VCD spectroscopic properties of the β‐hairpin forming miniprotein CLN025 in various solvents

Electronic and vibrational circular dichroism are often used to determine the secondary structure of proteins, because each secondary structure has a unique spectrum. Little is known about the vibrational circular dichroic spectroscopic features of the β‐hairpin. In this study, the VCD spectral features of a decapeptide, YYDPETGTWY (CLN025), which forms a stable β‐hairpin that is stabilized by intramolecular weakly polar interactions and hydrogen bonds were determined. Molecular dynamics simulations and ECD spectropolarimetry were used to confirm that CLN025 adopts a β‐hairpin in water, TFE, MeOH, and DMSO and to examine differences in the secondary structure, hydrogen bonds, and weakly polar interactions. CLN025 was synthesized by microwave‐assisted solid phase peptide synthesis with N^α‐Fmoc protected amino acids. The VCD spectra displayed a (?,+,?) pattern with bands at 1640 to 1656 cm^?1, 1667 to 1687 cm^?1, and 1679 to 1686 cm^?1 formed by the overlap of a lower frequency negative couplet and a higher frequency positive couplet. A maximum IR absorbance was observed at 1647 to 1663 cm^?1 with component bands at 1630 cm^?1, 1646 cm^?1, 1658 cm^?1, and 1675 to 1680 cm^?1 that are indicative of the β‐sheet, random meander, either random meander or loop and turn, respectively. These results are similar to the results of others, who examined the VCD spectra of β‐hairpins formed by ^DPro‐Xxx turns and indicated that observed pattern is typical of β‐hairpins. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 442–450, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Conformation dependence of the CαDα stretch mode in peptides. II. Explicitly hydrated alanine peptide structures

Our previous studies of the potential utility of the C^αD^α stretch frequency, ν(CD), as a tool for determining conformation in peptide systems (Mirkin and Krimm, J Phys Chem A 2004, 108, 10923–10924; 2007, 111, 5300–5303) dealt with the spectroscopic characteristics of isolated alanine peptides with α_R, β, and polyproline II structures. We have now extended these ab initio calculations to include various explicit‐water environments interacting with such conformers. We find that the structure‐discriminating feature of this technique is in fact enhanced as a result of the conformation‐specific interactions of the bonding waters, in part due to our finding (Mirkin and Krimm, J Phys Chem B 2008, 112, 15268) that C^α? D^α…O(water) hydrogen bonds can be present in addition to those expected between water and the CO and NH of the peptide groups. In fact, ν(CD) is hardly affected by the latter bonding but can be shifted by up to 70 cm^?1 by the former hydrogen bonds. We also discuss the factors that will have to be considered in developing the molecular dynamics (MD) treatment needed to satisfactorily take account of the influence of outer water layers on the structure of the first‐layer water molecules that hydrogen bond to the peptide backbone. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 791–800, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Structural analysis of some soluble elastins by means of FT‐IR and 2D IR correlation spectroscopy

Fourier transform infrared (FT‐IR) spectroscopy combined with 2D correlation spectroscopy has been used to offer some information about stability and structure of some soluble elastins. Temperature has been chosen as the perturbation to monitor the infrared behavior of various soluble elastins, namely, α‐elastin p, α‐elastin, and k‐elastin. In the 3800–2700 cm^?1 region, the H‐containing groups were analyzed. The bonded hydroxyls are found to decrease prior to the NH‐related hydrogen bonds and also to the conformational reorganization of hydrocarbon chains. The transition temperatures were evaluated and they were found to agree with those obtained from DSC data. The FTIR spectra and their 2nd derivatives denote that α‐ elastins exhibited amide‐I, ‐II and ‐III bands at 1656, 1539 and 1236 cm^?1, respectively, while in k‐elastin these bands were found at 1652 cm^?1 for amide I, 1540 cm^?1 for amide II and 1248 cm^?1 for amide III. The macroscopic IR finger‐print method, which combines: general IR spectra, secondary derivative spectra, and 2D‐IR correlation spectra, is useful to discriminate different elastins. Thus using the differences of the position and intensity of the bands from “fingerprint region” of studied elastins, which include the peaks assigned to C?O, C? C groups from α‐helix, β‐turn, and the peaks assigned to the amide groups, it is possible to identify and discriminate elastins from each others. Furthermore, the pattern of 2D‐IR correlation spectra under thermal perturbation, allow their direct identification and discrimination. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 1072–1084, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

