Physicochemical properties of thiol proteinase inhibitor isolated from goat pancreas

Thiol proteinase inhibitors are crucial to proper functioning of all living tissues consequent to their cathepsin regulatory and myriad important biologic properties. Equilibrium denaturation of dimeric goat pancreas thiol proteinase inhibitor (PTPI), a cystatin superfamily variant has been studied by monitoring changes in the protein's spectroscopic and functional characteristics. Denaturation of PTPI in guanidine hydrochloride and urea resulted in altered intrinsic fluorescence emission spectrum, diminished negative circular dichroism, and loss of its papain inhibitory potential. Native like spectroscopic properties and inhibitory activity are only partially restored when denaturant is diluted from guanidine hydrochloride unfolded samples demonstrating that process is partially reversible. Coincidence of transition curves and dependence of transition midpoint (3.2M) on protein concentration in guanidine hydrochloride‐induced denaturation are consistent with a two‐state model involving a native like dimer and denatured monomer. On the contrary, urea‐induced unfolding of PTPI is a multiphasic process with indiscernible intermediates. The studies demonstrate that functional conformation and stability are governed by both ionic and hydrophobic interactions. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 708–717, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Spectroscopic studies of the unfolding of a multimeric protein α‐crystallin

α‐Crystallin is a multimeric eye lens protein having molecular chaperone‐like function which is crucial for lens transparency. The stability and unfolding‐refolding properties of α‐crystallin plays important roles for its function. We undertook a multi probe based fluorescence spectroscopic approach to explore the changes in the various levels of organization of this protein at different urea concentration. Steady state fluorescence studies reveal that at 0.6M urea a compact structural intermediate is formed which has a native‐like secondary structure with enhanced surface exposure of hydrophobic groups. At 2.8M urea the tertiary interactions are largely collapsed with partial collapse of secondary and quaternary structure. The surface solvation probed by picosecond time resolved fluorescence of acrylodan labeled α‐crystallin revealed dry native‐like core of α‐crystallin at 0.6M urea compared to enhanced water penetration at 2.8M urea and extensive solvation at 6M urea. Activation energy for the subunit exchange decreased by 22 kJ mol^?1 on changing urea concentration from 0 to 0.6M compared with over 75 kJ mol^?1 on changing urea concentration from 0 to 2.8M. Light scattering and analytical ultracentrifugation techniques were used to determine size and oligomerization of the unfolding intermediates. The data indicated swelling but no oligomer breakdown at 0.6M urea. At 2.8M urea the oligomeric size is considerably reduced and a monomer is produced at 6M urea. The data clearly reveals that structural breakdown of α‐crystallin does not follow hierarchical sequence as tertiary structure dissolution takes place before complete oligomeric dissociation. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 549–560, 2014.     

Sequence‐dependent folding and unfolding of ligand‐bound purine riboswitches

Riboswitch regulation of gene expression requires ligand‐mediated RNA folding. From the fluorescence lifetime distribution of bound 2‐aminopurine ligand, we resolve three RNA conformers (C_o, C_i, C_c) of the liganded G‐ and A‐sensing riboswitches from Bacillus subtilis. The ligand binding affinities, and sensitivity to Mg²⁺, together with results from mutagenesis, suggest that C_o and C_i are partially unfolded species compromised in key loop‐loop interactions present in the fully folded C_c. These data verify that the ligand‐bound riboswitches may dynamically fold and unfold in solution, and reveal differences in the distribution of folded states between two structurally homologous purine riboswitches: Ligand‐mediated folding of the G‐sensing riboswitch is more effective, less dependent on Mg²⁺, and less debilitated by mutation, than the A‐sensing riboswitch, which remains more unfolded in its liganded state. We propose that these sequence‐dependent RNA dynamics, which adjust the balance of ligand‐mediated folding and unfolding, enable different degrees of kinetic discrimination in ligand binding, and fine‐tuning of gene regulatory mechanisms. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 953–965, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Stable intermediates determine proteins' primary unfolding sites in the presence of surfactants

