Characteristics of Z-DNA helices formed by imperfect (purine-pyrimidine) sequences in plasmids

The capacities of three synthetic sequences to adopt left-handed helices were evaluated in recombinant plasmids. The sequences consisted of very short runs of (CG)n (n = 2-4) interspersed with runs of alternating A.T base pairs and/or with regions of non-alternating base pairs. The plasmids were studied by two-dimensional gel electrophoresis to determine the natures of the conformational transitions and their free energies of formation. These results coupled with analyses with chemical (diethyl pyrocarbonate, osmium tetroxide, and bromoacetaldehyde) and enzymatic (S1 nuclease, T7 gene 3 product, and MHhaI) probes indicated that the entire sequence was adopting a left-handed helix in each case. In one of these sequences, Z-DNA formation necessitated the retention of the anti conformation of one of the guanines in a region of non-alternation. In a sequence which contains out-of-phase regions of alternation, our results indicate the formation of a separate left-handed helix in the central (CG)2 region, thus forming two Z-Z junctions. In summary, we conclude that only very short regions of alternating CG are necessary to effect the B to Z transition and that this conformational change can be transmitted through non-alternating regions. A set of empirical rules governing the characteristics of the B to Z transition and the types of left-handed helices in supercoiled plasmids was derived from studies on a systematic series of 17 plasmids.     

Left-handed Z-DNA and intramolecular triplex formation at the site of an unequal sister chromatid exchange

An unequal sister chromatid exchange (USCE) in the mouse myeloma cell line MPC-11 between 3' regions of the C gamma 2a and C gamma 2b heavy chain genes results in duplication of the C gamma 2a heavy chain gene and generation of a novel recombination joint. The USCE occurs between (TC)n tracts adjacent to alternating purine-pyrimidine tracts. We have investigated the capacity of both the donor regions and the recombinant product involved in this event to adopt left-handed Z-DNA and intramolecular triplexes. The results of chemical probing with diethylpyrocarbonate and osmium tetroxide at the base pair level demonstrate that under the influence of negative supercoiling the alternating purine-pyrimidine regions of these plasmids can adopt Z-DNA at neutral pH, and the oligopurine.oligopyrimidine (pur.pyr) regions of these regions can adopt intramolecular triplexes at low pH (less than or equal to pH 6.0). At intermediate pH values, mixtures of both structures are present. Increasing the negative superhelical density of the plasmid does not increase the amount of triplex present at neutral pH indicating that the presence of long Z-DNA segments adjacent to pur.pyr tract prevents intramolecular triplex formation. In summary, we conclude that the sequences involved in the USCE can form either an intramolecular triplex in the (TC)n tract or Z-DNA in the alternating purine-pyrimidine tract and that Z-DNA will predominate under physiological conditions. The presence of segments which adopt Z-DNA at a site of USCE suggests that formation of this structure may enhance recombination between adjacent pur.pyr tracts.     

DNA duplex with the potential to change handedness after every half a turn.

Polymorphic forms of the DNA duplex with long stretches of structural monotony are known. Several alternating purine-pyrimidine sequences have been shown to adopt left-handed Z-conformation. We report a DNA sequence d(CGCGCGATCGAT)n exhibiting alternating right-handed B and left-handed Z helical conformation after every half a turn. Further, this unusual conformation with change in handedness after every six base pairs was induced at physiological superhelical density.     

Structural interconversion of alternating purine-pyrimidine inverted repeats cloned in supercoiled plasmids.

Two self complementary oligonucleotides, T(GC)4AT(GC)4ACATG and C(GC)2(AT)5 (GC)3ATG, were synthesized and cloned into plasmids. Negative supercoiling causes a structural transition in the primary helix of both inserts. The first sequence converts into the left-handed helix, whereas the second sequence undergoes a transition into a cruciform or a Z-type structure depending on the experimental conditions employed. This has been deduced from the mapping of S1 nuclease sensitive sites, OsO4-sensitive sites, DEP modification pattern and relaxation studies. In addition, the differential effect of 5-cytosine methylation and binding of the AT-specific drug distamycin on these transitions further supports this interpretation. Thus, it is demonstrated, that the same sequence which is both inverted repeat and alternating purine-pyrimidine type may adopt either the left-handed conformation or the cruciform structure in response to the superhelical stress. Formation of the Z-type helix can be transmitted through the d(AT)n region which is 10 bp in length.     

