phosphatase 2Cs

Protein phosphorylation is a key signalling mechanism and has myriad effects on protein function. Phosphorylation by protein kinases can be reversed by protein phosphatases, thus allowing dynamic control of protein phosphorylation. Although this may suggest a straightforward kinase–phosphatase relationship, plant genomes contain five times more kinases than phosphatases. Here, we examine phospho‐signalling from a protein phosphatase centred perspective and ask how relatively few phosphatases regulate many phosphorylation sites. The most abundant class of plant phosphatases, the protein phosphatase 2Cs (PP2Cs), is surrounded by a web of regulation including inhibitor and activator proteins as well as posttranslational modifications that regulate phosphatase activity, control phosphatase stability, or determine the subcellular locations where the phosphatase is present and active. These mechanisms are best established for the Clade A PP2Cs, which are key components of stress and abscisic acid signalling. We also describe other PP2C clades and illustrate how these phosphatases are highly regulated and involved in a wide range of physiological functions. Together, these examples of multiple layers of phosphatase regulation help explain the unbalanced kinase–phosphatase ratio. Continued use of phosphoproteomics to examine phosphatase targets and phosphatase–kinase relationships will be important for deeper understanding of phosphoproteome regulation.     

Selection and growth regulation of genetically modified cells with hapten‐specific antibody/receptor tyrosine kinase chimera

Although receptor tyrosine kinases (RTKs) play a pivotal role in the development and maintaining the homeostasis of the body, overexpression or mutation of RTKs often induces tumorigenesis or metastasis. To mimic the function of RTKs, we developed two fusion receptors consisting of anti‐fluorescein antibody single‐chain Fv, extracellular D2 domain of erythropoietin receptor and transmembrane/intracellular domains of epidermal growth factor receptor or c‐fms based on previously constructed antibody/cytokine receptor chimeras. The expression of these chimeric receptors in the hematopoietic cell line Ba/F3 and non‐hematopoietic cell line NIH/3T3 resulted in the activation of receptors themselves, downstream signaling molecules and cell proliferation in response to fluorescein‐conjugated BSA, leading to selective expansion of transduced cells up to almost 100%. These results indicate that the cognate antigen could activate the chimeric receptors even though the wild‐type extracellular domains were switched to the antibody fragment. This is the first study to show that our antigen‐mediated genetically modified cell amplification (AMEGA) system could be applied to non‐hematopoietic cells by utilizing antibody/RTK chimeras. © 2009 American Institute of Chemical Engineers Biotechnol. Prog., 2009     

The binding of actin to p38 MAPK and inhibiting its kinase activity<Emphasis Type="Italic">in vitro</Emphasis>

p38 MAP kinase mediates a signal pathway that is involved in many physiological and pathological processes such as inflammation, cellular stress, apoptosis, cell cycle and growth, ischemia/re-perfusion, and myocardium hypertrophy. To determine the molecular and regulative mechanism of p38 signal pathway, we usedin vitro binding methods to screen the proteins that interact with p38. Here we report two proteins from mouse macrophage RAW264.7 strain treated with lipopolysaccharide (LPS) or ultraviolet radiation (UV), binding directly to p38. One of them is β-actin identified by peptide mass spectrum and ProFound program. Actin can inhibit the autophosphorylation of p38 and the phosphorylation of ATF by p38. It suggests that the binding of actin to p38in vitro may represent a negative feedback to the kinase activity of p38, which leads to the regulation of p38 pathway and cellular function.     

Endogenous biotin‐binding proteins: an overlooked factor causing false positives in streptavidin‐based protein detection

Biotinylation is widely used in DNA, RNA and protein probing assays as this molecule has generally no impact on the biological activity of its substrate. During the streptavidin‐based detection of glycoproteins in Lactobacillus rhamnosus GG with biotinylated lectin probes, a strong positive band of approximately 125 kDa was observed, present in different cellular fractions. This potential glycoprotein reacted heavily with concanavalin A (ConA), a lectin that specifically binds glucose and mannose residues. Surprisingly, this protein of 125 kDa could not be purified using a ConA affinity column. Edman degradation of the protein, isolated via cation and anion exchange chromatography, lead to the identification of the band as pyruvate carboxylase, an enzyme of 125 kDa that binds biotin as a cofactor. Detection using only the streptavidin conjugate resulted in more false positive signals of proteins, also in extracellular fractions, indicating biotin‐associated proteins. Indeed, biotin is a known cofactor of numerous carboxylases. The potential occurence of false positive bands with biotinylated protein probes should thus be considered when using streptavidin‐based detection, e.g. by developing a blot using only the streptavidin conjugate. To circumvent these false positives, alternative approaches like detection based on digoxigenin labelling can also be used.     

