Variants of a cloned synthetic lactose operator: I. A palindromic dimer lactose operator derived from one strand of the cloned 40-base pair operator

Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence

where the horizontal arrows indicate the locations of the two 21-bp “core? operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for EcoKL, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro.     

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Plasmids containing many tandem copies of a synthetic lactose operator

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.     

Absence of DNA sequence homology with genes of the Escherichia coli hemB locus in Shiga-toxin producing E. coli (STEC) O157 strains

By molecular cloning of chromosomal DNA of a human faecal Escherichia coli O6:non-motile strain, we identified a 1350-bp DNA segment which is commonly present in laboratory and wild-type E. coli strains but had no homology to DNA of Shiga-toxin producing E. coli O157, O145 and enteropathogens E. coli O55 strains. The nucleotide sequence of the 1350-bp segment cloned on plasmid pEO67 was determined (GenBank accession number AF087670) and a 97.2% sequence homology was found to a region of the E. coli hemB locus with an unknown gene function. The introduction of pEO67 into an STEC O157:H- strain had a stimulating effect on the growth of the recipient strain which was most expressed when bacteria were grown in iron depleted M9 medium with hemin added as the exogenous iron source. This growth effect was not observed with E. coli K-12 carrying pEO67. We suggest that the cloned gene is involved in iron uptake of E. coli and that the alteration in this part of the hemB locus is clonally inherited in genetically closely related STEC O157 and O55 strains.     

A synthetic translation-terminator gene: A tool for dissecting the translation direction of a gene

A 41-nucleotide-long duplex DNA, which contains the translation termination codon TAA in six reading frames and lactose operator sequence of Escherichiacoli, has been synthesized. This fragment may be useful not only for producing a truncated protein encoded in a plasmid, but also for the identification of the precise coding region and translation direction of a bacterial gene in the cloned chromosomal segment. The synthetic fragment was inserted into ß-lactamase structural gene in pBR322 in order to test the in vivo activity. The plasmid produced mutant ß-lactamase reduced in size, as expected from the insertion site, and rendered the host bacterium constitutive for ß-galactosidase. Thus, termination codons and lactose operator in synthetic nucleotide appear to be functional in vivo.     

Cloned seventeen-nucleotide-long synthetic lactose operator is biologically active.

A 17-nucleotide-long synthetic DNA molecule constituting the minimal recognition sequence of the lactose operator has been cloned in E. coli using the vehicle pBR313 and a synthetic HindIII adaptor. The clones containing the lac-pBR313 hybrid DNA constitutively produced beta-galactosidase. The level of beta-galactosidase was high and comparable to that obtained in cells carrying a 21-nucleotide-long synthetic lac operator on pMB9 plasmid or cells carrying a natural lac operator on pOP203-1 plasmid.     

Cloning of small DNA fragments containing the Escherichia coli tryptophan operon promoter and operator

A41-bp AluI restriction fragment from the trp promoter-operator region has been cloned into the PvuII site of pBR322, regenerating PvuII sites. Transformants were selected on media that allowed the selection of trp-operator-bearing plasmids. The cloned 41-bp fragment can be released from the vector by PvuII digestion, and it possesses a functional promoter and operator as demonstrated by in vivo tests. The 41-bp fragment contains several restriction sites: HincII, TaqI, RsaI, and a HpaI site that is located at the center of the operator sequence. Two new operator derivatives, symmetrical about the HpaI site, were prepared from the 41-bp fragment by joining two right-side, or two left-side PvuII-HpaI pieces together at the HpaI site. These derivatives showed in vivo operator activity. Plasmids containing up to five copies of the 41-bp trp-promoter-operator fragment have been constructed. These plasmids should be useful in preparing large amounts of the 41-bp fragment.     

