共查询到20条相似文献,搜索用时 718 毫秒
1.
Lewis EA Munde M Wang S Rettig M Le V Machha V Wilson WD 《Nucleic acids research》2011,39(22):9649-9658
Structural results with minor groove binding agents, such as netropsin, have provided detailed, atomic level views of DNA molecular recognition. Solution studies, however, indicate that there is complexity in the binding of minor groove agents to a single site. Netropsin, for example, has two DNA binding enthalpies in isothermal titration calorimetry (ITC) experiments that indicate the compound simultaneously forms two thermodynamically different complexes at a single AATT site. Two proposals for the origin of this unusual observation have been developed: (i) two different bound species of netropsin at single binding sites and (ii) a netropsin induced DNA hairpin to duplex transition. To develop a better understanding of DNA recognition complexity, the two proposals have been tested with several DNAs and the methods of mass spectrometry (MS), polyacrylamide gel electrophoresis (PAGE) and nuclear magnetic resonance spectroscopy in addition to ITC. All of the methods with all of the DNAs investigated clearly shows that netropsin forms two different complexes at AATT sites, and that the proposal for an induced hairpin to duplex transition in this system is incorrect. 相似文献
2.
The mouse pheromone 2-sec-butyl-4,5-dihydrothiazole (SBT) binds to an occluded, nonpolar cavity in the mouse major urinary protein-I (MUP-I). The thermodynamics of this interaction have been characterized using isothermal titration calorimetry (ITC). MUP-I-SBT binding is accompanied by a large favorable enthalpy change (DeltaH = -11.2 kcal/mol at 25 degrees C), an unfavorable entropy change (-TDeltaS = 2.8 kcal/mol at 25 degrees C), and a negative heat capacity change [DeltaC(p)() = -165 cal/(mol K)]. Thermodynamic analysis of binding between MUP-I and several 2-alkyl-4,5-dihydrothiazole ligands indicated that the alkyl chain contributes more favorably to the enthalpy and less favorably to the entropy of binding than would be expected on the basis of the hydrophobic desolvation of short-chain alcohols. However, solvent transfer experiments indicated that desolvation of SBT is accompanied by a net unfavorable change in enthalpy (DeltaH = +1.0 kcal/mol) and favorable change in entropy (-TDeltaS = -1.8 kcal/mol). These results are discussed in terms of the possible physical origins of the binding thermodynamics, including (1) hydrophobic desolvation of both the protein and the ligand, (2) formation of a buried water-mediated hydrogen bond network between the protein and ligand, (3) formation of strong van der Waals interactions, and (4) changes in the structure, dynamics, and/or hydration of the protein upon binding. 相似文献
3.
Freyer MW Buscaglia R Hollingsworth A Ramos J Blynn M Pratt R Wilson WD Lewis EA 《Biophysical journal》2007,92(7):2516-2522
Studies performed in our laboratory demonstrated the formation of two thermodynamically distinct complexes on binding of netropsin to a number of hairpin-forming DNA sequences containing AATT-binding regions. These two complexes were proposed to differ only by a bridging water molecule between the drug and the DNA in the lower affinity complex. A temperature-dependent isothermal titration calorimetry (ITC)-binding study was performed using one of these constructs (a 20-mer hairpin of sequence 5'-CGAATTCGTCTCCGAATTCG) and netropsin. This study demonstrated a break in the heat capacity change for the formation of the complex containing the bridging water molecule at approximately 303 K. In the plot of the binding enthalpy change versus temperature, the slope (DeltaCp) was -0.67 kcal mol-1 K-1 steeper after the break at 303 K. Because of the relatively low melting temperature of the 20-mer hairpin (341 K (68 degrees C)), the enthalpy change for complex formation might have included some energy of refolding of the partially denatured hairpin, giving the suggestion of a larger DeltaCp. Studies done on the binding of netropsin to similar constructs, a 24-mer and a 28-mer, with added GC basepairs in the hairpin stem to increase thermal stability, exhibit the same nonlinearity in DeltaCp over the temperature range of from 275 to 333 K. The slopes (DeltaCp) were -0.69 and -0.64 kcal mol-1 K-1 steeper after 303 K for the 24-mer and 28-mer, respectively. This observation strengthens the argument regarding the presence of a bridging water molecule in the lower affinity netropsin/DNA complex. The DeltaCp data seem to infer that because the break in the heat capacity change function for the lower affinity binding occurs at the isoequilibrium temperature for water, water may be included or trapped in the complex. The fact that this break does not occur in the heat capacity change function for formation of the higher affinity complex can similarly be taken as evidence that water is not included in the higher affinity complex. 相似文献
4.
