The differences in the T2 relaxation rates of the protons in the partially-deuteriated and fully protonated sugar residues in a large oligo-DNA ('NMR-window') gives complementary structural information.

Selective incorporation of the stereospecifically deuteriated sugar moieties (> 97 atom % 2H enhancements at H2', H2', H3' and H5'/5' sites, approximately 85 atom % 2H enhancement at H4' and approximately 20 atom % 2H enhancement at H1') in DNA and RNA by the 'NMR-window' approach has been shown to solve the problem of the resonance overlap [refs. 1, 2 & 3]. Such specific deuterium labelling gives much improved resolution and sensitivity of the residual sugar proton (i.e. H1' or H4') vicinal to the deuteriated centers (ref. 3). The T2 relaxation time of the residual protons also increases considerably in the partially-deuteriated (shown by underline) sugar residues in dinucleotides [d(CpG), d(GpC), d(ApT), d(TpA)], trinucleotide r(A2'p5'A2'p5'A) and 20-mer DNA duplex 5'd(C1G2C3-G4C5G6C7G8A9A10T11T12C13G14C15G16C17G18C19G20)(2) 3'. The protons with shorter T2 can be filtered away using a number of different NMR experiments such as ROESY, MINSY or HAL. The NOE intensity of the cross-peaks in these experiments includes only straight pathway from H1' to aromatic proton (i-i and i-i + 1) without any spin-diffusion. The volumes of these NOE cross-peaks could be measured with high accuracy as their intensity is 3 to 4 times larger than the corresponding peaks in the fully protonated residues in the normal NOESY spectra. The structural informations thus obtainable from the residual protons in the partially-deuteriated part of the duplex and the fully protonated part in the 'NMR window' can indeed complement each other.     

Deuteriation of sugar protons simplify NMR assignments and structure determination of large oligonucleotide by the 1H-NMR window approach.

The concept of the 1H-NMR window has been developed and examined through a comparative study of NOESY spectra of a self-complementary Dickerson's dodecamer (I) [5'd(5C6G7C8G9A10A11T12T13C-14G15C16G)2(3')], a self-complementary 20-mer (II) [(5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core part consists of the same Dickerson's dodecamer sequence with the flanking CGCG residues at both 3' and 5'-ends, and the partly-deuteriated (shown by underlined CGCG residues at both 3' and 5'-ends) analogous duplex (III) [5'd(1C2G3C4G5C6G7C8G9A10A11T12T13C14G15C16G17C18G19C20G)2(3')] in which the core 5C to 16G part (i.e. 1H-NMR window) consists of the natural Dickerson's dodecamer sequence. A comparison of their NOESY spectra clearly demonstrates that the severe overlap of proton resonances in the larger DNA duplex (II) has been successfully reduced in the partly-deuterated duplex (III) as a result of specific incorporations of the sugar-deuteriated nucleotide residues in the latter [stereospecific > 97 atom % 2H enrichment at H2', H2' and H3' sites, approximately 85 atom % 2H enrichment at H4' and approximately 20 atom % 2H enrichment at H1' (see refs. 10 and 11) in the 20-mer duplex (III)]. These simplifications of the resonance overlap by the deuteriation approach have enabled unequivocal chemical shift assignments and extraction of the quantitative NOE data in the 1H-NMR window part of duplex (III). A comparison of the 12-nucleotide long 1H-NMR window in (III) with that of the 12-mer duplex (I) also shows the scope of studying the changes in conformation and dynamics of the core 12-mer region in (III) which result from the increase of molecular weight due to the DNA chain extension. It is noteworthy that such a study is clearly impossible for the natural 20-mer (II) because of the inherent problem of the overlap of resonances.     