The effect of deuterium oxide on the stability of the collagen model peptides H‐(Pro‐Pro‐Gly)10‐OH,H‐(Gly‐Pro‐4(R)Hyp)9‐OH,and Type I collagen

The collagen triple helix has a larger accessible surface area per molecular mass than globular proteins, and therefore potentially more water interaction sites. The effect of deuterium oxide on the stability of collagen model peptides and Type I collagen molecules was analyzed by circular dichroism and differential scanning calorimetry. The transition temperatures (T_m) of the protonated peptide (Pro‐Pro‐Gly)₁₀ were 25.4 and 28.7°C in H₂O and D₂O, respectively. The increase of the T_m of (Pro‐Pro‐Gly)₁₀ measured calorimetrically at 1.0°C min^?1 in a low pH solution from the protonated to the deuterated solvent was 5.1°C. The increases of the T_m for (Gly‐Pro‐4(R)Hyp)₉ and pepsin‐extracted Type I collagen were measured as 4.2 and 2.2°C, respectively. These results indicated that the increase in the T_m in the presence of D₂O is comparable to that of globular proteins, and much less than reported previously for collagen model peptides [Gough and Bhatnagar, J Biomol Struct Dyn 1999, 17, 481–491]. These experimental results suggest that the interaction of water molecules with collagen is similar to the interaction of water with globular proteins, when the ratio of collagen to water is very small and collagen is monomerically dispersed in the solvent. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 93–101, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

NMR studies of an immunomodulatory benzodiazepine binding to its molecular target on the mitochondrial F1F0‐ATPase

Bz‐423 is an inhibitor of the mitochondrial F₁F₀‐ATPase, with therapeutic properties in murine models of immune diseases. Here, we study the binding of a water‐soluble Bz‐423 analog (5‐(3‐(aminomethyl)phenyl)‐7‐chloro‐ 1‐methyl‐3‐(naphthalen‐2‐ylmethyl)‐1H‐benzo][e][1,4]diazepin‐2(3H)‐one); (1) to its target subunit on the enzyme, the oligomycin sensitivity conferring protein (OSCP), by NMR spectroscopy using chemical shift perturbation and cross‐relaxation experiments. Titration experiments with constructs representing residues 1–120 or 1–145 of the OSCP reveals that (a) 1 binds to a region of the protein, at the minimum, comprising residues M51, L56, K65, V66, K75, K77, and N92, and (b) binding of 1 induces conformational changes in the OSCP. Control experiments employing a variant of 1 in which a key binding element on the small molecule was deleted; it had no perturbational effect on the spectra of the OSCP, which indicates that the observed changes with 1 represent specific binding interactions. Collectively, these data suggest that 1 might inhibit the enzyme through an allosteric mechanism where binding results in conformational changes that perturb the OSCP‐F₁ interface resulting in disrupted communication between the peripheral stalk and the F₁‐domain of the enzyme. © 2009 Wiley Periodicals, Inc. Biopolymers 29: 85–92, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Single‐molecule pair studies of the interactions of the α‐GalNAc (Tn‐antigen) form of porcine submaxillary mucin with soybean agglutinin