Organization and chromosomal localization of a B1-like containing repeat of Microtus subarvalis

A repetitive DNA sequence, MS2, was isolated from EcoRI-digested genomic DNA of the vole, Microtus subarvalis. The fragment was cloned and sequenced. Sequence analysis of this 1194-bp fragment revealed a 156-bp region demonstrating a 55% homology with the mouse B1 repeat. The remaining MS2 sequence shows no significant homology with other known GenBank sequences. The results of in situ hybridization of MS2 on vole metaphase chromosomes indicate the fragment is confined to heterochromatin blocks of the sex chromosomes in all but one species (M. arvalis). Distribution of MS2 sequences provides evidence for heterogeneity of the giant heterochromatin blocks of the XY Chromosomes (Chrs) in voles, for the unique cluster-like localization of MS2 within these blocks. Received: 10 October 1995 / Accepted: 30 March 1996     

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.     

The aryldialkylphosphatase-encoding gene adpB from Nocardia sp. strain B-1: cloning, sequencing and expression in Escherichia coli.

Using degenerate oligodeoxyribonucleotides (oligos) derived from the N-terminal sequence of an aryldialkylphosphatase (ADPase) from Nocardia sp. strain B-1, an amplification reaction was used to isolate a DNA segment containing a 57-bp fragment from the adpB gene. Based on the nucleotide (nt) sequence of this fragment, a nondegenerate oligo was synthesized and used to screen a subgenomic library of strain B-1 DNA for fragments containing adpB. A 3.55-kb PstI fragment containing adpB was cloned into Escherichia coli, and the nt sequence of a 1600-bp region containing adpB was determined. Under control of the lac promoter of pUC19, adpB expression in E. coli cultures was approx. 15-fold higher than in strain B-1 under the native adpB promoter. Comparison of adpB with the Flavobacterium ADPase-encoding gene, opd, revealed no significant homology at the nt or aa levels.     

Synthesis of DNA coding for human proinsulin

A chemical-enzymatic synthesis of 271- and 286-bp DNA duplexes, each of which contains the entire sequence coding for human proinsulin has been accomplished. In addition to the coding sequence, the 271-bp fragment carries translation initiation and termination signals plus EcoRI-HindIII restriction enzyme sites for insertion into an appropriate plasmid vector. The 286-bp fragment also contains a Shine-Dalgarno (SD) sequence preceding an ATG codon. Employing the 286-bp polynucleotide, the 568-bp tandem proinsulin gene has been obtained. The synthesis of these DNA fragments involved preparation of 42 oligonucleotides by a rapid N-methylimidazolide phosphotriester method and enzymatic conversion of the oligonucleotides into the gene subfragments, which were cloned separately and fused to yield the desired DNAs coding for proinsulin. The proinsulin gene fragments were cloned in Escherichia coli and shown to have the correct sequences.     

Long tandem arrays of complex repeat units in Chironomus telomeres.

A cloned 340-bp DNA fragment excised by EcoRI from the Chironomus pallividittatus genome has been localized to the telomeres by in situ hybridization as well as to connectives between telomeres. No hybridization was observed in other regions of the chromosomes. Another cloned EcoRI fragment, 525 bp long has also been studied. This represents a partial duplication of the 340-bp sequence. Genomic blot hybridization experiments show that the 340-bp sequence is a representative monomeric unit of tandemly repeated arrays which account for 1.2% of the Chironomus genome, on average 300 kb per telomere. The repeat unit contains two types of subrepeats each present twice per repeat unit. Northern blot hybridization experiments show that the telomere-associated sequences are transcribed into a discrete RNA species approximately 20 kb in size. The evolution of this telomere-associated DNA is discussed.     

Structure of the murine mb-1 gene encoding a putative sIgM-associated molecule

Genomic DNA clones containing the B cell-specific murine mb-1 gene were isolated and a 5.6-kb BamH I fragment was characterized. It is 5629 bp long and contains five exons: an exon containing the 5' untranslated and the coding sequence of the signal peptide, an exon of 294 bp, which contains most of the extracellular sequence of the MB-1 protein, a 119-bp long exon coding mainly for the transmembrane portion, and two exons of 69 bp and 427 bp encoding the cytoplasmic domain and the 3'-untranslated region, respectively. The mb-1 gene does not contain a "TATA box" found in many eukaryotic promoters. The 5'-flanking region has sequence stretches homologous to IgVH 5'-promoter regions and a bcl 2 intron sequence. It contains the decanucleotide sequence (ATGGCAAATA) almost identical to the octamer motif of IgVH promoters. A B cell-specific DNase I-hypersensitive site was found in the 3'-flanking region indicating that this region might be involved in B cell-specific expression of mb-1. Southern blot analysis of genomic liver DNA with the cloned mb-1 cDNA suggests the existence of another mb-1-related gene segment.     