Phosphorylation-mediated signalling in flowering: prospects and retrospects of phosphoproteomics in crops

Protein phosphorylation is a major post-translational modification, regulating protein function, stability, and subcellular localization. To date, annotated phosphorylation data are available mainly for model organisms and humans, despite the economic importance of crop species and their large kinomes. Our understanding of the phospho-regulation of flowering in relation to the biology and interaction between the pollen and pistil is still significantly lagging, limiting our knowledge on kinase signalling and its potential applications to crop production. To address this gap, we bring together relevant literature that were previously disconnected to present an overview of the roles of phosphoproteomic signalling pathways in modulating molecular and cellular regulation within specific tissues at different morphological stages of flowering. This review is intended to stimulate research, with the potential to increase crop productivity by providing a platform for novel molecular tools.     

Stimulation of a histone H4 protein kinase in Triton X-100 lysates of rabbit peritoneal neutrophils pretreated with chemotactic factors: lack of requirements of calcium mobilization and protein kinase C activation

The characteristics of the activation of a histone H4 kinase activity in Triton X-100 lysates of rabbit peritoneal neutrophils pretreated with fMet-Leu-Phe were studied: The activation of the kinase was a) inhibited by the antagonist of formylpeptide, t-Boc-(Phe-Leu)2(-)-Phe, b) completely inhibited by pertussis toxin pretreatment, c) not affected by the pretreatment of neutrophils with an activator of protein kinase C, phorbol-12-myristate-13-acetate, or an inhibitor of protein kinase C, 1-(5-isoquinoline-sulfonyl)-2-methyl-piperazine, and d) not inhibited in the cells preloaded with the intracellular calcium chelators, bis-(o-aminophenoxy)-ethane-N,N,N',N'-tetra acetic acid acetoxymethyl-ester (BAPTA/AM). These results suggest that the stimulus-induced activation of H4 kinase requires functional receptor and GTP-binding protein but neither calcium mobilization nor protein kinase C activation.     

Species‐ and site‐specific impacts of an invasive herbivore on tree survival in mixed forests

Invasive herbivores are often managed to limit their negative impact on plant populations, but herbivore density – plant damage relationships are notoriously spatially and temporally variable. Site and species characteristics (both plant and herbivore) must be considered when assessing the potential for herbivore damage, making it difficult to set thresholds for efficient management. Using the invasive brushtail possum Trichosurus vulpecula in New Zealand as a case study, we parameterized a generic model to predict annual probability of browse‐induced mortality of five tree species at 12 sites. We compared predicted and observed tree mortality for each species + site combination to establish herbivore abundance – tree mortality thresholds for each site on a single and combined tree species basis. Model results indicated it is likely that possum browse was the primary cause of all tree mortality at nine of the 12 species‐site combinations, allowing us to estimate site‐specific thresholds below which possum population numbers should be reduced and maintained to keep tree mortality under a predetermined level, for example 0.5% per year. The browse model can be used to set site‐ and species‐specific management action thresholds, and can be adapted easily for other plant or herbivore species. Results for multiple plant or herbivore species at a single site can be combined to create conservative, site‐wide management strategies, and used to: determine which sites will be affected most by changes in herbivore abundance; quantify thresholds for herbivore management; and justify expenditure on herbivore control.     

Organization of the genetic locus for chicken myosin light chain kinase is complex: Multiple proteins are encoded and exhibit differential expression and localization

We report that the genetic locus that encodes vertebrate smooth muscle and nonmuscle myosin light chain kinase (MLCK) and kinase-related protein (KRP) has a complex arrangement and a complex pattern of expression. Three proteins are encoded by 31 exons that have only one variation, that of the first exon of KRP, and the genomic locus spans approximately 100 kb of DNA. The three proteins can differ in their relative abundance and localization among tissues and with development. MLCK is a calmodulin (CaM) regulated protein kinase that phosphorylates the light chain of myosin II. The chicken has two MLCK isoforms encoded by the MLCK/KRP locus. KRP does not bind CaM and is not a protein kinase. However, KRP binds to and regulates the structure of myosin II. Thus, KRP and MLCK have the same subcellular target, the myosin II molecular motor system. We examined the tissue and cellular localization of KRP and MLCK in the chicken embryo and in adult chicken tissues. We report on the selective localization of KRP and MLCK among and within tissues and on a differential distribution of the proteins between embryonic and adult tissues. The results fill a void in our knowledge about the organization of the MLCK/KRP genetic locus, which appears to be a late evolving regulatory paradigm, and suggest an independent and complex regulation of expression of the gene products from the MLCK/KRP genetic locus that may reflect a basic principle found in other eukaryotic gene clusters that encode functionally linked proteins. J. Cell. Biochem. 70:402–413, 1998. © 1998 Wiley-Liss, Inc.     