Mucins form a group of heavily O‐glycosylated biologically important glycoproteins that are involved in a variety of biological functions, including modulating immune response, inflammation, and adhesion. Mucins are also involved in cancer and metastasis and often express diagnostic cancer antigens. Recently, a modified porcine submaxillary mucin (Tn‐PSM) containing GalNAcα1‐O‐Ser/Thr residues was shown to bind to soybean agglutinin (SBA) with ～10⁶‐fold enhanced affinity relative to GalNAcα1‐O‐Ser, the pancarcinoma carbohydrate antigen. In this study, dynamic force spectroscopy is used to investigate molecular pairs of SBA and Tn‐PSM. A number of force jumps that demonstrate unbinding or rebinding events were observed up to a distance equal to 2.0 μm, consistent with the length of the mucin chain. The unbinding force increased from 103 to 402 pN with increasing force loading rate. The position of the activation barrier in the energy landscape of the interaction was 0.1 nm. The lifetime of the SBA–TnPSM complex in the absence of applied force was determined to be in the range 1.3–1.9 s. Kinetic parameters describing the rate of dissociation of other sugar lectin interactions are in the range 3.3 × 10^?3–2.5 × 10^?3 s. The long lifetime of the SBA‐TnPSM complex is compatible with a binding model in which lectin molecules “bind and jump” from α‐GalNAc residue to α‐GalNAc residue along the polypeptide chain of Tn‐PSM before dissociating. These findings have important implications for the molecular recognition properties of mucins. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 719–728, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biochemical correlation of Raman spectra of normal,benign and malignant breast tissues: A spectral deconvolution study

The aim of this study was to understand and correlate spectral features and biochemical changes in normal, fibroadenoma and infiltrating ductal carcinoma of breast tissues using Raman spectra that were part of the spectroscopic models developed and evaluated by us earlier. Spectra were subjected to curve fitting and intensities plots of resultant curve resolved bands were computed. This study has revealed that fat (1301 and 1440 cm^?1), collagen (1246, 1271, and 1671 cm^?1) and DNA (1340 and 1480 cm^?1) bands have strong presence in normal, benign and malignant breast tissues, respectively. Intensity plots of various combinations of curved resolved bands were also explored to classify tissue types. Combinations of fat (1301 cm^?1) and collagen (1246, 1271, and 1671 cm^?1)/amide I; DNA (1340 cm^?1) and fat (1301 cm^?1); collagen (1271 cm^?1) and DNA (1480 cm^?1) are found to be good discriminating parameters. These results are in tune with findings of earlier studies carried out on western population as well as our molecular biological understanding of normal tissues and neoplastic processes. Thus the finding of this study further demonstrates the efficacy Raman spectroscopic approaches in diagnostic applications as well as in understanding molecular phenomenon in breast cancers. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 539–546, 2009. This article was originally published online as an accepted preprint. The “Published Online”date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Characterization of a pectic polysaccharide from the leaves of Diospyros kaki and its modulating activity on lymphocyte proliferation

Pectin is a group of carbohydrate polymers constructing the primary cell walls and the middle lamella of terrestrial plants. Herein, we demonstrated the structure and immunomodulatory activity of the major pectic polysaccharide DL‐3B₂ isolated from the leaves of Diospyros kaki. Based on composition analysis, methylation analysis, two‐step acid hydrolysis, lithium‐mediated selective degradation, ¹³C NMR spectroscopy, and electrospray ionization mass spectrometry, DL‐3B₂ was found to contain an α‐1, 4‐linked galacturonic acid (GalA) backbone with some insertions of α‐1, 2‐linked rhamnose residues. The arabinan‐ and arabinogalactan‐side chains were attached to O‐4 of the rhamnose residues, whereas the linear arabinoxylan was probably linked to O‐3 of the GalA residues. Immunological tests in vitro showed that DL‐3B₂ could help stimulate lipopolysaccharide‐induced B lymphocyte proliferation, but not ConA‐induced T lymphocyte proliferation, and that the arabinose residues play a role in maintaining this immunological activity. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 649–656, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Diverse modes of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐bifuran]‐5‐carboximidamide (DB832) interaction with multi‐stranded DNA structures