Identification of a sequence containing the positive regulatory region of Saccharomyces cerevisiae gene ENO1

A DNA fragment which contains the 5'-flanking region of the Saccharomyces cerevisiae enolase 1 gene (ENO1) and a portion of the coding sequence was cloned in a plasmid pMC1587. This fragment was fused in frame to the lacZ gene of Escherichia coli. Many mutants which deleted a portion of the 5'-flanking region of ENO1 were isolated from this ENO1-lacZ fusion plasmid by in vitro recombination. Analysis of beta-galactosidase activity of these mutants indicated that the regulatory region responsible for an efficient expression of the ENO1-lacZ fused gene resides within an 86-bp sequence located at -487 to -402 upstream from the start codon of ENO1. We found that the segment encompassing the 86-bp region worked equally well in an inverted orientation, but the tandem duplication of the sequence did not enhance the expression of the fused gene.     

Novel method for identifying sequence-specific DNA-binding proteins.

We developed a general method for the enrichment and identification of sequence-specific DNA-binding proteins. A well-characterized protein-DNA interaction is used to isolate from crude cellular extracts or fractions thereof proteins which bind to specific DNA sequences; the method is based solely on this binding property of the proteins. The DNA sequence of interest, cloned adjacent to the lac operator DNA segment is incubated with a lac repressor-beta-galactosidase fusion protein which retains full operator and inducer binding properties. The DNA fragment bound to the lac repressor-beta-galactosidase fusion protein is precipitated by the addition of affinity-purified anti-beta-galactosidase immobilized on beads. This forms an affinity matrix for any proteins which might interact specifically with the DNA sequence cloned adjacent to the lac operator. When incubated with cellular extracts in the presence of excess competitor DNA, any protein(s) which specifically binds to the cloned DNA sequence of interest can be cleanly precipitated. When isopropyl-beta-D-thiogalactopyranoside is added, the lac repressor releases the bound DNA, and thus the protein-DNA complex consisting of the specific restriction fragment and any specific binding protein(s) is released, permitting the identification of the protein by standard biochemical techniques. We demonstrate the utility of this method with the lambda repressor, another well-characterized DNA-binding protein, as a model. In addition, with crude preparations of the yeast mitochondrial RNA polymerase, we identified a 70,000-molecular-weight peptide which binds specifically to the promoter region of the yeast mitochondrial 14S rRNA gene.     

Genomic clones of a wild-type allele and a transposable element-induced mutant allele of the sucrose synthase gene of Zea mays L

In an attempt to isolate the transposable genetic element Ds from Zea mays L., we cloned DNA fragments hybridizing to a cDNA clone derived from the sucrose synthase gene in a λ vector (λ::Zm Sh). The fragments cloned from wild-type and from the Ds-induced mutant sh-m5933 (λ::Zm sh-m5933) share a segment 6 kb long while a contiguous segment of 15 kb of λ::Zm sh-m5933 (mutant-derived DNA) does not hybridize to the DNA segment cloned from the wild-type. Restriction maps are given, and the junction point between the two DNA segments in the mutant clone was determined. Hybridization of DNA fragments, present in the wild-type DNA of λ::Zm Sh, but not in the mutant clone, λ::Zm sh-m5933, to genomic DNA of sh-m5933 showed that no part of this DNA is deleted. It cannot be said whether the DNA found in the mutant, but not in the wild-type clone, has been brought there by Ds insertion or by another Ds-dependent DNA rearrangement. The mutant-derived DNA was hybridized to genomic DNA of various maize lines digested by several restriction endonucleases. Approximately 40 bands were detected. The mutant-derived DNA contains two pairs of inverted repeats several hundred nucleotide pairs long, one of which is located at the junction to wild-type-derived DNA.