Comparison of interproton distances in DNA models with nuclear Overhauser enhancement data

The conformational flexibility inherent in the polynucleotide chain plays an important role in deciding its three-dimensonal structure and enables it to undergo structural transitions in order to fulfil all its functions. Following certain stereochemical guidelines, both right and left handed double-helical models have been built in our laboratory and they are in reasonably good agreement with the fibre patterns for various polymorphous forms of DNA. Recently, nuclear magnetic resonance spectroscopy has become an important technique for studying the solution conformation and polymorphism of nucleic acids. Several workers have used 1_H nuclear magnetic resonance nuclear Overhauser enhancement measurements to estimate the interproton distances for the various DNA oligomers and compared them with the-interproton distances for particular models of A and B form DNA. In some cases the solution conformation does not seem to fit either of these models. We have been studying various models for DNA with a view to exploring the full conformational space allowed for nucleic acid polymers. In this paper, the interproton distances calculated for the different stereochemically feasible models of DNA are presented and they are compared and correlated against those obtained from¹H nuclear magnetic resonance nuclear Overhauser enhancement measurements of various nucleic acid oligomers.     

Oxidative and non-oxidative DNA damage and cardiovascular disease

Abstract

Evidence for the association of DNA damage with cardiovascular disease has been obtained from in vitro cell culture models, experimental cardiovascular disease and analysis of samples obtained from humans with disease. There is general acceptance that several factors associated with the risk of developing cardiovascular disease cause oxidative damage to DNA in cell culture models with both nuclear and mitochondrial DNA as targets. Moreover, evidence obtained over the past 10 years points to a possible mechanistic role for DNA damage in experimental atherosclerosis culminating in recent studies challenging the assumption that DNA damage is merely a biomarker of the disease process. This kind of mechanistic insight provides a renewed impetus for further studies in this area.     

DNA Models for A,B, C and D Conformations Related to Fiber X-ray,Infrared and NMR Measurements

Abstract

A conformational analysis of the A, B, C and D DNA forms was made in order to establish molecular models presenting a good agreement with experimental data obtained from fiber X-ray, infrared linear dichroism and ³¹P NMR. The proposed models have been refined and do present good stereochemistry and optimized H-bond distances between bases associated with the Watson-Crick pairing. The DNA conformations proposed are a left handed double helix for the C form and right handed helices for A, B and D. Relations to conformational transitions between these forms are discussed.     

Conformations of C-DNA in Agreement with Fiber X-ray and Infrared Dichroísm

Abstract

Different left handed double helices are proposed as models for DNA fibers in the C form. These conformations have geometrical parameters which agree well with fiber X-ray data and the orientations of their phosphate groups are in good agreement with infrared dichroísm results. A complete set of atomic coordinates and dihedral angles are given together with curves of calculated diffracted intensities. The present results are compared with experimental values and with the other C-DNA models.     

Comparative modeling of DNA and RNA polymerases from Moniliophthora perniciosa mitochondrial plasmid

Background  

The filamentous fungus Moniliophthora perniciosa (Stahel) Aime & Phillips-Mora is a hemibiotrophic Basidiomycota that causes witches' broom disease of cocoa (Theobroma cacao L.). This disease has resulted in a severe decrease in Brazilian cocoa production, which changed the position of Brazil in the market from the second largest cocoa exporter to a cocoa importer. Fungal mitochondrial plasmids are usually invertrons encoding DNA and RNA polymerases. Plasmid insertions into host mitochondrial genomes are probably associated with modifications in host generation time, which can be involved in fungal aging. This association suggests activity of polymerases, and these can be used as new targets for drugs against mitochondrial activity of fungi, more specifically against witches' broom disease. Sequencing and modeling: DNA and RNA polymerases of M. perniciosa mitochondrial plasmid were completely sequenced and their models were carried out by Comparative Homology approach. The sequences of DNA and RNA polymerase showed 25% of identity to 1XHX and 1ARO (pdb code) using BLASTp, which were used as templates. The models were constructed using Swiss PDB-Viewer and refined with a set of Molecular Mechanics (MM) and Molecular Dynamics (MD) in water carried out with AMBER 8.0, both working under the ff99 force fields, respectively. Ramachandran plots were generated by Procheck 3.0 and exhibited models with 97% and 98% for DNA and RNA polymerases, respectively. MD simulations in water showed models with thermodynamic stability after 2000 ps and 300 K of simulation.     

The conformations and energetics of photodamaged DNA

Energy minimization techniques are used in conjunction with the results of small molecule crystallographic studies on relevant compounds to propose structural models for photodamaged DNAs. Specifically, we present models both for a DNA molecule containing a psoralen photo-crosslink and for a DNA molecule containing a thymine photodimer. In both models, significant distortions of the nucleic acid helix are observed, including kinking and unwinding at the damage site and numerous changes in the backbone torsion angles relative to their standard conformations. Both the torsion angle geometries and the energetics of the models are presented in detail.     