The modes of binding of 5′‐[4‐(aminoiminomethyl)phenyl]‐[2,2′‐Bifuran]‐5‐carboximidamide (DB832) to multi‐stranded DNAs: human telomere quadruplex, monomolecular R‐triplex, pyr/pur/pyr triplex consisting of 12 T*(T·A) triplets, and DNA double helical hairpin were studied. The optical adsorption of the ligand was used for monitoring the binding and for determination of the association constants and the numbers of binding sites. CD spectra of DB832 complexes with the oligonucleotides and the data on the energy transfer from DNA bases to the bound DB832 assisted in elucidating the binding modes. The affinity of DB832 to the studied multi‐stranded DNAs was found to be greater (K_ass ≈ 10⁷M^?1) than to the duplex DNA (K_ass ≈ 2 × 10⁵M^?1). A considerable stabilizing effect of DB832 binding on R‐triplex conformation was detected. The nature of the ligand tight binding differed for the studied multi‐stranded DNA depending on their specific conformational features: recombination‐type R‐triplex demonstrated the highest affinity for DB832 groove binding, while pyr/pur/pyr TTA triplex favored DB832 intercalation at the end stacking contacts and the human telomere quadruplex d[AG₃(T₂AG₃)₃] accommodated the ligand in a capping mode. Additionally, the pyr/pur/pyr TTA triplex and d[AG₃(T₂AG₃)₃] quadruplex bound DB832 into their grooves, though with a markedly lesser affinity. DB832 may be useful for discrimination of the multi‐sranded DNA conformations and for R‐triplex stabilization. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 8–20, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Sequence‐dependent folding and unfolding of ligand‐bound purine riboswitches

Riboswitch regulation of gene expression requires ligand‐mediated RNA folding. From the fluorescence lifetime distribution of bound 2‐aminopurine ligand, we resolve three RNA conformers (C_o, C_i, C_c) of the liganded G‐ and A‐sensing riboswitches from Bacillus subtilis. The ligand binding affinities, and sensitivity to Mg²⁺, together with results from mutagenesis, suggest that C_o and C_i are partially unfolded species compromised in key loop‐loop interactions present in the fully folded C_c. These data verify that the ligand‐bound riboswitches may dynamically fold and unfold in solution, and reveal differences in the distribution of folded states between two structurally homologous purine riboswitches: Ligand‐mediated folding of the G‐sensing riboswitch is more effective, less dependent on Mg²⁺, and less debilitated by mutation, than the A‐sensing riboswitch, which remains more unfolded in its liganded state. We propose that these sequence‐dependent RNA dynamics, which adjust the balance of ligand‐mediated folding and unfolding, enable different degrees of kinetic discrimination in ligand binding, and fine‐tuning of gene regulatory mechanisms. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 953–965, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Helix‐coil energetics for helix formers and breakers reflect context and temperature: Mutants of helically robust,guest‐sensitive homopeptide hosts

The natural amino acids are primarily helix breakers at the low assignment temperatures characteristic of many studies, but recent genomic analyses of thermophilic proteins suggest that at high temperatures, some breakers may become strong helix formers. Moreover, the breaker/former inventory has not been previously characterized at the physiologically relevant temperature of 37°C. The versatility of ¹³C?O NMR chemical shifts as helicity reporters allows construction of two mutant peptide series, tailored to expand the range of temperature assignments for helical propensities and derived from the core hosts ^tL‐Ala₉XxxAla₉‐^tL and ^tL‐AlaNva₄XxxNva₄Ala₉‐^tL, Nva = norvaline. For three limiting guests Xxx, the helix former Nva and the breakers Gly and Pro, we report w_Xxx[T] assignments at seven temperatures from 2 to 80°C, validating our reasoning and paving the way for assignment of a definitive w_Xxx[T] data‐base. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 311–320, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Bioencapsulation of apomyoglobin in nanoporous organosilica sol–gel glasses: Influence of the siloxane network on the conformation and stability of a model protein

