Complexity in the binding of minor groove agents: netropsin has two thermodynamically different DNA binding modes at a single site

Structural results with minor groove binding agents, such as netropsin, have provided detailed, atomic level views of DNA molecular recognition. Solution studies, however, indicate that there is complexity in the binding of minor groove agents to a single site. Netropsin, for example, has two DNA binding enthalpies in isothermal titration calorimetry (ITC) experiments that indicate the compound simultaneously forms two thermodynamically different complexes at a single AATT site. Two proposals for the origin of this unusual observation have been developed: (i) two different bound species of netropsin at single binding sites and (ii) a netropsin induced DNA hairpin to duplex transition. To develop a better understanding of DNA recognition complexity, the two proposals have been tested with several DNAs and the methods of mass spectrometry (MS), polyacrylamide gel electrophoresis (PAGE) and nuclear magnetic resonance spectroscopy in addition to ITC. All of the methods with all of the DNAs investigated clearly shows that netropsin forms two different complexes at AATT sites, and that the proposal for an induced hairpin to duplex transition in this system is incorrect.     

Cooperative stabilization of Zn2+:DNA complexes through netropsin binding in the minor groove of FdU-substituted DNA

The simultaneous binding of netropsin in the minor groove and Zn²⁺ in the major groove of a DNA hairpin that includes 10 consecutive FdU nucleotides at the 3′-terminus (3′FdU) was demonstrated based upon NMR spectroscopy, circular dichroism (CD), and computational modeling studies. The resulting Zn²⁺/netropsin: 3′FdU complex had very high thermal stability with aspects of the complex intact at 85?°C, conditions that result in complete dissociation of Mg²⁺ complexes. CD and ¹⁹F NMR spectroscopy were consistent with Zn²⁺ binding in the major groove of the DNA duplex and utilizing F5 and O4 of consecutive FdU nucleotides as ligands with FdU nucleotides hemi-deprotonated in the complex. Netropsin is bound in the minor groove of the DNA duplex based upon 2D NOESY data demonstrating contacts between AH2 ¹H and netropsin ¹H resonances. The Zn²⁺/netropsin: 3′FdU complex displayed increased cytotoxicity towards PC3 prostate cancer (PCa) cells relative to the constituent components or separate complexes (e.g. Zn²⁺:3′FdU) indicating that this new structural motif may be therapeutically useful for PCa treatment.

An animated interactive 3D complement (I3DC) is available in Proteopedia at http://proteopedia.org/w/Journal:JBSD:32     

Mode of reversible binding of neocarzinostatin chromophore to DNA: evidence for binding via the minor groove

Two general approaches have been taken to understand the mechanism of the reversible binding of the nonprotein chromophore of neocarzinostatin to DNA: (1) measurement of the relative affinity of the chromophore for various DNAs that have one or both grooves blocked by bulky groups and (2) studies on the influence of adenine-thymine residue-specific, minor groove binding agents such as the antibiotics netropsin and distamycin on the chromophore-DNA interaction. Experiments using synthetic DNAs containing halogen group (Br, I) substituents in the major groove or natural DNAs with glucosyl moieties projecting into the major groove show that obstruction of the major groove does not decrease the binding stoichiometry or the binding constant for the DNA-chromophore interaction. Chemical methylation of bases in both grooves of calf thymus DNA, resulting in 13% methylation of N-7 of guanine in the major groove and 7% methylation of N-3 of adenine in the minor groove, decreases the binding affinity and increases the size of the binding site for neocarzinostatin chromophore. Similar results were obtained whether binding parameters were determined directly by spectroscopic measurements or indirectly by measuring the ability of the DNA to protect the chromophore against degradation. On the other hand, netropsin and distamycin compete with neocarzinostatin chromophore for binding to the minor groove of DNA, as shown by their decrease in the ability of poly(dA-dT) to protect the chromophore against degradation and their reduction in chromophore-induced DNA damage as measured by thymine release.(ABSTRACT TRUNCATED AT 250 WORDS)     