Despite detailed knowledge of the overall structural changes and stoichiometries of surfactant binding, little is known about which protein regions constitute the preferred sites of attack for initial unfolding. Here we have exposed three proteins to limited proteolysis at anionic (SDS) and cationic (DTAC) surfactant concentrations corresponding to specific conformational transitions, using the surfactant‐robust broad‐specificity proteases Savinase and Alcalase. Cleavage sites are identified by SDS‐PAGE and N‐terminal sequencing. We observe well‐defined cleavage fragments, which suggest that flexibility is limited to certain regions of the protein. Cleavage sites for α‐lactalbumin and myoglobin correspond to regions identified in other studies as partially unfolded at low pH or in the presence of organic solvents. For Tnfn3, which does not form partially folded structures under other conditions, cleavage sites can be rationalized from the structure of the protein's folding transition state and the position of loops in the native state. Nevertheless, they are more sensitive to choice of surfactant and protease, probably reflecting a heterogeneous and fluctuating ensemble of partially unfolded structures. Thus, for proteins accumulating stable intermediates on the folding pathway, surfactants encourage the formation of these states, while the situation is more complex for proteins that do not form these intermediates. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 221–231, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Comparison of Guanidine Hydrochloride (GdnHCl) and Urea Denaturation on Inactivation and Unfolding of Human Placental Cystatin (HPC)

The activity and conformational change of human placental cystatin (HPC), a low molecular weight thiol proteinase inhibitor (12,500) has been investigated in presence of guanidine hydrochloride (GdnHCl) and urea. The denaturation of HPC was followed by activity measurements, fluorescence spectroscopy and Circular Dichroism (CD) studies. Increasing the denaturant concentration significantly enhanced the inactivation and unfolding of HPC. The enzyme was 50% inactivated at 1.5 M GdnHCl or 3 M urea. Up to 1.5 M GdnHCl concentration there was quenching of fluorescence intensity compared to native form however at 2 M concentration intensity increased and emission maxima had 5 nm red shift with complete unfolding in 4–6 M range. The mid point of transition was in the region of 1.5–2 M. In case of urea denaturation, the fluorescence intensity increased gradually with increase in the concentration of denaturant. The protein unfolded completely in 6–8 M concentration of urea with a mid-point of transition at 3 M. CD spectroscopy shows that the ellipticity of HPC has increased compared to that of native up to 1.5 M GdnHCl and then there is gradual decrease in ellipticity from 2 to 5 M concentration. At 6 M GdnHCl the protein had random coil conformation. For urea the ellipticity decreases with increase in concentration showing a sigmoidal shaped transition curve with little change up to 1 M urea. The protein greatly loses its structure at 6 M urea and at 8 M it is a random coil. The urea induced denaturation follows two-state rule in which Native→Denatured state transition occurs in a single step whereas in case of GdnHCl, intermediates or non-native states are observed at lower concentrations of denaturant. These intermediate states are possibly due to stabilizing properties of guanidine cation (Gdn⁺) at lower concentrations, whereas at higher concentrations it acts as a classical denaturant.     

On the mechanism of SDS‐induced protein denaturation

To understand the mechanism of ionic detergent‐induced protein denaturation, this study examines the action of sodium dodecyl sulfate on ferrocytochrome c conformation under neutral and strongly alkaline conditions. Equilibrium and stopped‐flow kinetic results consistently suggest that tertiary structure unfolding in the submicellar and chain expansion in the micellar range of SDS concentrations are the two major and discrete events in the perturbation of protein structure. The nature of interaction between the detergent and the protein is predominantly hydrophobic in the submicellar and exclusively hydrophobic at micellar levels of SDS concentration. The observation that SDS also interacts with a highly denatured and negatively charged form of ferrocytochrome c suggests that the interaction is independent of structure, conformation, and ionization state of the protein. The expansion of the protein chain at micellar concentration of SDS is driven by coulombic repulsion between the protein‐bound micelles, and the micelles and anionic amino acid side chains. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 186–199, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Structure of a partially unfolded form of Escherichia coli dihydrofolate reductase provides insight into its folding pathway