Nanoporous sol–gel glasses were used as host materials for the encapsulation of apomyoglobin, a model protein employed to probe in a rational manner the important factors that influence the protein conformation and stability in silica‐based materials. The transparent glasses were prepared from tetramethoxysilane (TMOS) and modified with a series of mono‐, di‐ and tri‐substituted alkoxysilanes, R_nSi(OCH₃)_4?n (R = methyl‐, n = 1; 2; 3) of different molar content (5, 10, 15%) to obtain the decrease of the siloxane linkage (? Si? O? Si? ). The conformation and thermal stability of apomyoglobin characterized by circular dichroism spectroscopy (CD) was related to the structure of the silica host matrix characterized by ²⁹Si MAS NMR and N₂ adsorption. We observed that the protein transits from an unfolded state in unmodified glass (TMOS) to a native‐like helical state in the organically modified glasses, but also that the secondary structure of the protein was enhanced by the decrease of the siloxane network with the methyl modification (n = 0 < n = 1 < n = 2 < n = 3; 0 < 5 < 10 < 15 mol %). In 15% trimethyl‐modified glass, the protein even reached a maximum molar helicity (?24,000 deg. cm² mol^?1) comparable to the stable folded heme‐bound holoprotein in solution. The protein conformation and stability induced by the change of its microlocal environment (surface hydration, crowding effects, microstructure of the host matrix) were discussed owing to this trend dependency. These results can have an important impact for the design of new efficient biomaterials (sensors or implanted devices) in which properly folded protein is necessary. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 895–906, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Conformational evaluation of labeled C3′‐O‐P‐13CH2‐O‐C4″ phosphonate internucleotide linkage,a phosphodiester isostere

Modified internucleotide linkage featuring the C3′‐O‐P‐CH₂‐O‐C4″ phosphonate grouping as an isosteric alternative to the phosphodiester C3′‐O‐P‐O‐CH₂‐C4″ bond was studied in order to learn more on its stereochemical arrangement, which we showed earlier to be of prime importance for the properties of the respective oligonucleotide analogues. Two approaches were pursued: First, the attempt to prepare the model dinucleoside phosphonate with ¹³C‐labeled CH₂ group present in the modified internucleotide linkage that would allow for a more detailed evaluation of the linkage conformation by NMR spectroscopy. Second, the use of ab initio calculations along with molecular dynamics (MD) simulations in order to observe the most populated conformations and specify main structural elements governing the conformational preferences. To deal with the former aim, a novel synthesis of key labeled reagent (CH₃O)₂P(O)¹³CH₂OH for dimer preparation had to be elaborated using aqueous ¹³C‐formaldehyde. The results from both approaches were compared and found consistent. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 514–529, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

The peel of plantain and cooking banana fruits

The peel of the plantain and cooking banana fruit protects the edible pulp from the surrounding environment. The peel of those cultivars examined contained 85–90% water and between 28 and 60 mg dry weight cm^-2 surface area. The ratio of fruit pulp to peel fresh weights differed between cultivars (1.18-2.28). The surface area of the fruit can be determined from the fresh weight using regression equations for individual cultivars or for all cultivars combined. The stomatal density was generally higher at the fruit tips than at the mid region. Significant differences in stomatal length and density were identified between cultivars although no trends existed between plantains and cooking bananas. There was little difference in the quantity of epicuticular wax on plantains whereas there were differing amounts on cooking bananas. Differences in wax composition between cultivars and for wax extracted with hot or cold chloroform were identified. Removal of the epicuticular wax with chloroform accelerated the rate of weight loss. The use of hot chloroform increased both the amount of wax removed and also the rate of weight loss. The effect of removing the epicuticular wax on water loss is discussed and illustrated with scanning electron micrographs.     