DAPI binding to the DNA minor groove: a continuum solvent analysis

A continuum solvent model based on the generalized Born (GB) or finite-difference Poisson-Boltzmann (FDPB) approaches has been employed to compare the binding of 4'-6-diamidine-2-phenyl indole (DAPI) to the minor groove of various DNA sequences. Qualitative agreement between the results of GB and FDPB approaches as well as between calculated and experimentally observed trends regarding the sequence specificity of DAPI binding to B-DNA was obtained. Calculated binding energies were decomposed into various contributions to solvation and DNA-ligand interaction. DNA conformational adaptation was found to make a favorable contribution to the calculated total interaction energy but did not change the DAPI binding affinity ranking of different DNA sequences. The calculations indicate that closed complex formation is mainly driven by nonpolar contributions and was found to be disfavored electrostatically due to a desolvation penalty that outbalances the attractive Coulomb interaction. The calculated penalty was larger for DAPI binding to GC-rich sequences compared with AT-rich target sequences and generally larger for the FDPB vs the GB continuum model. A radial interaction profile for DAPI at different distances from the DNA minor groove revealed an electrostatic energy minimum a few Angstroms farther away from the closed binding geometry. The calculated electrostatic interaction up to this distance is attractive and it may stabilize a nonspecific binding arrangement.     

Interactions between a symmetrical minor groove binding compound and DNA oligonucleotides: 1H and 19F NMR studies

High-resolution NMR techniques (proton and 19F) have been used to study the interactions between several DNA oligonucleotides with varying length of AT base pairs and the synthetic pyrrole-containing compound (P1-F4S-P1), which has properties similar to the DNA minor groove binding drug distamycin A. When this two-fold symmetrical DNA binding molecule is added to the self-complementary DNA oligomers, the resulting complex exhibits an NMR spectrum without any doubling of individual resonances, consistent with a two-fold symmetry of the complex. This is in contrast to all other complexes studied so far. The minimum length of an AT stretch for specific ligand binding is judged to be greater than 4 base pairs. Inter-molecular proton nuclear Overhauser effects between the ligand molecule and a DNA dodecamer d(CGCAAATTTGCG) provide evidence that P1-F4S-P1 binds DNA in the minor groove and interacts with the middle AT base pairs. The presence of a specific interaction between P1-F4S-P1 and DNA is conclusively demonstrated by 19F NMR studies, in which four previously chemically equivalent fluorine nuclei in the free molecule become two non-equivalent pairs (yielding an AB quartet pattern) upon the binding of P1-F4S-P1 to DNA duplex. A sequence-dependent binding behavior of P1-F4S-P1 is evident by comparing the 19F NMR spectra of the complexes between P1-F4S-P1 and two different but related DNA dodecamers, d(CGCAAATTTGCG) and d(CGCTTTAAAGCG). P1-F4S-P1 binds more strongly to the former dodecamer with an association constant of approximately 1 X 10(3) M-1.     

Variability in DNA minor groove width recognised by ligand binding: the crystal structure of a bis-benzimidazole compound bound to the DNA duplex d(CGCGAATTCGCG)2.

An analogue of the DNA-binding compound Hoechst 33258, in which the piperazine ring has been replaced by an imidazoline group, has been cocrystallized with the dodecanucleotide sequence d(CGCGAATTCGCG)2. The structure has been solved by X-ray diffraction analysis and has been refined to an R-factor of 19.7% at a resolution of 2.0 A. The ligand is found to bind in the minor groove, at the central four AATT base pairs of the B-DNA double helix, with the involvement of a number of van der Waals contacts and hydrogen bonds. There are significant differences in minor groove width for the two compounds, along much of the AATT region. In particular this structure shows a narrower groove at the 3' end of the binding site consistent with the narrower cross-section of the imidazole group compared with the piperazine ring of Hoechst 33258 and therefore a smaller perturbation in groove width. The higher binding affinity to DNA shown by this analogue compared with Hoechst 33258 itself, has been rationalised in terms of these differences.     

Binding of AR-1-144, a tri-imidazole DNA minor groove binder, to CCGG sequence analyzed by NMR spectroscopy.