5.
Energetic basis of molecular recognition in a DNA aptamer 总被引:1,自引:0,他引:1
Bishop GR Ren J Polander BC Jeanfreau BD Trent JO Chaires JB 《Biophysical chemistry》2007,126(1-3):165-175
The thermal stability and ligand binding properties of the L-argininamide-binding DNA aptamer (5'-GATCGAAACGTAGCGCCTTCGATC-3') were studied by spectroscopic and calorimetric methods. Differential calorimetric studies showed that the uncomplexed aptamer melted in a two-state reaction with a melting temperature T(m)=50.2+/-0.2 degrees C and a folding enthalpy DeltaH(0)(fold)=-49.0+/-2.1 kcal mol(-1). These values agree with values of T(m)=49.6 degrees C and DeltaH(0)(fold)=-51.2 kcal mol(-1) predicted for a simple hairpin structure. Melting of the uncomplexed aptamer was dependent upon salt concentration, but independent of strand concentration. The T(m) of aptamer melting was found to increase as L-argininamide concentrations increased. Analysis of circular dichroism titration data using a single-site binding model resulted in the determination of a binding free energy DeltaG(0)(bind)=-5.1 kcal mol(-1). Isothermal titration calorimetry studies revealed an exothermic binding reaction with DeltaH(0)(bind)=-8.7 kcal mol(-1). Combination of enthalpy and free energy produce an unfavorable entropy of -TDeltaS(0)=+3.6 kcal mol(-1). A molar heat capacity change of -116 cal mol(-1) K(-1) was determined from calorimetric measurements at four temperatures over the range of 15-40 degrees C. Molecular dynamics simulations were used to explore the structures of the unligated and ligated aptamer structures. From the calculated changes in solvent accessible surface areas of these structures a molar heat capacity change of -125 cal mol(-1) K(-1) was calculated, a value in excellent agreement with the experimental value. The thermodynamic signature, along with the coupled CD spectral changes, suggest that the binding of L-argininamide to its DNA aptamer is an induced-fit process in which the binding of the ligand is thermodynamically coupled to a conformational ordering of the nucleic acid. 相似文献
6.
Calorimetric and spectroscopic investigation of drug-DNA interactions. I. The binding of netropsin to poly d(AT) 总被引:14,自引:7,他引:7
下载免费PDF全文
![点击此处可从《Nucleic acids research》网站下载免费的PDF全文](/ch/ext_images/free.gif)
We report the first calorimetric investigation of netropsin binding to poly d(AT). Temperature-dependent uv absorption, circular dichroism (CD), batch calorimetry, and differential scanning calorimetry (DSC) were used to detect, monitor, and thermodynamically characterize the binding process. The following results have been obtained: 1) Netropsin groove binding is accompanied by a large exothermic enthalpy of 9.2 kcal/mol of drug bound at 25 degrees C. This indicates that a large negative binding enthalpy may be a necessary but not a sufficient criterion for drug intercalation. We suggest that the exothermic binding might be correlated with specific H-bonding interactions. 2) From the difference in DSC transition enthalpies in the presence and absence of netropsin, we calculate a binding enthalpy of -10.7 kcal/mol of netropsin at 88 degrees C. 3) We calculate a positive delta S for netropsin binding to poly d(AT) at 25 degrees C. This positive entropy change may reflect netropsin-induced release of condensed cations and/or bound water. 4) The netropsin-saturated duplex monophasically melts 46 degrees C higher than the free duplex. The unsaturated duplex melts through two thermally-resolved transitions that correspond to netropsin-free and netropsin-bound regions. These two regions interact dynamically with no substantial influence on the thermal stabilities of the separate domains. 5) Netropsin binding decreases the cooperativity of the duplex to single strand transition. 相似文献
7.
Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies. 相似文献
8.
Polyamides composed of N-methylpyrrole (Py), N-methylimidazole (Im) and N-methylhydroxypyrrole (Hp) amino acids linked by beta-alanine (beta) bind the minor groove of DNA in 1:1 and 2:1 ligand to DNA stoichiometries. Although the energetics and structure of the 2:1 complex has been explored extensively, there is remarkably less understood about 1:1 recognition beyond the initial studies on netropsin and distamycin. We present here the 1:1 solution structure of ImPy-beta-Im-beta-ImPy-beta-Dp bound in a single orientation to its match site within the DNA duplex 5'-CCAAAGAGAAGCG-3'.5'-CGCTTCTCTTTGG-3' (match site in bold), as determined by 2D (1)H NMR methods. The representative ensemble of 12 conformers has no distance constraint violations greater than 0.13 A and a pairwise RMSD over the binding site of 0.80 A. Intermolecular NOEs place the polyamide deep inside the minor groove, and oriented N-C with the 3'-5' direction of the purine-rich strand. Analysis of the high-resolution structure reveals the ligand bound 1:1 completely within the minor groove for a full turn of the DNA helix. The DNA is B-form (average rise=3.3 A, twist=38 degrees ) with a narrow minor groove closing down to 3.0-4.5 A in the binding site. The ligand and DNA are aligned in register, with each polyamide NH group forming bifurcated hydrogen bonds of similar length to purine N3 and pyrimidine O2 atoms on the floor of the minor groove. Each imidazole group is hydrogen bonded via its N3 atom to its proximal guanine's exocyclic amino group. The important roles of beta-alanine and imidazole for 1:1 binding are discussed. 相似文献
9.
Understanding the molecular basis of ligand-DNA-binding events, and its application to the rational design of novel drugs, requires knowledge of the structural features and forces that drive the corresponding recognition processes. Existing structural evidence on DNA complexation with classical minor groove-directed ligands and the corresponding studies of binding energetics have suggested that this type of binding can be described as a rigid-body association. In contrast, we show here that the binding-coupled conformational changes may be crucial for the interpretation of DNA (hairpin) association with a classical minor groove binder (netropsin). We found that, although the hairpin form is the only accessible state of ligand-free DNA, its association with the ligand may lead to its transition into a duplex conformation. It appears that formation of the fully ligated duplex from the ligand-free hairpin, occurring via two pathways, is enthalpically driven and accompanied by a significant contribution of the hydrophobic effect. Our thermodynamic and structure-based analysis, together with corresponding theoretical studies, shows that none of the predicted binding steps can be considered as a rigid-body association. In this light we anticipate our thermodynamic approach to be the basis of more sophisticated nucleic acid recognition mechanisms, which take into account the dynamic nature of both the nucleic acid and the ligand molecule. 相似文献
10.
Binding of a small molecule to a macromolecular target reduces its conformational freedom, resulting in a negative entropy change that opposes the binding. The goal of this study is to estimate the configurational entropy change of two minor-groove-binding ligands, netropsin and distamycin, upon binding to the DNA duplex d(CGCGAAAAACGCG).d(CGCGTTTTTCGCG). Configurational entropy upper bounds based on 10-ns molecular dynamics simulations of netropsin and distamycin in solution and in complex with DNA in solution were estimated using the covariance matrix of atom-positional fluctuations. The results suggest that netropsin and distamycin lose a significant amount of configurational entropy upon binding to the DNA minor groove. The estimated changes in configurational entropy for netropsin and distamycin are -127 J K(-1) mol(-1) and -104 J K(-1) mol(-1), respectively. Estimates of the configurational entropy contributions of parts of the ligands are presented, showing that the loss of configurational entropy is comparatively more pronounced for the flexible tails than for the relatively rigid central body. 相似文献
11.