Probing of unusual DNA structures in topologically constrained form V DNA: use of restriction enzymes as structural probe.

The ability of DNA sequences to adopt unusual structures under the superhelical torsional stress has been studied. Sequences that are forced to adopt unusual conformation in topologically constrained pBR322 form V DNA (Lk = 0) were mapped using restriction enzymes as probes. Restriction enzymes such as BamHI, PstI, AvaI and HindIII could not cleave their recognition sequences. The removal of topological constraint relieved this inhibition. The influence of neighbouring sequences on the ability of a given sequence to adopt unusual DNA structure, presumably left handed Z conformation, was studied through single hit analysis. Using multiple cut restriction enzymes such as NarI and FspI, it could be shown that under identical topological strain, the extent of structural alteration is greatly influenced by the neighbouring sequences. In the light of the variety of sequences and locations that could be mapped to adopt non-B conformation in pBR322 form V DNA, restriction enzymes appear as potential structural probes for natural DNA sequences.     

Chemical detection of Z-DNA within the maize Adh1 promoter

Z-DNA is a left-handed helix which can form within tracts of alternating purines and pyrimidines. Tracts of potential Z-DNA identified by sequence inspection are often noted within regulatory portions of genes, but evidence that these tracts of sequence actually exist as Z-DNA is very limited, and not available for any plant gene. In this study, the chemical probes osmium tetroxide, diethylpyrocarbonate and hydroxylamine were used to show that a tract of alternating purines and pyrimidines in the Adh1 promoter (from -311 to -325) actually assumes a Z-DNA conformation under superhelical stress in vitro.     

Sequences that adopt non-B-DNA conformation in form V DNA as probed by enzymic methylation

pBR322 form V DNA is a highly torsionally strained molecule with a linking number of zero. We have used sequence-specific DNA methylases as probes for B-DNA in this molecule, exploiting the inability of methylases to methylate single-stranded DNA and Z-DNA, both of which are known to occur in form V DNA. Some sequences in form V DNA were shown to be totally in the B-form, others were totally in an altered, unmethylatable conformation, while still other sites appeared to exist partly in altered and partly in normal B-conformation. Some potential Z-forming sequences (alternating pyrimidine/purine) of less than seven base-pairs were not in the Z conformation in form V DNA, whereas others did adopt an altered structure, indicating a modulating influence of flanking sequences. Furthermore, regions of imperfect alternating pyrimidine/purine structure were sometimes capable of adopting an altered structure. In addition, some regions of altered structure had no apparent Z-forming sequences, nor were they in polypurine stretches, which have also been proposed to form left-handed DNA. These non-B-DNA conformations may represent novel left-handed helical structures or sequences that become single stranded under torsional strain. Long regions of either altered (unmethylatable) DNA or B-DNA were not always observed. In fact, one region showed three transitions between B-like DNA and altered structure within 26 base-pairs.     

S1 nuclease recognizes DNA conformational junctions between left-handed helical (dT-dG n. dC-dA)n and contiguous right-handed sequences

The ability of negative supercoiling to induce a left-handed helix in the recombinant plasmid pRW777, which contains a tract of 64 base pairs of almost perfect (dT-dG) . (dC-dA) from the mouse kappa immunoglobin gene, was studied. S1 nuclease recognizes and cleaves within the junction region which must exist adjacent to the (dT-dG)n . (dC-dA)n tract when in a left-handed state. The cleavage pattern indicates conformational flexibility and structural differences between the two existing junctions. The 64-base pair alternating copolymer undergoes the supercoil-induced formation of a left-handed state over the superhelical density range of -0.04 to -0.06, indicating that (dT-dG)n . (dC-dA) sequences form a left-handed helix less readily than (dC-dG)n . (dC-dG)n sequences of equivalent length. However, these supercoil densities are within the range found in vivo. Supercoil relaxation and antibody binding studies confirmed that the (dT-dG)n . (dC-dA)n tract in supercoiled pRW777 was in a left-handed helix.     