The interactions of N-[2-(dimethylamino)ethyl]-1-methyl-4-[1-methyl-4-[4-formamido-1-meth ylimidazole-2-carboxamido]imidazole-2-carboxamido]imidazole-2-c arboxa mide (AR-1-144), a tri-imidazole polyamide minor groove binder, with DNA have been investigated by NMR and CD spectroscopy. A series of DNA oligonucleotides with a C/G-containing four-bp core, i.e. CCGG, CGCG, GGCC, and GCGC, have been titrated with AR-1-144 at different ratios. AR-1-144 favors the CCGG sequence. The flanking sequence of the CCGG core also influences the binding preference, with a C or T being favored on the 3'-side of the CCGG core. The three-dimensional structure of the symmetric 2:1 side-by-side complex of AR-1-144 and GAACCGGTTC, determined by NOE-constrained NMR refinement, reveals that each AR-1-144 binds to four base pairs, i.e. at C5-G6-G7-T8, with every amide-imidazole unit forming two potential hydrogen bonds with DNA. The same DNA binding preference of AR-1-144 was also confirmed by circular dichroism spectroscopy, indicating that the DNA binding preference of AR-1-144 is independent of concentration. The cooperative binding of an AR-1-144 homodimer to the (purine)CCGG(pyrimidine) core sequence appears to be weaker than that of the distamycin A homodimer to A/T sequences, most likely due to the diminished hydrophobic interactions between AR-1-144 and DNA. Our results are consistent with previous footprinting data and explain the binding pattern found in the crystal structure of a di-imidazole drug bound to CATGGCCATG.     

Unusually strong binding to the DNA minor groove by a highly twisted benzimidazole diphenylether: induced fit and bound water

RT29 is a dicationic diamidine derivative that does not obey the classical "rules" for shape and functional group placement that are expected to result in strong binding and specific recognition of the DNA minor groove. The compound contains a benzimidazole diphenyl ether core that is flanked by the amidine cations. The diphenyl ether is highly twisted and gives the entire compound too much curvature to fit well to the shape of the minor groove. DNase I footprinting, fluorescence intercalator displacement studies, and circular dichroism spectra, however, indicate that the compound is an AT specific minor groove binding agent. Even more surprisingly, quantitative biosensor-surface plasmon resonance and isothermal titration calorimetric results indicate that the compound binds with exceptional strength to certain AT sequences in DNA with a large negative enthalpy of binding. Crystallographic results for the DNA complex of RT29 compared to calculated results for the free compound show that the compound undergoes significant conformational changes to enhance its minor groove interactions. In addition, a water molecule is incorporated directly into the complex to complete the compound-DNA interface, and it forms an essential link between the compound and base pair edges at the floor of the minor groove. The calculated DeltaCp value for complex formation is substantially less than the experimentally observed value, which supports the idea of water being an intrinsic part of the complex with a major contribution to the DeltaCp value. Both the induced fit conformational changes of the compound and the bound water are essential for strong binding to DNA by RT29.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Syntheses and DNA-binding studies of a series of unsymmetrical cyanine dyes: structural influence on the degree of minor groove binding to natural DNA

Twelve crescent-shaped unsymmetrical dyes have been synthesized and their interactions with DNA have been investigated by spectroscopic methods. A new facile synthetic route to this type of cyanine dyes has been developed, involving the preparation of 6-substituted 2-thiomethyl-benzothiazoles in good yields. The new dyes are analogues to the minor groove binding unsymmetrical cyanine dye, BEBO, recently reported by us. In this dye, the structure of the known intercalating cyanine dye BO was extended with a 6-methylbenzothiazole substituent. Herein we further investigate the role of the extending benzazole heterocycle, as well as of the pyridine or quinoline moiety of the cyanine chromophore, for the binding mode of these crescent-shaped dyes to calf thymus DNA. Flow LD and CD studies of the 12 dyes show that the extent of minor groove binding to mixed sequence DNA varies significantly between the dyes. We find that hydrophobicity and size are the crucial parameters for recognition of the minor groove. The relatively high fluorescence quantum yield of many of these cyanines bound to DNA, combined with their absorption at long wavelengths, may render them useful in biological applications. In particular, two of the benzoxazole containing dyes BOXTO and 2-BOXTO show a high degree of minor groove binding and quantum yields of 0.52 and 0.32, respectively, when bound to DNA.     

Immunoglobulin M possesses two binding sites for complement subcomponent C1q, and soluble 1:1 and 2:1 complexes are formed in solution at reduced ionic strength

