1H NMR conformational study of a variety of alpha-anomers of C5-substituted 2'-deoxyuridines: comparison to their antiherpetic beta counterparts

Although alpha-nucleosides are not found in nucleic acid, they do occur as constituents of smaller molecules in living cells, e.g., in vitamin B(12). There are now several examples of alpha-nucleosides exerting a biological activity in some instances equal to, or even exceeding, that of the corresponding beta-anomer. Examples include growth inhibitory properties against mouse leukemia cells and antitumor activity. From stereochemical point of view, alpha-anomers serve as references for studying of interaction of the base with the sugar moiety in beta-anomers and may help in better understanding of structure-activity relationships. One important problem preventing conformational analysis of alpha nucleosides is uncertainty in the determination of vicinal coupling constants from simulation of overlapping sugar proton resonances of strongly coupled spin systems. A successful resolution of near-isochronous H3' and H4' resonances made possible a full conformational analysis for a series of alpha-anomers C5-substituted 2'-deoxyuridines, including methyl, ethyl, isopropyl, fluor, vinyl, and bromovinyl, in comparison to their beta counterparts. Conformation of the sugar ring is determined from proton-proton coupling constants and described in terms of pseudorotation between two main puckering domains C2'endo (S) and C3'endo (N). A thorough analysis of chemical shifts as well as conformation of the sugar ring and C4'-C5' rotamers made possible determination of conformational preferences in equilibrium about the glycosidic bond between two regions, anti and syn. This work provides insights into the role of anomeric configuration of the base in conformational behavior of the sugar moiety, a link in the backbone of nucleic acids.     

The nature of conformational correlations in alpha- and beta-anomers of nucleic acid components in aqueous solution by nuclear magnetic resonance

The solution distribution of combinations of the sugar ring puckering domains, C2'endo(S), C3'endo(N), and C4'-C5' rotamers, +sc(g+), ap(t), -sc(g-), in alpha and beta-anomers in ribo- and deoxyribo- pyrimidine nucleic acid components can be determined from vicinal coupling constants (M. Remin, J. Biomol. Str. Dyn. 2, 211 (1984). A general correlation pattern with a conformational constant lambda reflecting an intrinsic physical property of the sugar-side chain ensemble, is developed and expressed in terms of four principles: I) The +sc rotamer contributes to the C3'endo population to a higher extent (1-Yt) than to C2'endo, (1-Yt-Yg-/Xs). II) The ap rotamer contributes to both C2'endo and C3'endo populations to the same extent (Yt). III) The -sc rotamer contributes only to the C2'endo population, (Yg-/Xs). IV) The molar fractions Xs, Yt and Yg- of conformations C2'endo, ap and -sc, respectively, are strongly correlated, lambda = (Yg-/Xs)/Yt approximately 0.5, and therefore Yt is a basic variable parameter which determines all others in the correlation pattern. In alpha-anomers, regardless of the type and conformation of the sugar ring and base, the molar fraction Yt = 0.37 +/- 0.02. This finding means that different alpha-anomers show one correlation pattern free of the influence of the base. In beta-anomers, structure and conformation of the base are important factors which modulate (through Yt) the correlation pattern, conserving its fundamental features. Yt is considerably increased by a syn-oriented pyrimidine base, but decreases when the base is anti. The transition from anti to syn orientation of the base is followed by destabilization of (C2'endo, +sc) in favor of (C3'endo, ap). The principles of conformational correlations rationalize a variety of correlations observed in the past.     

Three-state models of furanose pseudorotation

A general procedure is described to treat the pseudorotation of the furanose ring in terms of a three-state conformational equilibrium. In addition to the principal n (C3'-endo) and s (C2'-endo) puckering domains, the unusual e (01'-endo) intermediate is included in the analysis. Each of these three conformational categories is represented by a blend of five closely related puckered forms rather than by a single rotational isomeric state. Using this model together with experimentally measured nmr coupling constants, the puckering populations of various nucleic acid analogs are estimated. The conventional two-state n/s equilibria is confirmed in ordinary ribose and deoxyribose systems. The e domain, however, is found to be of major importance in several chemically modified furanoses including certain pyrimidine deoxynucleosides damaged by radiation and various nucleosides and nucleotides forced by bulky substituents on the base into unusual syn glycosyl arrangements. The "free" pseudorotation of these modified systems is not detected by conventional two-state puckering analyses.     

Is there sometimes T-T wobble pairing in thymidylyl-3',5'-thymidine?

