Short leader sequences may be transferred from small RNAs to pre-mature mRNAs by trans-splicing in Euglena.

Very closely related short sequences are present at the 5' end of cytoplasmic mRNAs in Euglena as evidenced by comparison of cDNA sequences and hybrid-arrested translation experiments. By cloning Euglena gracilis nuclear DNA and isolating the rbcS gene (encoding the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase), we have shown that the short leader sequence does not flank the nuclear gene sequence. The leader sequences were found to constitute the 5' extremities of a family of small RNAs. Sequencing six members of this family revealed a striking similarity to vertebrate U snRNAs. We propose that a trans-splicing mechanism transfers the spliced leader (SL) sequence from these small RNAs (SL RNAs) to pre-mature mRNAs. Transfer of leader sequences to mRNAs by trans-splicing has been shown only in trypanosomes where cis-splicing is unknown, and in nematodes where not more than 10% of the mRNAs have leader sequences. Our results strongly suggest that Euglena is a unique organism in which both a widespread trans-splicing and a cis-splicing mechanism co-exist.     

A pseudogene cluster in the leader region of the Euglena chloroplast 16S-23S rRNA genes.

The nucleotide sequence of a region (leader region) preceding the 5'-end of 16S-23S rRNA gene region of Euglena gracilis chloroplast DNA was compared with the homologous sequences that code for the 16S-23S rRNA operons of Euglena and E. coli. The leader region shows close homology in sequence to the 16S-23S rRNA gene region of Euglena (Orozco et al. (1980) J. Biol.Chem. 255, 10997-11003) as well as to the rrnD operon of E. coli, suggesting that it was derived from the 16S-23S rRNA gene region by gene duplication. It was shown that the leader region had accumulated nucleotide substitutions at an extremely rapid rate in its entirety, similar to the rate of tRNAIle pseudogene identified in the leader region. In addition, the leader region shows an unique base content which is quite distinct from those of 16S-23S rRNA gene regions of Euglena and E. coli, but again is similar to that of the tRNAIle pseudogene. The above two results strongly suggest that the leader region contains a pseudogene cluster which was derived from a gene cluster coding for the functional 16S-23S rRNA operon possibly by imperfect duplication during evolution of Euglena chloroplast DNA.     

Spectrin deficient inherited hemolytic anemias in the mouse: Characterization by spectrin synthesis and mRNA activity in reticulocytes

The 35 nucleotide spliced leader (SL) sequence is found on the 5' end of numerous trypanosome mRNAs, yet the tandemly organized reiteration units encoding this leader are not detectably linked to any of these structural genes. Here we report the presence of a class of discrete small SL RNA molecules that are derived from the genomic SL reiteration units of Trypanosoma brucei, Trypanosoma cruzi, and Leptomonas collosoma. These small SL RNAs are 135, 105, and 95 nucleotides, respectively, and contain a 5'-terminal SL or SL-like sequence. S1 nuclease analyses demonstrate that these small SL RNAs are transcribed from continuous sequence within the respective SL reiteration units. With the exception of the SL sequence and a concensus donor splice site immediately following it, these small RNAs are not well conserved. We suggest that the small SL RNAs may function as a donor of the SL sequence in an intermolecular process that places the SL at the 5' terminus of many trypanosomatid mRNAs.     

Microheterogeneity of the primary structure of the short repeated 5S DNA unit in diploid wheat Triticum monococcum L

Nucleotide sequences of two 5S rRNA genes located in repeated 327 bp long units were determined in diploid wheat Triticum monococcum. They were compared with sequences of 5S rRNA genes of Tr. monococcum and Tr. aestivum which were earlier determined. The differences were revealed in two localizations of the nucleotide sequence in 5S DNA coding regions of Tr. monococcum and - in nine localizations in nontranscribed spacer. It was established that the nucleotide sequence of 5S rRNA gene cloned in pTm5S9 plasmid and 5S DNA coding region in Tr. aestivum have significant homology. Diploid wheat Tr. monococcum was supposed to have 5S rRNA genes with different functional activity within one multigene family.     