Soluble complexes were formed between C1q, a subunit of the first component of human complement, and four different Waldenstr?m IgM proteins at reduced ionic strengths. The equilibria between these complexes and the free proteins were studied in the ultracentrifuge. Complex formation was found to be a very sensitive function of the salt concentration, and at physiological ionic strength complex formation was negligible. The complexes were cross-linked with a water-soluble carbodiimide and separated by sucrose gradient centrifugation. Both 22 S 1:1 and 26 S 2:1 C1q X IgM complexes were formed; stoichiometry was established by cross-linking 125I-C1q with 131I-IgM and determining the ratios of the specific activities of the gradient-purified materials. The association process was studied as a function of protein concentration and was analyzed by Scatchard and Hill plots to yield stoichiometry, association constant, and degree of cooperativity. The results indicated that IgM has two identical and independent binding sites for C1q. The intrinsic association constant was found to vary between 10(6) M-1 at 0.084 M ionic strength to 10(4) M-1 at physiological ionic strength; the slope of the log-log plot gave a value of -6.0. The cross-linked complexes were examined by electron microscopy, and the C1q appeared to be attached to the IgM through the C1q heads, implying that the biologically significant binding sites were involved in this interaction. For the 2:1 complexes, the two C1q appeared to attach to opposite surfaces of the IgM, suggesting the presence of a pseudo-2-fold axis lying in the plane of the IgM disk.     

How to construct a coordinated ecological network at different levels: A case from Ningbo city,China

Constructing ecological networks (ENs) is an essential means to set up ecological cities and deliver sustainable development. However, there is a pressing need to address the lack of linkage between ENs at different administrative levels. Therefore, this paper takes Ningbo city as the study area and constructs ENs at the city and county levels with different indices and research methods. It explores the linkages between ecological source areas and corridors at various administrative levels, finally forming an EN that links multiple levels. The results of the study show that 19 ecological source areas of approximately 1534.18 km² and 22 ecological corridors of 455.85 km were identified in the city of Ningbo. Furthermore, 12 ecological source areas, 16 natural ecological corridors, and 10 cultural landscape corridors were identified in Ningbo's Zhenhai District. After the superposition of municipal ecological sources, Zhenhai's ecological source areas increased in the west, north and southeast, adding approximately 12.81 km². Based on the comprehensive resistance surface, 18 composite ecological corridors were extracted, occupying approximately 74.21 km. After joining different administrative levels, the overall connectivity increased, promoting the circulation of ecosystem services. This study can accurately identify the spaces with critical ecological roles at different administrative levels and provide a reference for designing the whole ecological space and carrying out top-down ecological restoration projects.     

Evidence for nonintercalative complexes formed from the reversible binding of benzo[a]pyrene metabolites to closed-circular, single-stranded M13mp19 DNA

The fluorescence excitation spectrum of complexes formed from the reversible binding of the proximate carcinogen, trans-7,8-dihydroxy-7,8-dihydro-benzo[a]pyrene (BP78D) to closed-circular, single-stranded, viral M13mp19 DNA (SS M13 DNA) exhibits a red-shift of 5 nm compared to the spectrum of BP78D measured without DNA or with native, calf thymus DNA. In SS M13 DNA which is 0.10 mM in PO4-, the fluorescence intensity of BP78D is 2.3 times smaller than the intensity measured without DNA; however, the fluorescence lifetime (42.7 nsec) of BP78D with SS M13 DNA is 1.7-1.8 times larger than the lifetimes of BP78D measured without DNA or with calf thymus DNA. These results are consistent with the conclusion that, in addition to binding sites which cause fluorescence quenching, SS M13 DNA contains sites which permit formation of BP78D inclusion complexes that have weaker interactions with nucleotide bases than those occurring in intercalated complexes. The association constant (1.45 +/- 0.01 x 10(5) M-1) for the binding of BP78D to SS M13 DNA is more than 9.0 times larger than that for binding to calf thymus DNA. It is 7.1 times larger than that for the binding of the less genotoxic metabolite, trans-4,5-dihydroxy-4,5-dihydrobenzo[a]pyrene (BP45D) to SS M13 DNA. UV Photoelectron data and results from ab initio molecular orbital calculations suggest that a difference in polarizability contributes to the greater SS M13 DNA binding of BP78D compared to that of BP45D.     

Protein footprinting approach to mapping DNA binding sites of two archaeal homing enzymes: evidence for a two-domain protein structure.