Microtubule‐associated protein tau in human prostate cancer cells: Isoforms,phosphorylation, and interactions

Tau is a microtubule‐associated protein whose function has been investigated primarily in neurons. Recently, tau expression has been correlated with increased drug resistance in various cancers of non‐neuronal tissues. In this report, we investigate the tau expressed in cancerous prostate lines ALVA‐31, DU 145, and PC‐3. Prostate cancer tau is heat‐stable and highly phosphorylated, containing many of the modifications identified in Alzheimer's disease brain tau. RT‐PCR and phosphatase treatment indicated that all six alternatively spliced adult brain tau isoforms are expressed in ALVA‐31 cells, and isoforms containing exon 6 as well as high molecular weight tau isoforms containing either exon 4A or a larger splice variant of exon 4A are also present. Consistent with its hyperphosphorylated state, a large proportion of ALVA‐31 tau does not bind to microtubules, as detected by confocal microscopy and biochemical tests. Finally, endogenous ALVA‐31 tau can interact with the p85 subunit of phosphatidylinositol 3‐kinase, as demonstrated by co‐immunoprecipitations and in vitro protein‐binding assays. Our results suggest that tau in prostate cancer cells does not resemble that from normal adult brain and support the hypothesis that tau is a multifunctional protein. J. Cell. Biochem. 108: 555–564, 2009. © 2009 Wiley‐Liss, Inc.     

Expression pattern and sub‐cellular distribution of phosphoinositide specific phospholipase C enzymes after treatment with U‐73122 in rat astrocytoma cells

Phosphoinositide specific phospholipase C (PI‐PLC) enzymes interfere with the metabolism of inositol phospholipids (PI), molecules involved in signal transduction, a complex process depending on various components. Many evidences support the hypothesis that, in the glia, isoforms of PI‐PLC family display different expression and/or sub cellular distribution under non‐physiological conditions such as the rat astrocytes activation during neurodegeneration, the tumoural progression of some neoplasms and the inflammatory cascade activation after lipopolysaccharide administration, even if their role remains not completely elucidated. Treatment of a cultured established glioma cell line (C6 rat astrocytoma cell line) induces a modification in the pattern of expression and of sub cellular distribution of PI‐PLCs compared to untreated cells. Special attention require PI‐PLC beta3 and PI‐PLC gamma2 isoforms, whose expression and sub cellular localization significantly differ after U‐73122 treatment. The meaning of these modifications is unclear, also because the use of this N‐aminosteroid compound remains controversial, inasmuch it has further actions which might contribute to the global effect recorded on the treated cells. J. Cell. Biochem. 110: 1005–1012, 2010. © 2010 Wiley‐Liss, Inc.     

Rapid response of protein synthesis to insulin in 3T3 cells: Effects of protein kinase C depletion and differences from the response to serum repletion

Quiescent 3T3 cells grown in media containing 4% foetal calf serum showed different responses to insulin and to serum repletion (to 12%). Insulin stimulated protein synthesis within 1 h and this early response was insensitive to actinomycin D. The later insulin response showed progressive sensitivity to actinomycin D. The serum response was slower, not occurring until 1 h, and was inhibited by actinomycin D. Depletion of cell protein kinase C by pre-treatment with phorbol ester caused a total block of the immediate response to insulin but had little effect on the response to serum or the later response to insulin. Acute phorbol ester treatment stimulated protein synthesis.     

Sequence‐specific interactions of minor groove binders with restriction fragments of cDNAs for H tau 40 protein and MAP kinase 2. A qualitative and quantitative footprinting study

A series of DNA minor groove binders comprising netropsin, distamycin, the bisquaternary ammonium heterocycles SN 6999 and SN 6570, cis‐diammine platinum(II)‐bridged bis‐netropsin, cis‐diammine platinum(II)‐bridged bis‐distamycin and bis‐glycine‐linked bis‐distamycin were investigated for sequence‐specific interactions. The oligonucleotides used were the 154 base pair HindIII–RsaI restriction fragment of cDNA of h tau 40 protein and the 113 base pair NcoI–PvuII restriction fragment of cDNA of MAP kinase 2. Both proteins are believed to be involved in the pathology of Alzheimer's disease. For all these ligands, binding sites were localised at positions 1134–1139 (5′AATCTT3′), 1152–1156 (5′ATATT3′) and 1178–1194 (5′TTTCAATCTTTTTATTT3′) for the former and 720–726 (5′TATTCTT3′), 751–771 (5′AATTGTATAATAAATTTAAAA3′) and 781–785 (5′TATTT3′) for the latter. The AT‐preference of ligand binding was obvious and footprint titration experiments were applied to estimate binding constants (K_a) for each individual binding site mentioned above. The binding strength decreases in the order netropsin > distamycin > SN 6999 ≈ SN 6570>platinum‐bridged netropsin or distamycin≈bis‐glycine‐bridged distamycin and was found independently of the binding sites examined. GC‐base pairs interspersed in short AT‐tracts reduced the K_a‐values by as much as two orders of magnitudes. The dependence of extended bidentate as well as of monodentate binding of netropsin and distamycin derivatives on the length of AT‐stretches has been discussed. Copyright © 1999 John Wiley & Sons, Ltd.     