Privalov PL Jelesarov I Read CM Dragan AI Crane-Robinson C 《Journal of molecular biology》1999,294(4):997-1013
The energetics of the Sox-5 HMG box interaction with DNA duplexes, containing the recognition sequence AACAAT, were studied by fluorescence spectroscopy, isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC). Fluorescence titration showed that the association constant of this HMG box with the duplexes is of the order 4x10(7) M(-1), increasing somewhat with temperature rise, i.e. the Gibbs energy is -40 kJ mol(-1) at 5 degrees C, decreasing to -48 kJ mol(-1) at 32 degrees C. ITC measurements of the enthalpy of association over this temperature range showed an endothermic effect below 17 degrees C and an exothermic effect above, suggesting a heat capacity change on binding of about -4 kJ K(-1) mol(-1), a value twice larger than expected from structural considerations. A straightforward interpretation of ITC data in heat capacity terms assumes, however, that the heat capacities of all participants in the association reaction do not change over the considered temperature range. Our previous studies showed that over the temperature range of the ITC experiments the HMG box of Sox-5 starts to unfold, absorbing heat and the heat capacities of the DNA duplexes also increase significantly. These heat capacity effects differ from that of the DNA/Sox-5 complex. Correcting the ITC measured binding enthalpies for the heat capacity changes of the components and complex yielded the net enthalpies which exhibit a temperature dependence of about -2 kJ K(-1) mol(-1), in good agreement with that predicted on the basis of dehydration of the protein-DNA interface. Using the derived heat capacity change and the enthalpy and Gibbs energy of association measured at 5 degrees C, the net enthalpy and entropy of association of the fully folded HMG box with the target DNA duplexes was determined over a broad temperature range. These functions were compared with those for other known cases of sequence specific DNA/protein association. It appears that the enthalpy and entropy of association of minor groove binding proteins are more positive than for proteins binding in the major groove. The observed thermodynamic characteristics of protein binding to the A+T-rich minor groove of DNA might result from dehydration of both polar and non-polar groups at the interface and release of counterions. The expected entropy of dehydration was calculated and found to be too large to be compensated by the negative entropy of reduction of translational/rotational freedom. This implies that DNA/HMG box association proceeds with significant decrease of conformational entropy, i.e. reduction in conformational mobility. 相似文献
12.
The thermodynamics of self-assembly of a 14 base pair DNA double helix from complementary strands have been investigated by titration (ITC) and differential scanning (DSC) calorimetry, in conjunction with van't Hoff analysis of UV thermal scans of individual strands. These studies demonstrate that thermodynamic characterization of the temperature-dependent contributions of coupled conformational equilibria in the individual "denatured" strands and in the duplex is essential to understand the origins of duplex stability and to derive stability prediction schemes of general applicability. ITC studies of strand association at 293 K and 120 mM Na+ yield an enthalpy change of -73 +/- 2 kcal (mol of duplex)-1. ITC studies between 282 and 312 K at 20, 50, and 120 mM Na+ show that the enthalpy of duplex formation is only weakly salt concentration-dependent but is very strongly temperature-dependent, decreasing approximately linearly with increasing temperature with a heat capacity change (282-312 K) of -1.3 +/- 0.1 kcal K-1 (mol of duplex)-1. From DSC denaturation studies in 120 mM Na+, we obtain an enthalpy of duplex formation of -120 +/- 5 kcal (mol of duplex)-1 and an estimate of the corresponding heat capacity change of -0.8 +/- 0.4 kcal K-1 (mol of duplex)-1 at the Tm of 339 K. van't Hoff analysis of UV thermal scans on the individual strands indicates that single helix formation is noncooperative with a temperature-independent enthalpy change of -5.5 +/- 0.5 kcal at 120 mM Na+. From these observed enthalpy and heat capacity changes, we obtain the corresponding thermodynamic quantities for two fundamental processes: (i) formation of single helices from disordered strands, involving only intrastrand (vertical) interactions between neighboring bases; and (ii) formation of double helices by association (docking) of single helical strands, involving interstrand (horizontal and vertical) interactions. At 293 K and 120 mM Na+, we calculate that the enthalpy change for association of single helical strands is approximately -64 kcal (mol of duplex)-1 as compared to -210 kcal (mol of duplex)-1 calculated for duplex formation from completely unstructured single strands and to the experimental ITC value of -73 kcal (mol of duplex)-1. The intrinsic heat capacity change for association of single helical strands to form the duplex is found to be small and positive [ approximately 0.1 kcal K-1 (mol of duplex)-1], in agreement with the result of a surface area analysis, which also predicts an undetectably small heat capacity change for single helix formation. 相似文献
13.