Multiple DNA secondary structures in perfect inverted repeat inserts in plasmids. Right-handed B-DNA, cruciforms, and left-handed Z-DNA

The capabilities of five recombinant plasmids, containing relatively long (approximately 60-100 base pairs) perfect inverted repeat (IR) inserts, to support supercoil stabilized non-B-DNA structures were studied in vitro. The IRs were also alternating purine-pyrimidine sequences, thus, each could form either left-handed Z-DNA or cruciforms. Single-strand specific endonucleases, restriction endonucleases and methylases, and OsO4 modifications were used to characterize the DNA structures. Two-dimensional gel electrophoretic studies indicated that three of the five IRs formed both cruciforms and Z-DNA. (C-G) containing inserts preferred to form Z-DNA, whereas (T-G) sequences favored cruciforms. In vivo supercoil relaxation experiments demonstrated the existence of cruciforms in Escherichia coli. The physiological significance of these structures is discussed.     

Tetracycline promoter mutations decrease non-B DNA structural transitions, negative linking differences and deletions in recombinant plasmids in Escherichia coli

The ability to clone a variety of sequences with varying capabilities of adopting non-B structures (left-handed Z-DNA, cruciforms or triplexes) into three loci of pBR322 was investigated. In general, the inserts were stable (non-deleted) in the EcoRI site (an untranslated region) of pBR322. However, sequences most likely to adopt left-handed Z-DNA or triplexes in vivo suffered deletions when cloned into the BamHI site, which is located in the tetracycline resistance structural gene (tet). Conversely, when the promoter for the tet gene was altered by filling-in the unique HindIII or ClaI sites, the inserts in the BamHI site were not deleted. Concomitantly, the negative linking differences of the plasmids were reduced. Also, inserts with a high potential to adopt Z-DNA conformations were substantially deleted in the PvuII site of pBR322 (near the replication origin and the copy number control region), but were less deleted if the tet promoter was insertion-mutated. The deletion phenomena are due to the capacity of these sequences to adopt left-handed Z-DNA or triplexes in vivo since shorter inserts, less prone to form non-B DNA structures, or random sequences, did not exhibit this behavior. Sequences with the potential to adopt cruciforms were stable in all sites under all conditions. These results reveal a complex interrelationship between insert deletions (apparently the result of genetic recombination), negative supercoiling, and the formation of non-B DNA structures in living Escherichia coli cells.     

Conversions of the left-handed form and the protonated form of DNA back to the bound right-handed form by sanguinarine and ethidium: a comparative study

The interaction of sanguinarine and ethidium with right-handed (B-form), left-handed (Z-form) and left-handed protonated (designated as H(L)-form) structures of poly(dG-dC).poly(dG-dC) and poly(dG-me5dC).poly(dG-me5dC) was investigated by measuring the circular dichroism and UV absorption spectral analysis. Both sanguinarine and ethidium bind strongly to the B-form DNA and convert the Z-form and the H(L)-form back to the bound right-handed form. Circular dichroic data also show that the conformation at the binding site is right-handed, even though adjacent regions of the polymer have a left-handed conformation either in Z-form or in H(L)-form. Both the rate and extent of B-form to Z-form transition were decreased by sanguinarine and ethidium under ionic conditions that otherwise favour the left-handed conformation of the polynucleotides. The rate of decrease is faster in the case of ethidium as compared to that of sanguinarine. Scatchard analysis of the spectrophotometric data shows that sanguinarine binds strongly to both the polynucleotides in a non-cooperative manner under B-form conditions, in sharp contrast to the highly-cooperative binding under Z-form and H(L)-form conditions. Correlation of binding isotherms with circular dichroism data indicates that the cooperative binding of sanguinarine under the Z-form and the H(L)-form conditions is associated with a sequential conversion of the polymer from a left-handed to a bound right-handed conformation. Determination of bound alkaloid concentration by spectroscopic titration technique and the measurement of circular dichroic spectra have enabled us to calculate the number of base pairs of Z-form and H(L)-form that adopt a right-handed conformation for each bound alkaloid. Analysis reveals that 2-3 base pairs (bp) of Z-form of poly(dG-dC).poly(dG-dC) and poly(dG-me5dC).poly(dG-me5dC) switch to the right-handed form for each bound sanguinarine, while approximately same number of base pairs switch to the bound right-handed form in complexes with H(L)-form of these polynucleotides. Comparative binding analysis shows that ethidium also converts approximately 2 bp of Z-form or H(L)-form to bound right-handed form under same experimental conditions. Since sanguinarine binds preferentially to alternating GC sequences, which are capable of undergoing the B to Z or B to H(L) transition, these effects may be an important part in understanding its extensive biological activities.     