Conformational transition of parallel DNA in solutions with decreased water activity]

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

A two-dimensional NMR study of the solution structure of a DNA dodecamer comprising the concensus sequence for the specific DNA-binding sites of the glucocorticoid receptor protein

A two-dimensional 500-MHz 1H-NMR study on the non-self-complementary double-stranded DNA dodecamer 5'd(C-C-A-G-A-A-C-A-G-T-G-G)5'd(C-C-A-C-T-G-T-T-C-T-G-G), is presented. This oligonucleotide contains the consensus octanucleotide sequence 5'd(A-G-A-A-C-A-G-T) for the specific DNA-binding sites of the glucocorticoid receptor protein [Payvar, F. et al. (1984) Cell 35, 381-392]. Using a combination of two-dimensional pure phase absorption nuclear Overhauser enhancement (NOESY) and homonuclear J-correlated (COSY) spectroscopy all non-exchangeable base (with the exception fo the adenine H2 protons), methyl and deoxyribose H1', H2', H2", H3' and H4' resonances are assigned unambiguously using a sequential resonance assignment strategy. From the relative intensities of the cross peaks in the pure phase absorption NOESY spectra at two mixing times it is shown that the dodecamer adopts a B-type conformation in solution.     

Polypurine/polypyrimidine hairpins form a triple helix structure at low pH.

1D and 2D NMR investigations of the 15 residue deoxynucleotide sequence d(TCTCTC-TTT-GAGAGA) show that above pH = 6.5 the molecule adopts a B-form hairpin conformation. As the pH is lowered below 6.5 molecules progressively associate in pairs to form a partially triple helical, partially single stranded structure in which the bases of the oligopyrimidine d(TC)3 tract from one molecule form Hoogsteen pairs with the d(G-A)3 tract of the other. Imino protons of protonated cytosines can be observed at very low field (approximately 15 ppm). The enthalpy of triplex formation was estimated by NMR techniques to be -16 kcal mol-1. Intense H6 to H3' cross peaks from residues in all three strands suggest the presence of N-type sugars at some but not at all possible sites. Surprisingly strong cross peaks between H5' or H5" and non-exchangeable base protons are also observed. These suggest that certain of the O5'-C5'-C4'-C3' phosphate backbone torsion angles (gamma) are unusual.     

Molecular basis for methoxyamine initiated mutagenesis. 1H nuclear magnetic resonance studies of base-modified oligodeoxynucleotides.

In order to reach a more detailed understanding of the mechanism of the mutagenic action of methoxyamine and of N4-methoxycytidine and its 2'-deoxyribo-analogue, the solution structures of the self-complementary octanucleotide, d(CGAATTCG) and its analogues, d(CGAATCCG), d(CGAATMCG) and d(CGAATPCG) (designated 8mer-AT, 8mer-AC, 8mer-AM, and 8mer-AP, respectively), were investigated by 1H nuclear magnetic resonance spectroscopy; M is N4-methoxycytosine (mo4C) and P is an analogue, the bicyclic dihydropyrimido[4,5-c][1,2]oxazin-7-one, in which the N-O bond is held in the anti configuration with respect to N3 of the cytosine ring. Correlated spectroscopy and nuclear Overhauser spectroscopy allowed assignment of the base, anomeric and H2'/H2" protons in 8mers-AT, -AM and -AP, and showed that all three had features consistent with a regular B-DNA duplex structure. Duplex-to-coil transition temperatures were determined to be 52(+/- 2) degrees C (8mer-AT), 51(+/- 2) degrees C (8mer-AP), 32(+/- 2) degrees C (8mer-AM); on the chemical shift timescale, the melting transition was fast for 8mer-AT and 8mer-AP, but slow for 8mer-AM. Imino proton spectra were indicative of Watson-Crick base-pairing in 8mers-AT, -AP and -AM. The 8mer-AP duplex had a structure and melting characteristics virtually identical with those of the 8mer-AT duplex. The preferred syn configuration of the methoxyl group in M had a destabilising effect on the 8mer-AM duplex. At low temperatures, the A.M base-pair was in fast equilibrium between Watson-Crick and wobble configurations, with the methoxyl function anti-oriented, but the melting transition was accompanied by isomerization of the methoxyl group to the syn conformation. This syn-anti isomerization was the rate-determining step in the duplex-to-coil transition. The 8mer-AC oligomer did not form a stable duplex.     

Infrared CD of deoxy oligonucleotides. Conformational studies of 5''d(GCGC)3'', 5''d(CGCG)3'', 5''d(CCGG)3'', and 5''d(GGCC)3'' in low and high salt aqueous solution.