Proteins frequently fold via folding intermediates that correspond to local minima on the conformational energy landscape. Probing the structure of the partially unfolded forms in equilibrium under native conditions can provide insight into the properties of folding intermediates. To elucidate the structures of folding intermediates of Escherichia coli dihydrofolate reductase (DHFR), we investigated transient partial unfolding of DHFR under native conditions. We probed the structure of a high‐energy conformation susceptible to proteolysis (cleavable form) using native‐state proteolysis. The free energy for unfolding to the cleavable form is clearly less than that for global unfolding. The dependence of the free energy on urea concentration (m‐value) also confirmed that the cleavable form is a partially unfolded form. By assessing the effect of mutations on the stability of the partially unfolded form, we found that native contacts in a hydrophobic cluster formed by the F‐G and Met‐20 loops on one face of the central β‐sheet are mostly lost in the partially unfolded form. Also, the folded region of the partially unfolded form is likely to have some degree of structural heterogeneity. The structure of the partially unfolded form is fully consistent with spectroscopic properties of the near‐native kinetic intermediate observed in previous folding studies of DHFR. The findings suggest that the last step of the folding of DHFR involves organization in the structure of two large loops, the F‐G and Met‐20 loops, which is coupled with compaction of the rest of the protein.     

Thermal‐ and urea‐induced unfolding processes of glutathione S‐transferase by molecular dynamics simulation

The Schistosoma juponicum 26 kDa glutathione S‐transferase (sj26GST) consists of the N‐terminal domain (N‐domain), containing three alpha‐helices (named H1‐H3) and four anti‐parallel beta‐strands (S1‐S4), and the C‐terminal domain (C‐domain), comprising five alpha‐helices (named H4‐H8). In present work, molecular dynamics simulations and fluorescence spectroscopic were used to gain insights into the unfolding process of sj26GST. The molecular dynamics simulations on sj26GST subunit both in water and in 8 M urea were carried out at 300 K, 400 K and 500 K, respectively. Spectroscopic measurements were employed to monitor structural changes. Molecular dynamics simulations of sj26GST subunit induced by urea and temperature showed that the initial unfolding step of sj26GST both in water and urea occurred on N‐domain, involving the disruption of helices H2, H3 and strands S3 and S4, whereas H6 was the last region exposed to solution and was the last helix to unfold. Moreover, simulations analyses combining with fluorescence and circular dichroism spectra indicated that N‐domain could not fold independent, suggesting that correct folding of N‐domain depended on its interactions with C‐domain. We further proposed that the folding of GSTs could begin with the hydrophobic collapse of C‐domain whose H4, H5, H6 and H7 could move close to each other and form a hydrophobic core, especially H6 wrapped in the hydrophobic center and beginning spontaneous formation of the helix. S3, S4, H3, and H2 could form in the wake of the interaction between C‐domain and N‐domain. The paper can offer insights into the molecular mechanism of GSTs unfolding. © 2014 Wiley Periodicals, Inc. Biopolymers 103: 247–259, 2015.     

Mechanism of formation of the C‐terminal β‐hairpin of the B3 domain of the immunoglobulin‐binding protein G from Streptococcus. IV. Implication for the mechanism of folding of the parent protein

A 34‐residue α/β peptide [IG(28–61)], derived from the C‐terminal part of the B3 domain of the immunoglobulin binding protein G from Streptoccocus, was studied using CD and NMR spectroscopy at various temperatures and by differential scanning calorimetry. It was found that the C‐terminal part (a 16‐residue‐long fragment) of this peptide, which corresponds to the sequence of the β‐hairpin in the native structure, forms structure similar to the β‐hairpin only at T = 313 K, and the structure is stabilized by non‐native long‐range hydrophobic interactions (Val47–Val59). On the other hand, the N‐terminal part of IG(28–61), which corresponds to the middle α‐helix in the native structure, is unstructured at low temperature (283 K) and forms an α‐helix‐like structure at 305 K, and only one helical turn is observed at 313 K. At all temperatures at which NMR experiments were performed (283, 305, and 313 K), we do not observe any long‐range connectivities which would have supported packing between the C‐terminal (β‐hairpin) and the N‐terminal (α‐helix) parts of the sequence. Such interactions are absent, in contrast to the folding pathway of the B domain of protein G, proposed recently by Kmiecik and Kolinski (Biophys J 2008, 94, 726–736), based on Monte‐Carlo dynamics studies. Alternative folding mechanisms are proposed and discussed. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 469–480, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Comparison of the folding mechanism of highly homologous proteins in the lipid‐binding protein family