In vivo evidence for the involvement of phospholipase A and protein kinase in the signal transduction pathway for auxin-induced corn coleoptile elongation

Auxin-induced elongation of com coleoptiles is accompanied by cell wall acidification, which depends upon H⁺-pump activity. We tested the hypothesis that phospholipase A and a protein kinase are involved in the pathway of auxin signal transduction leading to H⁺ secretion, and elongation of corn coleoptiles. Initially, the pH of the bath solution at 50–100 μm from the surface of a coleoptile segment (pH_o) ranged between 4.8 and 6.6 when measured with an H⁺-sensitive microelectrode. Twenty or 50 μM lysophosphatidylcholine, 50 μM linolenic acid or 50 μM arachidonic acid induced a decline in pH_o by 0.3 to 2.1 units. The effect was blocked by 1 mM vanadate, suggesting that lysophosphatidylcholine or linolenic acid induced acidification of the apoplast by activating the H⁺-pump. Lysophosphatidylcholine and linolenic acid also accelerated the elongation rate of the coleoptiles. While linolenic acid and arachidonic acid, highly unsaturated fatty acids, promoted pH_o decrease and coleoptile elongation, linoleic acid, oleic acid, and stearic acid, fatty acids with a lesser extent of unsaturation, had no such effects. The effects of lysophosphatidylcholine, linolenic acid, and arachidonic acid on H⁺ secretion were not additive to that of indoleacetic acid (IAA), suggesting that lysophospholipids, fatty acids and auxin use similar pathways for the activation of the H⁺-pump. The phospholipase A₂ inhibitors, aristolochic acid and manoalide, inhibited the IAA-induced pH_o decrease and coleoptile elongation. The general protein kinase inhibitors, H-7 or staurosporine, blocked the IAA- or lysophosphatidylcholine-induced decrease in pH_o. H-7 also inhibited the coleoptile elongation induced by IAA or lysophosphatidylcholine. These results support the hypothesis that phospholipase A is activated by auxin, and that the products of the enzyme, lysophospholipids and fatty acids, induce acidification of the apoplast by activating the H⁺-pump through a mechanism involving a protein kinase, which in turn promotes com coleoptile elongation.     

Signal transduction mechanisms involved in cardiac preconditioning: Role of Ras-GTPase, Ca2 +/calmodulin-dependent protein kinase II and epidermal growth factor receptor

It is well established that brief episodes of ischemia/reperfusion (I/R) [preconditioning (PC)] protect the myocardium from the damage induced by subsequent more prolonged I/R. However, the signaling pathways activated during PC or I/R are not well characterized. In this study, the role of Ras-GTPase, tyrosine kinases (TKs), epidermal growth factor receptor (EGFR) and Ca^{2 +}/calmodulin-dependent protein kinase II (CaMK II) in mediating PC in a perfused rat heart model was investigated. A 40-min episode of global ischemia in perfused rat hearts produced significantly impaired cardiac function, measured as left ventricular developed pressure (P_max) and left ventricular end-diastolic pressure (LVEDP), and impaired coronary hemodynamics, measured as coronary flow (CF) and coronary vascular resistance (CVR). PC significantly enhanced cardiac recovery after I/R. Combination of PC and FPT III (Ras-GTPase inhibitor FPT III; 232 ng/min for 6 days) treatment did not produce any additive benefits as compared to PC alone. In contrast, PC-induced improvements in cardiac function after I/R were significantly attenuated by pretreatment with genistein (1mg/kg/day for 6 days), a broad-spectrum inhibitor of TKs, or AG1478 (1mg/kg/day for 6 days), a specific inhibitor of EGFR tyrosine kinase or KN-93 (578 ng/min for 6 days), a CaMK II inhibitor, before PC. These observations suggest that PC and FPT III pretreatment may produce cardioprotection via similar mechanisms. Present results also indicate that activation of TKs and specifically activation of EGFR-mediated TKs and CaMK II-mediated regulation of calcium homeostasis are part of the PC mechanisms that improve recovery after I/R. (Mol Cell Biochem 268: 175–183, 2005)