Mechanical properties of symmetric and asymmetric DNA A-tracts: implications for looping and nucleosome positioning

A-tracts are functionally important DNA sequences which induce helix bending and have peculiar structural properties. While A-tract structure has been qualitatively well characterized, their mechanical properties remain controversial. A-tracts appear structurally rigid and resist nucleosome formation, but seem flexible in DNA looping. In this work, we investigate mechanical properties of symmetric A_nT_n and asymmetric A_2n tracts for n = 3, 4, 5 using two types of coarse-grained models. The first model represents DNA as an ensemble of interacting rigid bases with non-local quadratic deformation energy, the second one treats DNA as an anisotropically bendable and twistable elastic rod. Parameters for both models are inferred from microsecond long, atomic-resolution molecular dynamics simulations. We find that asymmetric A-tracts are more rigid than the control G/C-rich sequence in localized distortions relevant for nucleosome formation, but are more flexible in global bending and twisting relevant for looping. The symmetric tracts, in contrast, are more rigid than asymmetric tracts and the control, both locally and globally. Our results can reconcile the contradictory stiffness data on A-tracts and suggest symmetric A-tracts to be more efficient in nucleosome exclusion than the asymmetric ones. This would open a new possibility of gene expression manipulation using A-tracts.     

Size distribution of DNA replicative intermediates in bacteriophage P4 and in Escherichia coli.

We have tested the hypothesis that Okazaki fragment replicative intermediates have defined termini using as a model system the in vivo DNA replication of the tiny bacteriophage P4. The kinetics of formation of intermediates in P4 DNA replication have been investigated. P4 DNA replication in DNA polymerase I-deficient mutants generates Okazaki fragments with a size distribution similar to that in uninfected cells. When P4-derived Okazaki fragments are resolved by agarose gel electrophoresis, no discrete size classes appear. This finding is incompatible with sequence-specific models of Okazaki fragment formation but supports the view that these replication intermediates are initiated and terminated at random locations on the P4 chromosome.     

Topologies of Complexes Containing O-Alkylguanine-DNA Alkyltransferase and DNA

The mutagenic and cytotoxic effects of many alkylating agents are reduced by O⁶-alkylguanine-DNA alkyltransferase (AGT). In humans, this protein not only protects the integrity of the genome, but also contributes to the resistance of tumors to DNA-alkylating chemotherapeutic agents. Here we describe and test models for cooperative multiprotein complexes of AGT with single-stranded and duplex DNAs that are based on in vitro binding data and the crystal structure of a 1:1 AGT-DNA complex. These models predict that cooperative assemblies contain a three-start helical array of proteins with dominant protein-protein interactions between the amino-terminal face of protein n and the carboxy-terminal face of protein n + 3, and they predict that binding duplex DNA does not require large changes in B-form DNA geometry. Experimental tests using protein cross-linking analyzed by mass spectrometry, electrophoretic and analytical ultracentrifugation binding assays, and topological analyses with closed circular DNA show that the properties of multiprotein AGT-DNA complexes are consistent with these predictions.     

Stretching DNA origami: effect of nicks and Holliday junctions on the axial stiffness

The axial stiffness of DNA origami is determined as a function of key nanostructural characteristics. Different constructs of two-helix nanobeams with specified densities of nicks and Holliday junctions are synthesized and stretched by fluid flow. Implementing single particle tracking to extract force–displacement curves enables the measurement of DNA origami stiffness values at the enthalpic elasticity regime, i.e. for forces larger than 15 pN. Comparisons between ligated and nicked helices show that the latter exhibit nearly a two-fold decrease in axial stiffness. Numerical models that treat the DNA helices as elastic rods are used to evaluate the local loss of stiffness at the locations of nicks and Holliday junctions. It is shown that the models reproduce the experimental data accurately, indicating that both of these design characteristics yield a local stiffness two orders of magnitude smaller than the corresponding value of the intact double-helix. This local degradation in turn leads to a macroscopic loss of stiffness that is evaluated numerically for multi-helix DNA bundles.     

On the origin of DNA genomes: evolution of the division of labor between template and catalyst in model replicator systems

The division of labor between template and catalyst is a fundamental property of all living systems: DNA stores genetic information whereas proteins function as catalysts. The RNA world hypothesis, however, posits that, at the earlier stages of evolution, RNA acted as both template and catalyst. Why would such division of labor evolve in the RNA world? We investigated the evolution of DNA-like molecules, i.e. molecules that can function only as template, in minimal computational models of RNA replicator systems. In the models, RNA can function as both template-directed polymerase and template, whereas DNA can function only as template. Two classes of models were explored. In the surface models, replicators are attached to surfaces with finite diffusion. In the compartment models, replicators are compartmentalized by vesicle-like boundaries. Both models displayed the evolution of DNA and the ensuing division of labor between templates and catalysts. In the surface model, DNA provides the advantage of greater resistance against parasitic templates. However, this advantage is at least partially offset by the disadvantage of slower multiplication due to the increased complexity of the replication cycle. In the compartment model, DNA can significantly delay the intra-compartment evolution of RNA towards catalytic deterioration. These results are explained in terms of the trade-off between template and catalyst that is inherent in RNA-only replication cycles: DNA releases RNA from this trade-off by making it unnecessary for RNA to serve as template and so rendering the system more resistant against evolving parasitism. Our analysis of these simple models suggests that the lack of catalytic activity in DNA by itself can generate a sufficient selective advantage for RNA replicator systems to produce DNA. Given the widespread notion that DNA evolved owing to its superior chemical properties as a template, this study offers a novel insight into the evolutionary origin of DNA.     