The folding mechanism of two closely related proteins in the intracellular lipid‐binding protein family, human bile acid‐binding protein (hBABP), and rat bile acid‐binding protein (rBABP) were examined. These proteins are 77% identical (93% similar) in sequence. Both of these single domain proteins fit well to a two‐state model for unfolding by fluorescence and circular dichroism at equilibrium. Three phases were observed during the unfolding of rBABP by fluorescence but only one phase was observed during the unfolding of hBABP, suggesting that at least two kinetic intermediates accumulate during the unfolding of rBABP that are not observed during the unfolding of hBABP. Fluorine NMR was used to examine the equilibrium unfolding behavior of the W49 side chain in 6‐fluorotryptophan‐labeled rBABP and hBABP. The structure of rBABP appears to be more dynamic than that of hBABP in the vicinity of W49 in the absence of denaturant, and urea has a greater effect on this dynamic behavior for rBABP than for hBABP. As such, the folding behavior of highly sequence related proteins in this family can be quite different. These differences imply that moderately sized proteins with high sequence and structural similarity can still populate quite different structures during folding. Proteins 2009. © 2008 Wiley‐Liss, Inc.     

Unfolding study of a trimeric membrane protein AcrB

The folding of a multi‐domain trimeric α‐helical membrane protein, Escherichia coli inner membrane protein AcrB, was investigated. AcrB contains both a transmembrane domain and a large periplasmic domain. Protein unfolding in sodium dodecyl sulfate (SDS) and urea was monitored using the intrinsic fluorescence and circular dichroism spectroscopy. The SDS denaturation curve displayed a sigmoidal profile, which could be fitted with a two‐state unfolding model. To investigate the unfolding of separate domains, a triple mutant was created, in which all three Trp residues in the transmembrane domain were replaced with Phe. The SDS unfolding profile of the mutant was comparable to that of the wild type AcrB, suggesting that the observed signal change was largely originated from the unfolding of the soluble domain. Strengthening of trimer association through the introduction of an inter‐subunit disulfide bond had little effect on the unfolding profile, suggesting that trimer dissociation was not the rate‐limiting step in unfolding monitored by fluorescence emission. Under our experimental condition, AcrB unfolding was not reversible. Furthermore, we experimented with the refolding of a monomeric mutant, AcrB_Δloop, from the SDS unfolded state. The CD spectrum of the refolded AcrB_Δloop superimposed well onto the spectra of the original folded protein, while the fluorescence spectrum was not fully recovered. In summary, our results suggested that the unfolding of the trimeric AcrB started with a local structural rearrangement. While the refolding of secondary structure in individual monomers could be achieved, the re‐association of the trimer might be the limiting factor to obtain folded wild‐type AcrB.     

Structural analysis of the human cannabinoid receptor one carboxyl‐terminus identifies two amphipathic helices

Recent research has implicated the C‐terminus of G‐protein coupled receptors in key events such as receptor activation and subsequent intracellular sorting, yet obtaining structural information of the entire C‐tail has proven a formidable task. Here, a peptide corresponding to the full‐length C‐tail of the human CB1 receptor (residues 400–472) was expressed in E.coli and purified in a soluble form. Circular dichroism (CD) spectroscopy revealed that the peptide adopts an α‐helical conformation in negatively charged and zwitterionic detergents (48–51% and 36–38%, respectively), whereas it exhibited the CD signature of unordered structure at low concentration in aqueous solution. Interestingly, 27% helicity was displayed at high peptide concentration suggesting that self‐association induces helix formation in the absence of a membrane mimetic. NMR spectroscopy of the doubly labeled (¹⁵N‐ and ¹³C‐) C‐terminus in dodecylphosphocholine (DPC) identified two amphipathic α‐helical domains. The first domain, S401‐F412, corresponds to the helix 8 common to G protein‐coupled receptors while the second domain, A440‐M461, is a newly identified structural motif in the distal region of the carboxyl‐terminus of the receptor. Molecular modeling of the C‐tail in DPC indicates that both helices lie parallel to the plane of the membrane with their hydrophobic and hydrophilic faces poised for critical interactions. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 565–573, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Folding intermediates of the prion protein stabilized by hydrostatic pressure and low temperature