A fibre-type x-ray diffraction photograph from thymidylyl-3',5'-thymidine is interpreted in terms of a seven-residues per turn, left-handed helical structure in which the first thymine of one molecule is linked to the second thymine of the next molecule by 'wobble' type hydrogen bonds. The first thymidine is in the anti conformation, with a C2'endo - C3'exo sugar and the second is in the syn conformation with a C3'endo - C4'exo sugar. The C5' - 05' bond in the inter-nucleotide linkage is in the g- conformation and that of the P-05' is g+.     

Another method for specifying furanose ring puckering.

A set of pseudorotation coordinates is proposed for characterizing the puckering of the furanose ring. These are defined from the curvilinear displacements of the C1' and C4' atoms from the planar conformation. The present coordinates have some practical advantages over the ones currently used.     

NMR studies of tris-intercalation: solution structure and interaction of d(CTTCGCGCGAAG) with an acridine trimer

Tris-intercalation of an acridine trimer into the self-complementary dodecanucleotide d(CTTCGCGCGAAG) has been studied, in solution, by means of 1H and 31P nuclear magnetic resonance. In a first step all the non-exchangeable protons (except H5', H5"), the imino protons and seven of the eleven phosphorus have been assigned. The dodecanucleotide is shown to adopt a double helical B-type structure. Most of the sugar puckers are in the O1'endo range, those of the internal guanosines being closer to C2'endo. Deviations from the canonical B structure are observed in the base stacking and the phosphodiester torsional angles at the 3T4C5G stretch. The addition of an acridine trimer to the base-paired dodecanucleotide leads to the conclusion that the trimer, which is in slow exchange at the NMR time scale, tris-intercalates into the three C(3'-5')G sites of the central core, according to the excluded site model. This is evidenced by the large (1.4 ppm) upfield shift experienced by the imino protons of the three internal guanines and the shielding undergone by the acridine ring protons. Tris-intercalation is also supported by the downfield shift experienced by 6 out of the 22 phosphorus. Two of them are shifted by nearly 2 ppm, a shift range reported for oligonucleotides complexed to actinomycin D; this suggests that the structure of the backbone of the dodecanucleotide is altered.     

Conformational analysis of chirally deuterated tunicamycin as an active site probe of UDP-N-acetylhexosamine:polyprenol-P N-acetylhexosamine-1-P translocases

Tunicamycins are potent inhibitors of UDP-N-acetyl-D-hexosamine:polyprenol-phosphate N-acetylhexosamine-1-phosphate translocases (D-HexNAc-1-P translocases), a family of enzymes involved in bacterial cell wall synthesis and eukaryotic protein N-glycosylation. Structurally, tunicamycins consist of an 11-carbon dialdose core sugar called tunicamine that is N-linked at C-1' to uracil and O-linked at C-11' to N-acetylglucosamine (GlcNAc). The C-11' O-glycosidic linkage is highly unusual because it forms an alpha/beta anomeric-to-anomeric linkage to the 1-position of the GlcNAc residue. We have assigned the (1)H and (13)C NMR spectra of tunicamycin and have undertaken a conformational analysis from rotating angle nuclear Overhauser effect (ROESY) data. In addition, chirally deuterated tunicamycins produced by fermentation of Streptomyces chartreusis on chemically synthesized, monodeuterated (S-6)-[(2)H(1)]glucose have been used to assign the geminal H-6'a, H-6'b methylene bridge of the 11-carbon dialdose sugar, tunicamine. The tunicamine residue is shown to assume pseudo-D-ribofuranose and (4)C(1) pseudo-D-galactopyranosaminyl ring conformers. Conformation about the C-6' methylene bridge determines the relative orientation of these rings. The model predicts that tunicamycin forms a right-handed cupped structure, with the potential for divalent metal ion coordination at 5'-OH, 8'-OH, and the pseudogalactopyranosyl 7'-O ring oxygen. The formation of tunicamycin complexes with various divalent metal ions was confirmed experimentally by MALDI-TOF mass spectrometry. Our data support the hypothesis that tunicamycin is a structural analogue of the UDP-D-HexNAc substrate and is reversibly coordinated to the divalent metal cofactor in the D-HexNAc-1-P translocase active site.     