B-Z DNA junctions contain few, if any, nonpaired bases at physiological superhelical densities

The reactions of bromoacetaldehyde (BAA) with recombinant plasmids that contain sequences which can adopt left-handed Z structures or, at other locations, cruciforms were studied as a function of supercoil density. The sequence in pRW756 that undergoes a supercoil induced transition from a right to left-handed helix was (dC-dG)16 and regions near the replication origin of the pBR322 vector were converted from linearforms to cruciforms. The locations of the most nonpaired structural features were mapped by S1 nuclease cleavage of the "wedged open" duplexes after linearization of the DNAs. Three cruciforms in the pBR322 portions of the plasmids were specifically detected by BAA reaction at physiological supercoil densities (sigma = -0.067). However, the B-Z junctions did not react with BAA under these conditions although the junctions were present since the (dC-dG)16 was shown to be left-handed. Thus, the B-Z junctions have less single-stranded character than the pBR322 cruciforms (3-6 nonpaired bases) and may be fully paired. At much higher superhelical densities (sigma = -0.11-0.12), the B-Z junctions as well as the cruciforms react with BAA indicating a change in the nature of the junctions. Studies were also performed with pRW777 which harbors the mouse kappa immunoglobin sequence (dT-dG)32 . (dC-dA)32 that adopts a left-handed helix under appropriate conditions; the results were similar to those found with pRW756.     

HhaI methylase and restriction endonuclease as probes for B to Z DNA conformational changes in d(GCGC) sequences.

The capacity of the modification methylase (MHhaI) and restriction endonuclease (HhaI) form Haemophilus haemolyticus to methylate and cleave, respectively, recognition sites which are in right-handed B or left-handed Z structures was determined in vitro. Plasmids containing tracts of (dC-dG) as well as numerous individual d(GCGC) sites distributed around the vector were studied. Negative supercoiling was used to convert the (dC-dG) tracts (approximately 30 bp in length) from a right-handed to a left-handed conformation. (Methyl-3H)-SAM was used to localize and quantitate modified d(GCGC) recognition sites, whereas cleavage by HhaI was used to detect unmethylated sites. In the left-handed Z-form, the (dC-dG) blocks were not methylated by MHhaI and not cleaved by HhaI. A two-dimensional gel analysis of a family of 33 topoisomers treated with MHhaI revealed that the lack of methylation in the (dC-dG) blocks was directly correlated to the supercoil-induced B to Z transition in these segments. These results are significant with respect to enzyme-DNA interactions in general and provide the basis for using HhaI and MHhaI as probes for different DNA structures and conformational transitions under physiological conditions.     