Prion diseases are associated with conformational conversion of the cellular prion protein, PrPC, into a misfolded form, PrPSc. We have investigated the equilibrium unfolding of the structured domain of recombinant murine prion protein, comprising residues 121-231 (mPrP-(121-231)). The equilibrium unfolding of mPrP-(121-231) by urea monitored by intrinsic fluorescence and circular dichroism (CD) spectroscopies indicated a two-state transition, without detectable folding intermediates. The fluorescent probe 4,4'-dianilino-1,1'-binaphthyl-5,5-disulfonic acid (bis-ANS) binds to native mPrP-(121-231), indicating exposure of hydrophobic domains on the protein surface. Increasing concentrations of urea (up to 4 M) caused the release of bound bis-ANS, whereas changes in intrinsic fluorescence and CD of mPrP took place only above 4 M urea. This indicates the existence of a partially unfolded conformation of mPrP, characterized by loss of bis-ANS binding and preservation of the overall structure of the protein, stabilized at low concentrations of urea. Hydrostatic pressure and low temperatures were also used to stabilize partially folded intermediates that are not detectable in the presence of chemical denaturants. Compression of mPrP to 3.5 kbar at 25 degrees C and pH 7 caused a slight decrease in intrinsic fluorescence emission and an 8-fold increase in bis-ANS fluorescence. Lowering the temperature to -9 degrees C under pressure reversed the decrease in intrinsic fluorescence and caused a marked (approximately 40-fold) increase in bis-ANS fluorescence. The increase in bis-ANS fluorescence at low temperatures was similar to that observed for mPrP at 1 atm at pH 4. These results suggest that pressure-assisted cold denaturation of mPrP stabilizes a partially folded intermediate that is qualitatively similar to the state obtained at acidic pH. Compression of mPrP in the presence of a subdenaturing concentration of urea stabilized another partially folded intermediate, and cold denaturation under these conditions led to complete unfolding of the protein. Possible implications of the existence of such partially folded intermediates in the folding of the prion protein and in the conversion to the PrPSc conformer are discussed.     

“Setting paint” analogy for the hydrophobic self‐association of tropoelastin into elastin‐like hydrogel

Alkaline tropoelastin solutions (pH 11) were optically clear at low temperatures, but a firm gel formed when the temperature was raised to 37°C. Reversion to a clear solution took place if the temperature was lowered to below 20°C within less than 2 h, but not if 37°C was maintained for several hours. The precipitated elastin‐like hydrogel thus formed did not visually redissolve at low temperatures. Tropoelastin hydrogel was stable to subsequent washings with alkaline solution at 37°C, but at 4°C some hydrogel redissolved showing that association is at least partly reversible. Washing the hydrogel with neutral 8M urea solution at 4°C dissolved less than 10% of tropoelastin in 24 h. We characterized this phenomenon by combining temperature‐controlled light microscopy analysis, ¹H NMR spectroscopy (temperature, diffusion, and relaxation time studies), and UV‐absorption‐based concentration measurements. The self‐association of tropoelastin at pH 11 is due to hydrophobic interactions in an emulsion‐like system in which the spherules coalesce in a manner like a water‐based latex paint that forms a durable hydrophobic sheet as water and the organic solvent evaporate. In the present case, the sedimentation and entanglement of the tropoelastin porous sheets means that reverse dissolution is a kinetically slow process. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 321–330, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Uncover the conserved property underlying sequence‐distant and structure‐similar proteins

It is widely accepted that a protein's sequence determines its structure. The surprising finding that proteins of distant sequence can adopt similar 3D structures has raised interesting questions regarding underlying conserved properties that are essential for protein folding and stability. Uncovering the conserved properties may shed light on the folding mechanism of proteins and help with the development of computational tools for protein structure prediction. We compiled and analyzed a structure pair dataset of 66 high‐resolution and low sequence identity (16–38%) soluble proteins. Structure deviation for each pair was confirmed by calculating its C_α SiMax value and comparing its potential energy per residue. Analysis of favorable inter‐residue interactions for each structure pair indicated that the average number of inter‐residue interactions within each structure represents a conserved feature of homologous structures of distant sequence. Detailed comparison of individual types of interactions showed that the average number of either hydrophobic or hydrogen bonding interactions remains unchanged for each structure pair. These findings should be of help to improving the quality of homology models based on templates of low sequence identity, thus broadening the application of homology modeling techniques for protein studies. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 340–347, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Conformational stability of the full‐atom hexameric model of the ClpB chaperone from Escherichia coli