Molecular structure of 2,2′-anhydro-1-β-D-arabinofuranosyl cytosine hydrochloride (cyclo ARA-C): A highly rigid nucleoside

The molecular structure of cyclo ara-C hydrochloride has been determined by x-ray diffraction methods. The ether linkage between the base and sugar moieties severely restricts the conformation about the glycosyl bond and the mode of sugar puckering. The glycosyl torsion angle (X_CN =299°) lies in a region outside the $\text{anti}\text{and}\text{syn}$ ranges found for the β-nucleosides. The arabinose ring exhibits C(4′)-endo (⁴E) mode of puckering, with a pseudorotation phase angle P of 233°. The positive charge on the base apparently stabilizes the $\text{gauche}\text{-}\text{gauche}$ conformation of the C(5′)-O(5′) bond despite the short contacts between O(5′) and C(2) and N(1) of the base.     

Nucleic acid model building: the multiple backbone solutions associated with a given base morphology

A constrained model building procedure is used to generate nucleic acid structures of the familiar A-, B-, and Z-DNA duplexes. Attention is focused upon the multiple structural solutions associated with the arrangements of nucleic acid base pairs rather than the optimum sugar-phosphate structure. The glycosyl (chi) and sugar torsions (both the ring puckering and the exocyclic C5'-C4' (psi) torsion) are treated as independent variables and the resulting O3'...O5' distances are used as closure determinants. When such distances conform to the known geometry of phosphate chemical bonding, an intervening phosphorus atom with correct C-O-P valence angles can be located. Four sequential torsion angles--phi', omega', omega and phi--about the C3'-O3'-P-O5'-C5' bonds are then obtained as dependent variables. The resulting structures are categorized in terms of conformation, ranked in potential energy, and analyzed for torsional correlations. The numerical results are quite interesting with implications regarding nucleic acid models constructed to fit less than ideal experimental data. The multiple solutions to the problem are useful for comprehending the conformational complexities of the local sugar-phosphate backbone and for understanding the transitions between different helical forms. According to these studies, unique characterization of a nucleic acid duplex involves more than the determination of its base pair morphology, its sugar puckering preferences, or its groove binding features.     

Sequence specific conformation of a DNA decamer containing an adenine tract studied in solution by H-NMR spectroscopy

The decanucleotide duplex d(AAAACGTTTT)2 and a variety of phase-sensitive two-dimensional (2D) NMR experiments have been used to investigate the solution conformation of an adenine-tract and its junction with another DNA sequence. 2D nuclear Overhauser effect data confirm that the oligonucleotide has a general B-type DNA morphology but an array of unusual correlations implies that the adenine tract and the 5'-ApC junction have conformations more compatible with the modified X-ray structures recently reported for DNAs of similar sequence (Nelson, H.C.M., Finch, J.T., Luisi, B.F. and Klug, A. (1987) Nature 330, 221-226). The pattern and magnitude of interstrand NOEs from the adenine H2s to the sugar H1's of the complementary base to the 5'-neighbouring residue indicate that the A-T basepairs are highly propeller twisted and that the minor groove is narrowed, showing its greatest compression at the 3'-end of the tract at the 5'-ApC step. Quantifying spin-coupling interactions within the deoxyribose rings by analysing both 1D and high-resolution 2D DQF-COSY data reveals that the conformation of the purines is predominantly C2'-endo, with the pseudorotation phase angle P lying in the range 140-180 degrees. For the pyrimidines, however, there are distortions away from this standard B-type geometry with the data being best described by P values lying in the range 90-130 degrees (i.e., O4'-endo, C1'-exo). The sugar puckers of A1, T9 and T10 are dynamically distorted no doubt as a consequence of their positions at, or close to, the ends of the duplex. Thus the conformation of the adenine and thymine sugars within the oligo(dA) and oligo(dT) strands are different with an abrupt change in sugar puckering occurring at the 5'-ApC (5'-GpT) step. Peculiar chemical shifts values for A4H2, T7CH3 and sugar C5 H1', H2' and H2", together with a number of interresidue NOEs with unusual intensities, imply that there are also substantial modifications to basepair stacking interactions at this step. Taken as a whole, our data are consistent with the view that the conformational dislocation at the 5'-ApC dinucleotide results from a combination of slide and roll manoeuvres and that the junction between the AAAA and CG sequences is a potential nucleation site for DNA bending.     

The crystal and molecular structure of 2'-deoxy-2'-fluoroinosine monohydrate.