A molecular mechanics and molecular dynamics approach was used to examine the structure of complexes formed between the d(CGCGAATTCGCG)2 duplex and netropsin, distamycin, and four carbocyclic analogues of netropsin and distamycin (1-4). The resulting structures of the ligand-DNA model complexes and their energetics were examined. It is predicted that the compounds 1-4 should have a decreased affinity for the minor groove of AT-rich regions in comparison to netropsin and distamycin. From the energetic analysis it appears that van der Waals and electrostatic interactions are more important than specific hydrogen bonds in stabilizing the ligand-duplex complexes. We predict that compounds 1 and 2 are effectively isohelical with the DNA minor groove. The superior DNA-binding afforded by 1 and 2 in comparison to 3 and 4 results from their more effective penetration into the minor groove and smaller perturbation of molecular structure upon complex formation. 相似文献
14.
N Patel H Berglund L Nilsson R Rigler L W McLaughlin A Gr?slund 《European journal of biochemistry》1992,203(3):361-366
Fluorescence spectroscopy was used to study the interaction between the minor-groove-binding drug netropsin and the self-complementary oligonucleotide d(CTGAnPTTCAG)2 containing the fluorescent base analogue 2-aminopurine (nP). The binding of netropsin to this oligonucleotide causes strong quenching of the 2-aminopurine fluorescence, observed by steady-state as well as time-resolved spectroscopy. From fluorescence titrations, binding isotherms were recorded and evaluated. The parameters showed one netropsin binding site/oligonucleotide duplex and an association constant of about 10(5) M-1 at 25 degrees C, 3-4 orders of magnitude weaker than for an exclusive adenine/thymine host sequence. From the temperature dependence of the association constant the thermodynamic parameters were obtained as delta G = -29 kJ/mol, delta H = -12 kJ/mol and delta S = +55 J.mol-1.K-1 at 25 degrees C. These parameters resemble those of the interaction of poly[(dG-dC).(dG-dC)] with netropsin, indicating a mainly entropy-driven reaction. The amino group of 2-aminopurine, like that of guanine, resides in the minor groove of DNA. Therefore the relatively weak binding of netropsin to d(CTGAnPTTCAG)2 is probably related to partial blockage of the tight fit of netropsin into the preferred minor groove of an exclusive adenine/thymine host sequence. 相似文献
15.