The archaeal intron-encoded homing enzymes I-PorI and I-DmoI belong to a family of endonucleases that contain two copies of a characteristic LAGLIDADG motif. These endonucleases cleave their intron- or intein- alleles site-specifically, and thereby facilitate homing of the introns or inteins which encode them. The protein structure and the mechanism of DNA recognition of these homing enzymes is largely unknown. Therefore, we examined these properties of I-PorI and I-DmoI by protein footprinting. Both proteins were susceptible to proteolytic cleavage within regions that are equidistant from each of the two LAGLIDADG motifs. When complexed with their DNA substrates, a characteristic subset of the exposed sites, located in regions immediately after and 40-60 amino acids after each of the LAGLIDADG motifs, were protected. Our data suggest that the enzymes are structured into two, tandemly repeated, domains, each containing both the LAGLIDADG motif and two putative DNA binding regions. The latter contains a potentially novel DNA binding motif conserved in archaeal homing enzymes. The results are consistent with a model where the LAGLIDADG endonucleases bind to their non-palindromic substrates as monomeric enzymes, with each of the two domains recognizing one half of the DNA substrate.     

Molecular events involved in a single cycle of ligand transfer from an ATP binding cassette transporter, LolCDE, to a molecular chaperone, LolA

An ATP binding cassette transporter LolCDE complex releases lipoproteins from the inner membrane of Escherichia coli in an ATP-dependent manner, leading to the formation of a complex between a lipoprotein and a periplasmic chaperone, LolA. LolA is proposed to undergo a conformational change upon the lipoprotein binding. The lipoprotein is then transferred from the LolA-lipoprotein complex to the outer membrane via LolB. Unlike most ATP binding cassette transporters mediating the transmembrane flux of substrates, the LolCDE complex catalyzes the extrusion of lipoproteins anchored to the outer leaflet of the inner membrane. Moreover, the LolCDE complex is unique in that it can be purified as a liganded form, which is an intermediate of the lipoprotein release reaction. Taking advantage of these unique properties, we established an assay system that enabled the analysis of a single cycle of lipoprotein transfer reaction from liganded LolCDE to LolA in a detergent solution. The LolA-lipoprotein complex thus formed was physiologically functional and delivered lipoproteins to the outer membrane in a LolB-dependent manner. Vanadate, a potent inhibitor of the lipoprotein release from proteoliposomes, was found to inhibit the release of ADP from LolCDE. However, a single cycle of lipoprotein transfer occurred from vanadate-treated LolCDE to LolA, indicating that vanadate traps LolCDE at the energized state.     

Highly flexible ligand binding pocket of ecdysone receptor: a single amino acid change leads to discrimination between two groups of nonsteroidal ecdysone agonists

The insect steroid hormone 20-hydroxyecdysone works through a ligand-activated nuclear receptor, the ecdysone receptor (EcR), which plays critical roles in insect development and reproduction. The EcR has been exploited to develop insecticides to control pests and gene switches for gene regulation. Recently reported crystal structures of the EcR protein show different but partially overlapping binding cavities for ecdysteroid (ECD) and diacylhydrazine (DAH) ligands, providing an explanation for the differential activity of DAH ligands in insects. 1-Aroyl-4-(arylamino)-1,2,3,4-tetrahydroquinoline (THQ) ligands were recently discovered as ecdysone agonists. Mutagenesis of the EcR (from Choristoneura fumiferana, CfEcR) ligand binding domain followed by screening in a reporter assay led to the identification of CfEcR mutants, which responded well to THQ ligands but poorly to both ECD and DAH ligands. These mutants were further improved by introducing a second mutation, A110P, which was previously reported to cause ECD insensitivity. Testing of these V128F/A110P and V128Y/A110P mutants in a C57BL/6 mouse model coactivator interaction assay and in insect cells showed that this mutant EcR is activated by THQ ligands but not by ECD or DAH ligands. The CfEcR and its V128F/A110P mutant were used to demonstrate simultaneous regulation of two reporter genes using THQ and DAH ligands.     

DNA damage by anti-cancer agents resolved at the nucleotide level of a single copy gene: evidence for a novel binding site for cisplatin in cells.

A new PCR based technique has been developed to investigate the sequence selectivity of adduct formation by DNA damaging agents in a single copy gene in isolated genomic DNA or in drug treated cells. Single-strand ligation PCR (sslig-PCR) demonstrated that cisplatin and nitrogen mustards reacted with guanine in an N-ras fragment with varying sequence specificity similar to that observed previously in plasmid DNA. In cisplatin-treated cells sslig-PCR demonstrated all the adducts found in isolated DNA and with the same sequence selectivity showing a preference for GG and AG sites. However, in cells an additional site of DNA binding of cisplatin was observed at the two occurrences of the sequence 5'-TACT-3' on the transcribed and non-transcribed strands. This sequence is not a recognised target for cisplatin and represents a novel adduct formed in cells.