Infrared (vibrational) circular dichroism (VCD) spectra have been obtained for the self-complementary tetranucleotides, 5'd(CGCG)3', 5'd(GCGC)3', 5'd(CCGG)3', and 5'd(GGCC)3'. In buffered aqueous solution at low salt concentration, these tetramers exhibit spectra associated with right-handed polymers, although the spectra differ significantly for the four species. In high salt solution, a B-->Z transition occurs in 5'd(CGCG)3', while the other tetranucleotides appear only slightly altered. Temperature dependent studies of these oligonucleotides reveal a greater amount of thermal stability for the tetramers in low salt than for the high salt solutions. VCD intensities computed via the exciton formalism are compared with observed results.     

Crystal structure of the topoisomerase II poison 9-amino-[N-(2-dimethylamino)ethyl]acridine-4-carboxamide bound to the DNA hexanucleotide d(CGTACG)2.

The structure of the complex formed between d(CGTACG)(2) and the antitumor agent 9-amino-[N-(2-dimethylamino)ethyl]acridine-4-carboxamide has been solved to a resolution of 1.6 A using X-ray crystallography. The complex crystallized in space group P6(4) with unit cell dimensions a = b = 30.2 A and c = 39.7 A, alpha = beta = 90 degrees, gamma = 120 degrees. The asymmetric unit contains a single strand of DNA, 1. 5 drug molecules, and 29 water molecules. The final structure has an overall R factor of 19.3%. A drug molecule intercalates between each of the CpG dinucleotide steps with its side chain lying in the major groove, and the protonated dimethylamino group partially occupies positions close to ( approximately 3.0 A) the N7 and O6 atoms of guanine G2. A water molecule forms bridging hydrogen bonds between the 4-carboxamide NH and the phosphate group of the same guanine. Sugar rings adopt the C2'-endo conformation except for cytosine C1 which moves to C3'-endo, thereby preventing steric collision between its C2' methylene group and the intercalated acridine ring. The intercalation cavity is opened by rotations of the main chain torsion angles alpha and gamma at guanines G2 and G6. Intercalation perturbs helix winding throughout the hexanucleotide compared to B-DNA, steps 1 and 2 being unwound by 8 degrees and 12 degrees, respectively, whereas the central TpA step is overwound by 17 degrees. An additional drug molecule, lying with the 2-fold axis in the plane of the acridine ring, is located at the end of each DNA helix, linking it to the next duplex to form a continuously stacked structure. The protonated N,N-dimethylamino group of this "end-stacked" drug hydrogen bonds to the N7 atom of guanine G6. In both drug molecules, the 4-carboxamide group is internally hydrogen bonded to the protonated N-10 atom of the acridine ring. The structure of the intercalated complex enables a rationalization of the known structure-activity relationships for inhibition of topoisomerase II activity, cytotoxicity, and DNA-binding kinetics for 9-aminoacridine-4-carboxamides.     

The synthesis and properties of oligodeoxyribonucleotides containing N6-methoxyadenine.

Oligodeoxyribonucleotides containing N6-methoxyadenine (M) have been synthesized. The order of stability of duplexes consisting of synthesized oligodeoxyribonucleotides, 5'd(CCTGGTAXCAGGTCC)3'-5'd(GGACCTGNTACCAGG)3' (X = M, A, G. N = A, G, T, C), was M: A (Tm = 52 degrees C) greater than M: T (50 degrees C) greater than M: G (48 degrees C) greater than M: C (46 degrees C) observed by thermal denaturation in a buffer of 0.01 M Na cacodylate, and 0.1 M NaCl at pH 7.0. The Tms are within a range of 6 degrees of difference, which is smaller than those of Tms of the duplexes containing A:N pairs (11 degrees) and G:N pairs (11 degrees). DNA replication study on a template-primer system, 5'd(32p-CAGCTTTCGC)3' 3'd(GTCGAAAGCGMAGTCG)5', showed that TTP and dCTP were incorporated into DNA strands at a site opposite to M by Klenow DNA polymerase, but dATP and dGTP were not.     