The fluorene derivative tilorone has received great attention as a DNA intercalator and has been widely recognized as an inducer of interferon. The biological activity of tilorone is known to be related to its binding mode with DNA; however, few structural and thermodynamic studies have elaborated on this issue. This paper presents two-dimensional (2-D) NMR and isothermal titration calorimetry (ITC) for the tilorone/DNA complex, coupled with circular dichroism (CD) spectroscopy and viscosity measurements. NMR investigation suggests that tilorone binds to DNA through intercalation, showing greater affinity for insertion between AT base pairs than between CG pairs. CD spectral changes were observed for T/B (tilorone/DNA base pair molar ratio) ratios greater than the stoichiometric ratio generally expected for intercalators (i.e., T/B = 0.5, according to the neighbor-exclusion principle). However, there was a clear plateau in the CD intensity between T/B < 0.35 and T/B > 0.45. From comparison with NMR and other measurements, we postulate that CD changes below the plateau should be related to the intercalation and the latter to electrostatic interactions and nonspecific bindings. ITC data showed that DeltaH < -TDeltaS < 0, which indicated that tilorone/DNA binding is enthalpy controlled. The magnitude of Kb (the binding constant) was of the same order as that of ethidium bromide. The stoichiometric number, obtained from ITC, CD, and UV data, implied a relatively smaller value (0.28-0.35) than that of the neighbor-exclusion principle. This is because side chains located in the groove disrupt further intercalation to the adjacent sites. 相似文献
16.
Circular dichroism and UV melting studies on formation of an intramolecular triplex containing parallel T*A:T and G*G:C triplets: netropsin complexation with the triplex.
下载免费PDF全文
![点击此处可从《Nucleic acids research》网站下载免费的PDF全文](/ch/ext_images/free.gif)
We have used circular dichroism and UV absorption spectroscopy to characterize the formation and melting behaviour of an intramolecular DNA triple helix containing parallel T*A:T and G*G:C triplets. Our approach to induce and to stabilize a parallel triplex involves the oligonucleotide 5'-d(G4A4G4[T4]C4T4C4-[T4]G4T4G4) ([T4] represents a stretch of four thymine residues). In a 10 mM sodium cacodylate, 0.2 mM disodium EDTA (pH 7) buffer, we have shown the following significant results. (i) While in the absence of MgCl2 this oligonucleotide adopts an intramolecular hairpin duplex structure prolonged by the single strand extremity 5'-d([T4]G4T4G4), the presence of millimolar concentrations of MgCl2generates an intramolecular triplex (via double hairpin formation). (ii) In contrast to the antiparallel triplex formed by the oligonucleotide 5'-d(G4T4G4[T4]G4A4G4[T4]C4T4C4), the parallel triplex melts in a biphasic manner (a triplex to duplex transition followed by a duplex to coil transition) and is less stable than the antiparallel one. The enthalpy change associated with triplex formation (-37 kcal/mol) is approximately half that of duplex formation (-81 kcal/mol). (iii) The parallel triple helix is disrupted by increasing the concentration of KCl(>10 mM), whereas, under the same conditions, the antiparallel triplex remains stable. (iv) Netropsin, a natural DNA minor groove-binding ligand, binds to the central site A4/T4of the duplex or triplex in an equimolar stoichiometry. Its association constant K is smaller for the parallel triplex ( approximately 1 x 10(7) M-1) than for the antiparallel one ( approximately 1 x 10(8) M-1). In contrast to the antiparallel structure, netropsin binding has no apparent effect on thermal stability of the parallel triple helix. 相似文献
17.
Probing the hydration of the minor groove of A.T synthetic DNA polymers by volume and heat changes 总被引:4,自引:0,他引:4
The minor-groove ligand netropsin provides a sensitive probe of the hydration difference between poly(dA).poly(dT) and poly[d(AT)].poly[d(AT)]. We have measured the volume change delta V accompanying binding of netropsin to these polymers, using an improved magnetic suspension densimeter. For poly(dA).poly(dT) we find delta V = +97 mL/mol of bound netropsin at pH 7.0 and 10 mM sodium phosphate buffer. For poly[d(AT)].poly[d(AT)] we find delta V = -16 mL/mol of bound netropsin. This striking differential effect suggests that the poly(dA).poly(dT) duplex compresses more water (or is more extensively hydrated). From our enthalpy and entropy results we estimate the approximately 10 water molecules, immobilized in the minor groove of this system, are displaced by each netropsin bound. The volume increase, however, is substantially larger than can be explained by a simple melting of these immobilized water molecules in the minor groove. A decompression of at least 40 water molecules must attend the complexation to the poly(dA).poly(dT) duplex. This suggests that the conformation change attending the binding of the drug to this polymer duplex causes a further dehydration, whereas no such change in dehydration and configuration for the heteropolymer system is indicated. 相似文献
18.