Hexamer oligonucleotide topology and assembly under solution phase NMR and theoretical modeling scrutiny

The entire family of noncomplementary hexamer oligodeoxyribonucleotides d(GCXYGC) (X and Y = A, G, C, or T) were assessed for topological indicators and equilibrium thermodynamics using a priori molecular modeling and solution phase NMR spectroscopy. Feasible modeled hairpin structures formed a basis from which solution structure and equilibria for each oligonucleotide were considered. ¹H and ³¹P variable temperature‐dependent (VT) and concentration‐dependent NMR data, NMR signal assignments, and diffusion parameters led to d(GCGAGC) and d(GCGGGC) being understood as exceptions within the family in terms of self‐association and topological character. A mean diffusion coefficient D_{298 K} = (2.0 ± 0.07) × 10^?10 m² s^?1 was evaluated across all hexamers except for d(GCGAGC) (D_{298 K} = 1.7 × 10^?10 m² s^?1) and d(GCGGGC) (D_{298 K} = 1.2 × 10^?10 m² s^?1). Melting under VT analysis (T_m = 323 K) combined with supporting NMR evidence confirmed d(GCGAGC) as the shortest tandem sheared GA mismatched duplex. Diffusion measurements were used to conclude that d(GCGGGC) preferentially exists as the shortest stable quadruplex structure. Thermodynamic analysis of all data led to the assertion that, with the exception of XY = GA and GG, the remaining noncomplementary oligonucleotides adopt equilibria between monomer and duplex, contributed largely by monomer random‐coil forms. Contrastingly, d(GCGAGC) showed preference for tandem sheared GA mismatch duplex formation with an association constant K = 3.9 × 10⁵M^?1. No direct evidence was acquired for hairpin formation in any instance although its potential existence is considered possible for d(GCGAGC) on the basis of molecular modeling studies. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 1023–1038, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Studies on Leaf Surface Lipid of Tobacco III. Compositional Change in Alkane during Growth and Senescence of Tobacco Leaves

Alkane is the major constituent of epicuticular wax universally distributed in plants. Tobacco leaves contained 5–10 mg of alkane per 1000 cm². The content gradually increased with leaf age. Leaves on the upper stalk contained more alkane than those on lower stalk. Components with carbon numbers from 27 to 33 occupied more than 98 % of the total alkane content. In relative ratios of alkane components, anteiso-C₃₀ and normal-C₃₁ were most drastically and increased, respectively, with leaf age regardless of stalk position. On the other hand, normal-C₂₉ and normal-C₃₃ increased and decreased, respectively, from the upper to lower stalk positions without being affected by leaf age. These results suggest the possible use of alkane composition as an index of leaf maturity and stalk position, for example, the ratio of anteiso-C₃₀/normal-C₃₁ for maturity and normal-C₃₃/normal-C₂₉ for stalk position.     

Solvent‐dependent conformation of amylose tris(phenylcarbamate) as deduced from scattering and viscosity data

The z‐average mean‐square radius of gyration 〈S²〉_z, the particle scattering function P(k), the second virial coefficient, and the intrinsic viscosity [η] have been determined for amylose tris(phenylcarbamate) (ATPC) in methyl acetate (MEA) at 25°C, in ethyl acetate (EA) at 33°C, and in 4‐methyl‐2‐pentanone (MIBK) at 25°C by light and small‐angle X‐ray scattering and viscometry as functions of the weight‐average molecular weight in a range from 2 × 10⁴ to 3 × 10⁶. The first two solvents attain the theta state, whereas the last one is a good solvent for the amylose derivative. Analysis of the 〈S²〉_z, P(k), and [η] data based on the wormlike chain yields h (the contour length or helix pitch per repeating unit) = 0.37 ± 0.02 and λ^?1 (the Kuhn segment length) = 15 ± 2 nm in MEA, h = 0.39 ± 0.02 and λ^?1 = 17 ± 2 nm in EA, and h = 0.42 ± 0.02 nm and λ^?1 = 24 ± 2 nm in MIBK. These h values, comparable with the helix pitches (0.37–0.40 nm) per residue of amylose triesters in the crystalline state, are somewhat larger than the previously determined h of 0.33 ± 0.02 nm for ATPC in 1,4‐dioxane and 2‐ethoxyethanol, in which intramolecular hydrogen bonds are formed between the C?O and NH groups of the neighbor repeating units. The slightly extended helices of ATPC in the ketone and ester solvents are most likely due to the replacement of those hydrogen bonds by intermolecular hydrogen bonds between the NH groups of the polymer and the carbonyl groups of the solvent. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 729–736, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Chemical composition of epicuticular wax crystals on the slippery zone in pitchers of five <Emphasis Type="Italic">Nepenthes</Emphasis> species and hybrids