Inhibition of Bordetella pertussis and Bacillus anthracis adenylyl cyclases by polyadenylate and "P"-site agonists

Inhibition of adenylyl cyclases from Bacillus anthrasis and Bordetella pertussis by polyadenylate and by the most potent "P"-site agonists was investigated. These bacterial adenylyl cyclases differed in their sensitivity to inhibition by nominal "P"-site agents and in the effect of divalent cations on this inhibition. The enzyme from Bordetella pertussis was relatively insensitive to inhibition by "P"-site agonists, exhibiting a rank order of potency of 2'd3'AMP greater than 3'-AMP greater than 2',5'-ddAdo approximately Ado approximately 2'-dAdo, with IC50 values for 2'd3'AMP and 3'-AMP of 1-3 mM. Inhibition by 2'd3'AMP, however, was not affected by divalent cation, making it distinct from "P"-site-mediated inhibition of most mammalian adenylyl cyclases. The sensitivity to these nucleosides was comparable with potency for inhibition of bovine sperm adenylyl cyclase but was 3 orders of magnitude less potent than for activated enzyme from bovine or rat brain. The Bordetella pertussis enzyme was similarly insensitive to inhibition by polyadenylate, with 16 microM inhibiting less than 20%. By comparison, Bacillus anthrasis adenylyl cyclase was more potently inhibited by 2'd3'AMP (IC50 approximately 85 microM) but not by the other nucleosides (less than 15% inhibition at 1 mM), and inhibition by 2'd3'AMP was optimally enhanced by 5-10 mM Mg2+ or Mn2+, as is typical for inhibition by "P"-site agonists. The Bacillus anthrasis enzyme was potently inhibited by polyadenylate (IC50 approximately 0.3 microM), comparable to inhibition of brain adenylyl cyclases. Sensitivity of Bacillus anthrasis adenylyl cyclase to poly(A) was diminished somewhat by Ca2+/calmodulin (to IC50 approximately 1 microM) although Ca2+/calmodulin was without effect on inhibition by 2'd3'AMP. In contrast to inhibition of mammalian adenylyl cyclases via the "P"-site, inhibition of both bacterial adenylyl cyclases by 2'd3'AMP was competitive with respect to substrate MgATP. The data indicate basic differences in susceptibilities of these bacterial adenylyl cyclases to inhibition by poly(A), by adenosine analogs, and the effects of divalent cations. Although the potency of 2'd3'AMP and the metal-dependent nature of inhibition of Bacillus anthrasis adenylyl cyclase shared characteristics of "P"-site-mediated inhibition, the fact that inhibition of both bacterial adenylyl cyclases was competitive with respect to substrate strongly suggests that this inhibition was at the catalytic site and that these bacterial enzymes do not contain a distinct "P"-site.     

Molecular dynamics simulation of 7, 8-dihydro-8-oxoguanine DNA

To elucidate the effect of guanine lesion produced by the oxidative damage on DNA, 1 nanosecond molecular dynamics simulations of native and oxidized DNA were performed. The target DNA molecules are dodecamer duplex d(CGCGAATTCGCG)(2) and its derivative duplex d(C(1)G(2)C(3)(8-oxoG)(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12).d(C(13)G(14)C(15)G(16)A(17)A(18)T(19)T(20)C(21)G(22)C(23)G(24), which has one oxidized guanine, 7, 8-dihydro-8-oxoguanine (8-oxoG), at the fourth position. The local structural change due to the lesion of 8-oxoG and the global dynamic structure of the 8-oxoG DNA were studied. It was found that the 8-oxoG DNA remained structurally stable during the simulation due to newly produced hydrogen bonds around the (8-oxoG)(4) residue. However, there were distinguishable differences in structural parameters and dynamic property in the 8-oxoG DNA. The conformation around the (8-oxoG)(4) residue departed from the usual conformation of native DNA and took an unique conformation of epsilon-zeta in B(II) conformation and chi in high anti orientation at the (8-oxoG)(4) residue, and adopted a very low helical twist angle at the C(3):G(22)-(8-oxoG)(4):C21) step. Further analysis by principal component analysis indicated that the formation of the hydrogen bonds around the (8-oxoG)(4) residue plays a role as a trigger for the conformational transition of the 8-oxoG DNA in the conformational space.     