The structure of the hydrate of 2'-deoxy-2'-fluoroinosine has been determined by single-crystal x-ray diffraction. The nucleoside crystallizes in space group P2(1)2(1)2(1) with unit cell dimensions, a = 33.291, b = 10. 871, c = 6.897A. There are two nucleosides and two water molecules in the asymmetric unit. The structure was solved by direct methods and refined to a residual R = 0.095. The two independent nucleosides in the asymmetric unit show different conformations about the glycosidic bond, while other structural details are similar. The base orientation to the sugar is syn in molecule A, whereas anti in molecule B. The exocyclic C(4')-C(5') bond conformation defined with respect to C(3')-C(4')-C(5')-O(5') is gauche+ in both molecules A and B. The sugar ring pucker defined by the pseudorotation phase angle P is a twisted conformation in both, C(3')-endo-C(4')-exo with P = 29 degrees in molecule A and C(4')-exo-C(3')-endo with P = 41 degrees in molecule B. It is shown by comparison with x-ray results of other 2'-fluoronucleosides and unmodified nucleosides including inosines that, in addition to a strong preference of the C(3')-endo type pucker, twisted conformations involving C(4')-exo puckering may be one of characteristic features of 2'-fluoronucleosides.     

Conformational analysis of the trinucleoside diphosphate 3'd(A2'-5'A2'-5'A). An NMR and CD study.

A 500 MHz and 300 MHz NMR study of the trinucleoside diphosphate 3'd(A2'-5'A2'-5'A) is presented. In addition, circular dichroism is used to study base stacking in the title compound. The complete 1H-NMR spectral assignment of the sugar ring proton signals is given. Information about the sugar ring (N- or S-type conformation) and about the backbone geometry along C4'-C5' and C5'-O5' bonds is obtained from the NMR coupling constants. It is shown that the trimer mainly occurs in the N-N-N stacked state at low temperatures; the presence of a minor amount of N-N-S conformational sequence is indicated.     

Molecular orbital studies on the structure of nucleoside analogs. I. Conformation of 8-azapurine nucleosides

PCILO (perturbative configuration interaction using localized orbitals) computations have been carried out for the conformational properties of 8-azapurine nucleosides. The results indicate an anti conformation for Xcn and a gg conformation for phiC(4')-C(5') for C(2')-endo 8-aza analogs compared to the syn and gg conformation for the corresponding purine nucleosides. For C(3')-endo sugar puckering, both molecules prefer the syn conformation due to intramolecular hydrogen bonding between O(5')-H of the sugar and N(3) of the base, the preference being more profound in 8-aza analogs. The crystallographic conformation 8-azaadenosine has been attributed to crystal forces. The available NMR data on 8-azapurine nucleosides are in agreement with the PCILO predictions.     

Conformational transition of parallel DNA in solutions with decreased water activity]

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.     

Conformationally restricted 2-substituted wyosine derivatives. 1H, 13C, and 15N NMR study

It was found by 1H, 13C and 15N NMR study that substitution of 4,9-dihydro-4,6-dimethyl-9-oxo-3-(2',3',5'-tri-O-acetyl-beta-D-ribofuranosyl) imidazo [1,2-a]purine (wyosine triacetate, 1) at C2 position with electronegative groups CH30 and C6H5CH2O results in a noticeable electron distribution disturbance in the "left-hand" imidazole ring and a significant increase in the North conformer population of the sugar moiety.     

An oligodeoxyribonucleotide N3'--> P5' phosphoramidate duplex forms an A-type helix in solution.

The solution conformations of the dinucleotide d(TT) and the modified duplex d(CGCGAATTCGCG)2 with N3'--> P5' phosphoramidate internucleoside linkages have been studied using circular dichroism (CD) and NMR spectroscopy. The CD spectra indicate that the duplex conformation is similar to that of isosequential phosphodiester RNA, a A-type helix, and is different from that of DNA, a B-type helix, NMR studies of model dimers d(TpT) and N3'--> P5' phosphoramidate d(TnpT) show that the sugar ring conformation changes from predominantly C2'-endo to C3'-endo when the 3'-phosphoester is replaced by a phosphoramidate group. Two-dimensional NMR (NOESY, DQF-COSY and TOCSY spectra) studies of the duplex provide additional details about the A-type duplex conformation of the oligonucleotide phosphoramidate and confirm that all furanose rings of 3'-aminonucleotides adopt predominantly N-type sugar puckering.     

The occurence of the syn-C3' endo conformation and the distorted backbone conformations for C4'-C5' and P-O5' in oligo and polynucleotides.