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in negatively supercoiled plasmids at pH 5.2 (Caddle, M. S., Lussier, R. L., and Heintz, N. H. (1990) J. Mol. Biol. 211, 19-33). To further characterize the structural organization, supercoiled plasmids containing this region were analyzed in vitro with OsO4 and diethyl pyrocarbonate probes as well as with two-dimensional gel electrophoresis under different conditions. In pMCG, which contains the sequence in a 1.6-kilobase pair insert, the preferred conformation at neutral pH and at the native superhelical density is a Z-DNA structure for the (GC)5(AC)18 tract. Under mildly acidic conditions and at the native superhelical density, both (AG) tracts form intramolecular triplexes to the exclusion of the Z-DNA structure. Chemical probing of topoisomers of pMCG indicates that the (AG)27 tract forms a triplex more readily than the (AG)21 motif. Also, analysis of the reactivity obtained on a larger plasmid, pMCD, which contains the cluster of repeated sequences in a 4.75-kilobase pair insert, shows that at the native superhelical density the formation of intramolecular triplexes is limited to the (AG)27 tract. Finally, experiments conducted on different populations of topoisomers of pMCG show the existence, at pH 5.0 and highly negative superhelical density (greater than or equal to 0.080), of both the left-handed and the two triple-stranded structures in the same DNA. Therefore, one triplex is located immediately adjacent to the Z helix. Companion studies revealed that this region of the DHFR replicon modulates fork translocation during the replication of recombinant plasmids in mammalian cells.     

Left-handed Z-DNA helices in polymers, restriction fragments, and recombinant plasmids

Studies on DNA polymers, restriction fragments, and recombinant plasmids have revealed the following: A) A family of left-handed DNA conformations exists for (dC-dG)n.(dC-dG)n. The observation of a particular conformation is dependent on the salt, the salt concentration and dehydrating agent. B) In sodium acetate solutions, (dC-dG)n.(dC-dG)n forms left-handed, psi(+)-condensed structures as detected by Raman spectroscopy and circular dichroism. C) (dT-dG)n.(dC-dA)n undergoes a right-to-left-handed transition only when reacted with AAF and at high salt concentrations. D) Transitions observed for polymer DNAs also are observed for restriction fragments containing both (dC-dG).(dC-dG) and (dT-dG).(dC-dA) sequences, but the transitions in the fragments generally require higher salt concentrations than observed for the polymers. E) Studies with recombinant plasmids containing (dC-dG) sequences from 10 to 58 bp in length demonstrate that left-handed Z-DNA segments can exist contiguous to B-DNA segments. F) Negative supercoil density (sigma less than or equal to -0.072) is sufficient to convert the (dC-dG) regions in those plasmids into left-handed structures under physiological ionic conditions (200 mM NaCl). G) The favorable free energy contribution of methylation in stabilizing the Z form in fragments and plasmids is approximately offset by the unfavorable free energy contributions of the B/Z junctions. H) Sl and BAL 31 nucleases recognize aberrant structural features at the confluence of the B and Z regions. I) Detailed mapping of Sl nuclease cleavage on supercoiled plasmids shows that the nuclease sensitive regions extend over at least five to ten bp. J) Even though the (dT-dG)n.(dC-dA)n polymer requires base modification and high salt conditions to undergo the R----L transition, supercoiling (sigma less than or equal to -0.07) can supply enough energy to allow a plasmid containing the intervening sequence of a human fetal globin gene with (dT-dG).(dC-dA) sequences to undergo a R----L transition.     

B-Z junctions in supercoiled pRW751 DNA contain unpaired bases or non-Watson-Crick base pairs

Structural distortions on the boundary between right-handed and left-handed DNA segments in negatively supercoiled plasmid pRW751 (a derivative of pBR322 containing (dC-dG)13 and (dC-dG)16 segments) were studied by means of osmium tetroxide, pyridine and glyoxal. These two probes react preferentially with single-stranded DNA, but only the latter requires non-paired bases for the reaction. Nuclease S1 and testing of the inhibition of BamHI cleavage (whose recognition sequences GGATCC lie on the "outer" boundaries between the (dC-dG)n and the pBR322 nucleotide sequence) were used to detect the site-specific chemical modification in pRW751. As a result of glyoxal treatment BamHI cleavage was strongly inhibited in topoisomeric samples whose superhelical density was sufficiently negative to stabilize the (dC-dG)n segments in the left-handed form. Osmium tetroxide, pyridine modification resulted in a similar inhibition of BamHI cleavage and in a formation of nuclease S1 sensitive sites. The results suggest that the "outer" B-Z junctions in pRW751 contain one or few non-paired bases or non-Watson-Crick base pairs.