Helix-coil transition of parallel-stranded DNA. Thermodynamics of hairpin and linear duplex oligonucleotides

The stabilities have been determined of different DNA double helices constructed with the two constituent strands in a parallel orientation. These molecules incorporate polarity-inverting loop structures (hairpins) or nucleotide sequences (duplexes) which impose the desired polarity on the two strands constituting the sugar-phosphate backbone. The hairpins consisted of d(A.T)n stems (n = 8 or 10) and either a 5'-p-5' linkage in a d(C)4 loop (ps-C8 and ps-C10) or a 3'-p-3' linkage in a d(G)4 loop (ps-G10). The linear duplexes had 21-nt (ps-C2.C3) and 25-nt (ps-D1.D2, ps-D3.D4) mixed A,T sequences and normal chemical linkages throughout. Reference molecules with normal antiparallel helical orientations (hairpins aps-C8, aps-C10, and aps-G10 and duplexes aps-C3.C7, aps-D1.D3, and aps-D2.D4) were also synthesized and studied. Hydrogen bonding in ps-DNA is via reverse Watson-Crick base pairs, and the various constructs display spectroscopic, chemical, biochemical, and electrophoretic properties distinct from those of their aps counterparts. For example, both the ps and aps molecules show a pronounced UV absorption hyperchromicity upon melting, but the spectral distribution is not the same. Thus, the difference spectra (ps-aps) in the native state are characterized by a positive peak at 252 nm, an isosbestic point at 267 nm, and a negative peak at 282 nm. Temperature-dependent absorbances were recorded at selected wavelengths and in the form of complete spectra to derive the thermodynamic parameters for the helix-coil transitions.(ABSTRACT TRUNCATED AT 250 WORDS)     

Two-dimensional NMR investigation of a bent DNA fragment: assignment of the proton resonances and preliminary structure analysis.

The resonances of all the non-exchangeable protons (except 5'H and 5"H) of d(CGAAAAATCGG) + d(CCGATTTTTCG), a putatively bent DNA duplex, have been assigned using 1H two-dimensional nuclear magnetic resonance methods. The nuclear Overhauser effect data indicate an overall B-form structure for this double-helical DNA undecamer. However, several features of the NMR data such as some unusually weak C8/C6 proton to C1' proton NOE cross-peaks, the presence of relatively intense C2H to C1'H NOE cross-peaks, and unusual chemical shifts of some 2", 2', and 1' protons suggest a substantial perturbation of the helix structure at the junctions and along the length of the tract of A residues. These structural deviations are considered in terms of models of DNA bending.     

Ionic strength dependence of the hysteresis in the polyriboadenylate-polyribouridylate system.

The hysteresis observed in cyclic acid-base titrations of the three-standed polyribonucleotide helix poly (A)-2 POLY (U) strongly depends on ionic strength. For NaCl and at 25 degrees C, hysteresis occurs in the limited concentration range between 0.03 M and 1.0 M(NaCl). The transition points associated with the cyclic conversions between the triple helix and the poly (A)-poly (A) double helix and (free) poly (U) constitute a (pH ionic strength) phase diagram covering the ranges of stability and metastability of the hysteresis system. Variations with NaCl concentration of some hysteresis parameters can be quantitatively described in terms of polyelectrolyte theories based on the cylinder-cell model for rodlike polyions. The results of this analysis suggest that the metastability is predominantly due to dlectrostatic energy barriers preventing the equilibrium transition of the partially protonated triple helix above a critical pH value. Ultraviolet absorbance and potentiometric titration data of poly (A)in the acidic pH range can be analyzed in terms of two types of double-helical structures. Spectrophotometric titrations reveal isosbestic wavelengths for structural transitions of poly (A). "Time effects" commonly observed in poly (A) titrations are suggested to reflect helix transitions between the two acidic structures.     

Effects of the O2' hydroxyl group on Z-DNA conformation: structure of Z-RNA and (araC)-[Z-DNA

The left-handed Z structures of two hexamers [d(CG)r(CG)d(CG) and d(CG)(araC)d(GCG)] containing ribose and arabinose residues have been solved by X-ray diffraction analysis at 1.5-A resolution. Their conformations closely resemble that of the canonical Z-DNA. The O2' hydroxyl groups of both rC and araC residues form intramolecular hydrogen bonds with N2 of the 5' guanine residue and replace the bridging water molecules in the deep groove of Z-DNA, which stabilize the guanine in the syn conformation. The araC residue can be incorporated into the Z structure readily and facilitates B to Z transition, as supported by UV absorption spectroscopic studies. In contrast, in Z-RNA the ribose of the cytidine residue is twisted in order to form the respective hydrogen bond. The potential biological roles of the modified Z-DNA containing anticancer nucleoside araC and of Z-RNA are discussed.     