Euglena gracilis chloroplast ribosomal RNA transcription units. Nucleotide sequence polymorphism in 5 S rRNA genes and 5 S rRNAs

The three tandemly repeated ribosomal RNA operons from the chloroplast genome of Euglena gracilis Klebs, Pringsheim Strain Z each contain a 5 S rRNA gene distal to the 23 S rRNA gene (Gray, P.W., and Hallick, R.B. (1979) Biochemistry 18, 1820-1825). We have cloned two distinct 5 S rRNA genes, and determined the DNA sequence of the genes, their 5'- and 3'-flanking sequences, and the 3'-end of the adjacent 23 S rRNA genes. The two genes exhibit sequence polymorphism at five bases within the "procaryotic loop" coding region, as well as internal restriction endonuclease site heterogeneity. These restriction endonuclease site polymorphisms are evident in chloroplast DNA, and not just the cloned examples of 5 S genes. Chloroplast 5 S rRNA was isolated, end labeled, and sequenced by partial enzymatic degradation. The same polymorphisms found in 5 S rDNA are present in 5 S rRNA. Therefore, both types of 5 S rRNA genes are transcribed and are present in chloroplast ribosomes.     

A new twist in trypanosome RNA metabolism: cis-splicing of pre-mRNA

It has been known for almost a decade and a half that in trypanosomes all mRNAs are trans-spliced by addition to the 5' end of the spliced leader (SL) sequence. During the same time period the conviction developed that classical cis-splicing introns are not present in the trypanosome genome and that the trypanosome gene arrangement is highly compact with small intergenic regions separating one gene from the next. We have now discovered that these tenets are no longer true. Poly(A) polymerase (PAP) genes in Trypanosoma brucei and Trypanosoma cruzi are split by intervening sequences of 653 and 302 nt, respectively. The intervening sequences occur at identical positions in both organisms and obey the GT/AG rule of cis-splicing introns. PAP mRNAs are trans-spliced at the very 5' end as well as internally at the 3' splice site of the intervening sequence. Interestingly, 11 nucleotide positions past the actual 5' splice site are conserved between the T. bruceiand T. cruzi introns. Point mutations in these conserved positions, as well as in the AG dinucleotide of the 3' splice site, abolish intron removal in vivo. Our results, together with the recent discovery of cis-splicing introns in Euglena gracilis, suggest that both trans- and cis-splicing are ancient acquisitions of the eukaryotic cell.     

Sequence analysis of the transcribed and 5'' non-transcribed regions of the ribosomal RNA gene in Dictyostelium discoideum

The nucleotide sequence of Dictyostelium discoideum rDNA extending over almost the entire transcribed region and a part of the 5' non-transcribed spacer region has been determined. Computer analysis revealed that there were several conserved sequences in the 17S, 5.8S and 26S coding regions when compared with the sequences at analogous positions in some eukaryotic rRNA genes. The data also showed that the D. discoideum rDNA contains several extra sequences, which have not been found in other eukaryotes' rDNAs , near the 3' terminus of the 17S coding region and the 5' terminus of the 26S coding region.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Nucleotide sequence at the junction between the nonstructural and the structural genes of the semliki forest virus genome.

The nucleotide sequence at the junction between the nonstructural and the structural genes of the Semliki Forest virus 42S RNA genome has been determined from cloned cDNA. With the aid of S1-mapping, we have located the 5' end of the viral 26S RNA on this sequence. The 26S RNA is homologous to the 3' end of the 42S RNA and is used as a messenger for the structural proteins of the virus. The nucleotide sequence in the noncoding 5' region of the 26S RNA (51 bases) was thus established, completing the primary structure of the 26S RNA molecule (for earlier sequence work, see Garoff et al., Proc. Natl. Acad. Sci. U.S.A. 77:6376-6380, 1980, and Garoff et al., Nature (London) 288:236-241, 1980). An examination of the nucleotide sequences upstream from the initiator codon for the structural proteins on the 42S RNA genome shows that all reading frames are effectively blocked by stop codons, which means that the nonstructural genes in the 5' end of the 42S RNA molecule do not overlap with the structural ones at the 3' end of the molecule.     

Characterization of the nuclear ribosomal DNA of Euglena gracilis

A phage lambda recombinant library containing Euglena gracilis genomic DNA was screened for nuclear rDNA sequences. A recombinant phage was isolated that contained an 11.5-kb nuclear rDNA sequence. The 11.5-kb insert was mapped with restriction endonucleases and was shown to represent a complete rDNA repeat unit that carried the genes for the 19S, 25S, 5.8 S and 5 S cytoplasmic rRNAs. The 2000 rDNA repeat units per haploid genome are organized in the form of identical tandem repeats.