The nucleoside constituents of nucleic acids prefer the anti conformation (1). When the sugar pucker is taken into account the nucleosides prefer the C2'endo-anti conformation. Of the nearly 300 nucleosides known, about 250 are in the anti conformation and 50 are in the syn-conformation, i.e., anti to syn conformation is 5:1. The nucleotide building blocks of nucleic acids show the same trend as nucleosides. Both the deoxy-guanosine and riboguanosine residues in nucleosides and nucleotides prefer the syn-C2'endo conformation with an intra-molecular hydrogen bond (for nucleosides) between the O5'-H and the N3 of the base and, a few syn-C3'endo conformations are also observed. Evidence is presented for the occurrence of the C3'endo-syn conformation for guanines in mis-paired double helical right-handed structures with the distorted sugar phosphate C4'-C5' and P-O5' bonds respectively, from g+ (gg) and g- to trans. Evidence is also provided for guanosine nucleotides in left-handed double-helical (Z-DNA) oligo and polynucleotides which has the same syn-C3'endo conformation and the distorted backbone sugar-phosphate bonds (C4'-C5' and P-O5') as in the earlier right-handed case.     

Conformational flexibility in DNA structure and its implications in understanding the organization of DNA in chromatin.

X-ray crystallographic studies of drug-nucleic acid crystalline complexes have suggested that DNA first bends or 'kinks' before accepting an intercalative drug or dye. This flexibility in DNA structure is made possible by altering the normal C2' endo deoxyribose sugar puckering in B DNA to a mixed sugar puckering pattern of the type C3' endo (3'-5') C2' endo and partially unstacking base pairs. A kinking scheme such as this would require minimal sterochemical rearrangement and would also involve small energies. This has prompted us to ask more generally if a conformational change such as this could be used by proteins in their interactions with DNA. Here we describe an interesting superhelical DNA structure formed by kinking DNA every ten base pairs. This structure may be used in the organization of DNA within the nucleosome structure in chromatin.     

Solution conformations of the antimetabolite 9-beta-D-xylofuranosyladenine and its 8-bromo analogue

An analysis has been made, with the aid of 1H NMR spectroscopy, of the solution conformation of the known antimetabolite, 9-beta-D-xylofuranosyladenine (xyloA), and of its 8-bromo analogue. For xyloA, the results point to a strong preference for the sugar ring of the conformation type N (C(3') endo), a relatively low population of the gauche-gauche rotamer of the exocyclic 5'-CH2OH, and a preference for the conformation anti about the glycosidic bond. For 8-bromo-xyloA, the preference for the type N conformation of the sugar ring is less marked, and the preferred conformation about the glycosidic bond is syn. The conformation of the sugar ring in the foregoing xylonucleosides consequently differs appreciably from that for the corresponding ribonucleosides, which adopt preferentially the type S (C(2')endo) and gauche-gauche conformations. Comparison with previously reported results for O'-methyl derivatives of xyloA points to the similarity in conformational properties of all of these. In contrast to arabinonucleosides with free 2' and 5' hydroxyls, the conformation of xyloA is relatively unaffected in strongly alkaline medium where the sugar hydroxyl(s) dissociate. Under these conditions, there is no formation of an intramolecular hydrogen bond such as might have been anticipated from X-ray diffraction studies in the solid state.     

Conformational microheterogeneity in a DNA double helix: structure of restriction endonuclease Bam H1 recognition site

Structural studies using 500 MHz 1H NMR spectroscopy on Bam H1 recognition site d(GGATCC)2 in solution at 19 degrees is reported. The resonances from the sugar ring and base protons have been assigned from the 2D-COSY and NOESY spectra. Analyses of the NOESY cross-peaks between the base protons H8/H6 and sugar protons H2'/H2", H3' reveal that the nucleotide units G2, A3 and C6 adopt (C3'-endo, chi = 200 degrees-220 degrees) conformation while G1, T4 and C5 exhibit (C2'-endo, chi = 240 degrees-260 degrees) conformation. NMR data clearly suggest that the two strands of d(GGATCC)2 are conformationally equivalent and there is a structural two-fold between the two A-T pairs. The above information and the NOESY data are used to generate a structural model of d(GGATCC)2. The important features are: (i) G1-G2 stack, the site of cleavage, shows an alternation in sugar pucker i.e. C2'-endo, C3'-endo as in a B-A junction, (ii) G2-A3 stack adopts a mini A-DNA, both the sugars being C3'-endo, (iii) A3-T4 stack, the site of two-fold, displays an A-B junction with alternation in sugar pucker as C3'-endo, C2'-endo, (iv) T4-C5 stack adopts a mini B-DNA both the sugars being C2'-endo and (v) C5-C6 stack exhibits a B-A junction with C2'-endo, C3'-endo sugar puckers. Thus, our studies demonstrate that conformational microheterogeneity with a structural two fold, is present in the Bam H1 recognition site.