Structural model for an oligonucleotide containing a bulged guanosine by NMR and energy minimization

We present three-dimensional structural models for a DNA oligomer containing a bulged guanosine based on proton NMR data and energy minimization computations. The nonexchangeable proton resonances of the duplex 5'd(GATGGGCAG).d(CTGCGCCATC) are assigned by nuclear Overhauser effect spectroscopy (NOESY) and correlated spectroscopy connectivities, and the NMR spectrum is compared with that of a regular 8-mer of similar sequence, 5'd(GATGGCAG).d(CTGCCATC). Experimental proton-proton distances are obtained from NOESY spectra acquired with mixing times of 100, 150, and 200 ms. A refined three-dimensional structure for the bulge-containing duplex is calculated from regular B DNA starting coordinates by using the AMBER molecular mechanics program [Weiner, S. J., Kollman, P. A., Case, D. A., Singh, U. C., Ghio, C., Alagona, G., Profeta, S., & Weiner, P. (1984) J. Am. Chem. Soc. 106, 765-784]. We compare structures obtained by building the helix in three and four base pair increments with structures obtained by direct minimization of the entire nine base sequence, with and without experimental distance constraints. The general features of all the calculated structures are very similar. The helix is of the B family, with the extra guanine stacked into the helix, and the helix axis is bent by 18-23 degrees, in agreement with gel mobility data for bulge-containing sequences [Rice, J. A. (1987) Ph.D. Thesis, Yale University].     

"Cap" sequences in poly(A)-rich RNA from dry wheat embryos

Although template-active RNA in dry seeds and embryos has attracted widespread interest, there have been no published reports about 5'-terminal "capping" sequences in such RNA. Boro[3H]hydride labeling of periodate-oxidized termini and high performance liquid chromatography of cap oligonucleotides have been used to compare terminal sequences in poly(A)-rich RNA from dry and germinating embryos. As is the case in germinating embryos, poly(A)-rich RNA from dry embryos contains only "type 0" cap sequences, i.e., m7G(5')ppp(5')N, in which m7G is the 7-methylguanosine cap and N is any of the classical ribonucleosides: adenosine (A), guanosine (G), cytidine (C),a nd uridine (U). Striking differences between the cell-free translational capacities of bulk messenger RNA (mRNA) populations from dry and germinating embryos are not reflected in signal differences in their proportions of "type 0" cap structures: in general, there is approximately 40% m7G(5')ppp(5')A, with roughly equivalent amounts of m7G(5')ppp(5')G and m7G(5')ppp(5')C accounting for most of the remaining sequences. The findings with mRNA from dry plant embryos serve to emphasize interesting differences between patterns of methylation in the capped and uncapped RNA molecules in higher plants and animals; the differences have not been previously noted in the literature and are the subject of brief comment in this paper.     

Structural characterization of separated H DNA conformers

Polypyrimidine/polypurine DNA sequences in plasmids can adopt protonated triplex-containing structures (H DNA) in response to negative superhelical stress and low pH. A d(TC)17-d(GA)17 insert adopts two isomeric protonated structures, which differ in degree of helical unwinding. The variant forms of individual topoisomers were separated by agarose gel electrophoresis and their reactivities to permanganate and acid-induced depurination were compared. Depurination patterns of the individual conformers indicate that in the more mobile form (H-y5) the 5'-half of the d(GA)n strand participates in a triplex while in the other (H-y3) the 3'-half forms the triplex. The H-y5 form is more stable than the H-y3 form at low negative superhelix densities. Because of the difference in helical unwinding, the H-y5 form becomes relatively less stable as the superhelix density increases. Topological models of the two forms show that providing there is no linkage at the tips of the triple helical segments one more positive twist is localized in the H-y5 form than in the H-y3 form. The foldback in the pyrimidine strand of the H-y5 form is less accessible to solvent than that of the H-y3 form as assessed by its lower reactivity to permanganate. Consideration of a pyrimidine loop model (Harvey, S. C., Luo, J., & Lavery, R. (1988) Nucleic Acids Res. 16, 11795-11809) suggests that the unique stability of the H-y5 form results from Watson-Crick base pairs between residues of the d(TC)n loop and the d(GA)n strand as it exits the triplex.