Plants of the carnivorous genus Nepenthes efficiently trap insects in leaf pitchers, mostly employing epicuticular wax crystals on the pitcher walls to make them slippery for the prey. In the present study, the compositions and micromorphologies of the wax crystals of five Nepenthes species and hybrids were analysed in order to test whether the chemical principles underlying this ecological function are widespread within the genus. Three wax layers could be distinguished within the Nepenthes pitcher cuticles: (1) the outermost part of the crystals forming the platelets visible in standard scanning electron microscopy, (2) the bottom portion of the epicuticular wax crystals, and (3) an intracuticular wax layer. The composition of the intracuticular wax differed significantly from that of the neighbouring epicuticular layer. The compositions of corresponding wax mixtures from all five Nepenthes species and hybrids were very similar, with almost equal amounts of very long chain aldehydes and primary alcohols. While triacontanal (C₃₀ aldehyde) was prevailing in the epicuticular crystals of Nepenthes albomarginata and Nepenthes x intermedia, Nepenthes x superba and Nepenthes x henriana were found to have especially high percentages of dotriacontanal (C₃₂ aldehyde). Nepenthes “khasiana” had an intermediate aldehyde composition with almost equal amounts of both chain lengths.     

Chain conformation and bioactivity of water‐soluble polysaccharide extracted from Rhizoma Panacis Japonici

A water‐soluble α‐(1→4)‐D ‐glucan heteropolysaccharide with 37% degree of branch extracted by base from Rhizoma Panacis Japonici, coded as RPS3, was fractionated into six fractions by the method of nonsolvent addition. Their weight‐average molecular mass (M_w), polydispersity index (M_w/M_n), and radius of gyration (〈s²〉_z^1/2) were determined with laser light scattering (LLS) and size exclusion chromatography combined with LLS. The structure of the fraction was determined by methylation analyses and ¹³C NMR. The dependences of intrinsic viscosity ([η]) and 〈s²〉_z^1/2 on M_w were established as [η] = 0.71 M_w^{0.27 ± 0.01} (cm³/g) and 〈s²〉_z^1/2 = 1.53 M_w^{0.27 ± 0.02} (nm) in the M_w range from 5.62 × 10⁴ to 3.05 × 10⁶ (g/mol) for RPS3 in 0.15M NaCl aqueous solution at 25°C. On the basis of the current theory of the polymer solution, the fractal dimension (d_f), unperturbed chain dimension (A), and characteristic ratio (C_∞) were calculated to be 3.0, 1.48 Å, and 15.1, respectively. The results revealed that the RPS3 chains existed as spherical conformation in the aqueous solution. Transmission electron microscope further provided the evidence of the sphere shape of the RPS3 and its fractionated molecules in water. In vitro cytotoxicity assay indicated that the fractions could inhibit the tumor cells and showed no harm to normal cells at low dose. The bioactivity was relative with molecular mass of the samples. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 383–390, 2010. This article was originally published online as an acceptedpreprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office atbiopolymers@wiley.com