Interplay between DNA repair and inflammation,and the link to cancer

Abstract

DNA damage and repair are linked to cancer. DNA damage that is induced endogenously or from exogenous sources has the potential to result in mutations and genomic instability if not properly repaired, eventually leading to cancer. Inflammation is also linked to cancer. Reactive oxygen and nitrogen species (RONs) produced by inflammatory cells at sites of infection can induce DNA damage. RONs can also amplify inflammatory responses, leading to increased DNA damage. Here, we focus on the links between DNA damage, repair, and inflammation, as they relate to cancer. We examine the interplay between chronic inflammation, DNA damage and repair and review recent findings in this rapidly emerging field, including the links between DNA damage and the innate immune system, and the roles of inflammation in altering the microbiome, which subsequently leads to the induction of DNA damage in the colon. Mouse models of defective DNA repair and inflammatory control are extensively reviewed, including treatment of mouse models with pathogens, which leads to DNA damage. The roles of microRNAs in regulating inflammation and DNA repair are discussed. Importantly, DNA repair and inflammation are linked in many important ways, and in some cases balance each other to maintain homeostasis. The failure to repair DNA damage or to control inflammatory responses has the potential to lead to cancer.     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.     

A Theoretical Study of Formation of DNA Noncanonical Structures Under Negative Superhelical Stress

Abstract

The development of statistical mechanical models of the formation of noncanonical structures in circular DNA and the finding of the energy parameters for these models made it possible to predict the appearance of such structures in a DNA with any given sequence. It does not seem feasible, however, to perform such calculations for DNA sequences of considerable length by allowing for all the possible states. We propose a special algorithm for calculating the thermodynamic characteristics of various conformational rearrangements in DNA that occur under negative supercoilings, allowing for several possible states of each base pair in the chain. Calculations have been performed for a number of natural DNAs. According to these calculations, the most likely noncanonical structures in DNA under normal conditions are cruciform structures and the Z form. The results of the calculations are compared with the experimental data reported in the literature. State diagrams have been computed for a number of inserts in circular DNA that can adopt both the cruciform conformation and the left-handed helical Z form.     

De-intercalation of ethidium bromide and propidium iodine from DNA in the presence of caffeine

Caffeine (CAF) is capable of interacting directly with several genotoxic aromatic ligands by stacking aggregation. Formation of such hetero-complexes may diminish pharmacological activity of these ligands, which is often related to its direct interaction with DNA. To check these interactions we performed three independent series of spectroscopic titrations for each ligand (ethidium bromide, EB, and propidium iodine, PI) according to the following setup: DNA with ligand, ligand with CAF and DNA-ligand mixture with CAF. We analyzed DNA-ligand and ligand-CAF mixtures numerically using well known models: McGhee-von Hippel model for ligand-DNA interactions and thermodynamic-statistical model of mixed association of caffeine with aromatic ligands developed by Zdunek et al. (2000). Based on these models we calculated association constants and concentrations of mixture components using a novel method developed here. Results are in good agreement with parameters calculated in separate experiments and demonstrate de-intercalation of EB and PI molecules from DNA caused by CAF.     

From Nonspecific DNA–Protein Encounter Complexes to the Prediction of DNA–Protein Interactions

DNA–protein interactions are involved in many essential biological activities. Because there is no simple mapping code between DNA base pairs and protein amino acids, the prediction of DNA–protein interactions is a challenging problem. Here, we present a novel computational approach for predicting DNA-binding protein residues and DNA–protein interaction modes without knowing its specific DNA target sequence. Given the structure of a DNA-binding protein, the method first generates an ensemble of complex structures obtained by rigid-body docking with a nonspecific canonical B-DNA. Representative models are subsequently selected through clustering and ranking by their DNA–protein interfacial energy. Analysis of these encounter complex models suggests that the recognition sites for specific DNA binding are usually favorable interaction sites for the nonspecific DNA probe and that nonspecific DNA–protein interaction modes exhibit some similarity to specific DNA–protein binding modes. Although the method requires as input the knowledge that the protein binds DNA, in benchmark tests, it achieves better performance in identifying DNA-binding sites than three previously established methods, which are based on sophisticated machine-learning techniques. We further apply our method to protein structures predicted through modeling and demonstrate that our method performs satisfactorily on protein models whose root-mean-square Cα deviation from native is up to 5 Å from their native structures. This study provides valuable structural insights into how a specific DNA-binding protein interacts with a nonspecific DNA sequence. The similarity between the specific DNA–protein interaction mode and nonspecific interaction modes may reflect an important sampling step in search of its specific DNA targets by a DNA-binding protein.