The energetics of LRP binding to a 104 bp lac promoter determined from ITC measurements were compared to the energetics of binding to a shorter 40 bp DNA duplex with the 21 bp promoter binding site sequence. The promoter binding affinity of 2.47 +/- 0.0 1x 10(7) M(-1) was higher than the DNA binding affinity of 1.81 +/- 0.67 x 10(7) M(-1) while the binding enthalpy of -804 +/- 41 kJ mol(-1) was lower than that of the DNA binding enthalpy of -145 +/- 16 kJ mol(-1) at 298.15 K. Both the promoter and DNA binding reactions were exothermic in phosphate buffer but endothermic in Tris buffer that showed the transfer of four protons to LRP in the former reaction but only two in the latter. A more complicated dependence of these parameters on temperature was observed for promoter binding. These energetic differences are attributable to additional LRP-promoter interactions from wrapping of the promoter around the LRP. 相似文献
19.
We used a combination of optical and calorimetric techniques to investigate the incorporation of deoxythymidine --> deoxyuridine (dT --> dU) substitutions in the duplex and third strand of the parallel intramolecular triplex d(A(7)C(5)T(7)C(5)T(7)) (ATT). UV and differential scanning calorimetry melting experiments show that the incorporation of two substitutions yielded triplexes with lower thermal stability and lower unfolding enthalpies. The enthalpies decrease with an increase in salt concentration, indirectly yielding a heat capacity effect, and the magnitude of this effect was lower for the substituted triplexes. The combined results indicate that the destabilizing effect is due to a decrease in the level of stacking interactions. Furthermore, the minor groove ligand netropsin binds to the minor groove and to the hydrophobic groove, created by the double chain of thymine methyl groups in the major groove of these triplexes. Binding of netropsin to the minor groove yielded thermodynamic profiles similar to that of a DNA duplex with a similar sequence. However, and relative to ATT, binding of netropsin to the hydrophobic groove has a decreased binding affinity and lower binding enthalpy. This shows that the presence of uridine bases disrupts the hydrophobic groove and lowers its cooperativity toward ligand binding. The overall results suggest that the stabilizing effect of methyl groups may arise from the combination of both hydrophobic and electronic effects. 相似文献
20.
Vander Meulen KA Davis JH Foster TR Record MT Butcher SE 《Journal of molecular biology》2008,384(3):702-717
Little is known about the thermodynamic forces that drive the folding pathways of higher-order RNA structure. In this study, we employ calorimetric [isothermal titration calorimetry (ITC) and differential scanning calorimetry (DSC)] and spectroscopic (NMR and UV) methods to characterize the thermodynamics of the GAAA tetraloop-receptor interaction, utilizing a previously described bivalent construct. ITC studies indicate that the bivalent interaction is enthalpy driven and highly stable, with a binding constant (K(obs)) of 5.5x10(6) M(-1) and enthalpy (DeltaH(obs)(o)) of -33.8 kcal/mol at 45 degrees C in 20 mM KCl and 2 mM MgCl(2). Thus, we derive the DeltaH(obs)(o) for a single tetraloop-receptor interaction to be -16.9 kcal/mol at these conditions. UV absorbance data indicate that an increase in base stacking quality contributes to the enthalpy of complex formation. These highly favorable thermodynamics are consistent with the known critical role for the tetraloop-receptor motif in the folding of large RNAs. Additionally, a significant heat capacity change (DeltaC(p,obs)(o)) of -0.24 kcal mol(-1) K(-1) was determined by ITC. DSC and UV-monitored thermal denaturation experiments indicate that the bivalent tetraloop-receptor construct follows a minimally five-state unfolding pathway and suggest the observed DeltaC(p,obs)(o) for the interaction results from a temperature-dependent unbound receptor RNA structure. 相似文献