The Escherichia coli heat shock protein ClpB, a member of the Hsp100 family, plays a crucial role in cellular thermotolerance. In co‐operation with the Hsp70 chaperone system, it is able to solubilize proteins aggregated by heat shock conditions and refold them into the native state in an ATP‐dependent way. It was established that the mechanism of ClpB action depends on the formation of a ring‐shaped hexameric structure and the translocation of a protein substrate through an axial channel. The structural aspects of this process are not fully known. By means of homology modeling and protein–protein docking, we obtained a model of the hexameric arrangement of the full‐length ClpB protein complexed with ATP. A molecular dynamics simulation of this model was performed to assess its flexibility and conformational stability. The high mobility of the “linker” M‐domain, essential for the renaturing activity of ClpB, was demonstrated, and the size and shape of central channel were analyzed. In this model, we propose the coordinates for a loop between b4 and B6 structural elements, not defined in previous structural research, which faces the inside of the channel and may therefore play a role in substrate translocation. © 2009 Wiley Periodicals, Inc. Biopolymers 93: 47–60, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

Synthesis of quadruplex‐forming tetra‐end‐linked oligonucleotides: Effects of the linker size on quadruplex topology and stability

G‐quadruplexes are characteristic structural arrangements of guanine‐rich DNA sequences that abound in regions with relevant biological significance. These structures are highly polymorphic differing in the number and polarity of the strands, loop composition, and conformation. Furthermore, the cation species present in solution strongly influence the topology of the G‐quadruplexes. Recently, we reported the synthesis and structural studies of new G‐quadruplex forming oligodeoxynucleotides (ODNs) in which the 3′‐ and/or the 5′‐ends of four ODN strands are linked together by a non‐nucleotidic tetra‐end‐linker (TEL). These TEL‐ODN analogs having the sequence TGGGGT are able to form parallel G‐quadruplexes characterized by a remarkable high thermal stability. We report here an investigation about the influence of the reduction of the TEL size on the molecularity, topology, and stability of the resulting TEL‐G‐quadruplexes using a combination of circular dichroism (CD), CD melting, ¹H NMR spectroscopy, gel electrophoresis, and molecular modeling data. We found that all TEL‐(TGGGGT)₄ analogs, regardless the TEL size and the structural orientation of the ODN branches, formed parallel TEL‐G‐quadruplexes. The molecular modeling studies appear to be consistent with the experimental CD and NMR data revealing that the G‐quadruplexes formed by TEL‐ODNs having the longer TEL (L 1 ‐ 4 ) are more stable than the corresponding G‐quadruplexes having the shorter TEL (S 1 ‐ 4 ). The relative stability of S 1 ‐ 4 was also reported. © 2009 Wiley Periodicals, Inc. Biopolymers 91: 466–477, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

A de novo designed 11 kDa polypeptide: Model for amyloidogenic intrinsically disordered proteins

A de novo polypeptide GH₆[(GA)₃GY(GA)₃GE]₈GAH₆ (YE8) has a significant number of identical weakly interacting β‐strands with the turns and termini functionalized by charged amino acids to control polypeptide folding and aggregation. YE8 exists in a soluble, disordered form at neutral pH but is responsive to changes in pH and ionic strength. The evolution of YE8 secondary structure has been successfully quantified during all stages of polypeptide fibrillation by deep UV resonance Raman (DUVRR) spectroscopy combined with other morphological, structural, spectral, and tinctorial characterization. The YE8 folding kinetics at pH 3.5 are strongly dependent on polypeptide concentration with a lag phase that can be eliminated by seeding with a solution of folded fibrillar YE8. The lag phase of polypeptide folding is concentration dependent leading to the conclusion that β‐sheet folding of the 11‐kDa amyloidogenic polypeptide is completely aggregation driven. © 2010 Wiley Periodicals, Inc. Biopolymers 93: 607–618, 2010. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com