3'-azido-3'-deoxythymidine binding to ribonuclease A: model for drug-protein interaction

Ribonuclease A (RNase A) with several high affinity binding sites is a possible target for many organic and inorganic molecules. 3'-Azido-3'-deoxythymidine (AZT) is the first clinically effective drug for the treatment of human immunodeficiency virus (HIV) infection. The drug interactions with protein and nucleic acids are associated with its mechanism of action in vivo. This study was designed to examine the interaction of AZT with RNase A under physiological conditions. Reaction mixtures of constant protein concentration (2%) and different drug contents (0.0001-0.1 mM) are studied by UV-visible, FTIR, and circular dichroism spectroscopic methods in order to determine the drug binding mode, the drug binding constant, and the effects of drug complexation on the protein and AZT conformations in aqueous solution. The spectroscopic results showed one major binding for the AZT-RNase complexes with an overall binding constant of 5.29 x 10(5) M(-1). An increase in the protein alpha helicity was observed upon AZT interaction, whereas drug sugar pucker remained in the C2'-endo/anti conformation in the AZT-RNase complexes.     

Interaction of cisplatin drug with RNase A.

cis-Pt(NH3)2Cl2 (cisplatin) is an antitumor drug with many severe toxic side effects including enzymatic structural changes associated with its mechanism of action. This study is designed to examine the interaction of cisplatin drug with ribonuclease A (RNase A) in aqueous solution at physiological pH, using drug concentration of 0.0001 mM to 0.1 mM with final protein concentration of 2% w/v. Absorption spectra and Fourier transform infrared (FTIR) spectroscopy with its self-deconvolution, second derivative resolution enhancement and curve-fitting procedures were used to characterize the drug binding mode, association constant and the protein secondary structure in the cisplatin-RNase complexes. Spectroscopic results show that at low drug concentration (0.0001 mM), no interaction occurs between cisplatin and RNase, while at higher drug concentrations, cisplatin binds indirectly to the polypeptide C=O, C-N (via H2O or NH3 group) and directly to the S-H donor atom with overall binding constant 5.66 x 10(3)M(-1). At high drug concentration, major protein secondary structural changes occur from that of the alpha-helix 29% (free enzyme) to 20% and beta-sheet 39% (free enzyme) to 45% in the cisplatin-RNase complexes. The observed structural changes indicate a partial protein unfolding in the presence of cisplatin at high drug concentration.     

Interaction of RNase A with VO3- and VO2+ ions. Metal ion binding mode and protein secondary structure

Some of vanadyl complexes have shown potential to inhibit RNase activity by acting as transition state analogue, while at the same time not inhibiting DNase. To gain an insight into the interaction of protein with vanadate (VO3-) and vanadyl (VO2+) ions, the present study was designed to examine the binding of ribonuclase A (RNase A) with NaVO3 and VOSO4 in aqueous solution at physiological pH with metal ion concentrations of 0.001 mM to 1 mM, and protein concentration of 2% w/v. Absorption spectra and Fourier transform infrared (FTIR) spectroscopy with self-deconvolution and second derivative resolution enhancement were used to determine the cation binding mode, association constant and the protein secondary structure in the presence of vanadate and vanadyl ions in aqueous solution. Spectroscopic results show that an indirect metal ion interaction occurs with the polypeptide C = O, C-N (via H2O) with overall binding constants of K(VO3-) = 3.93x10(2) M(-1) and K(VO2+) = 4.20x10(3) M(-1). At high metal ion concentrations, major protein secondary structural changes occur from that of the alpha-helix 29% (free enzyme) to 23-24%; beta-sheet (pleated and anti) 50% (free enzyme) to 64-66% and turn 21% (free enzyme) to 10-12% in the metal-RNase complexes. The observed structural changes indicate a partial protein unfolding in the presence of high metal ion concentration.     

The effects of anions on the solution structure of Na,K-ATPase

Anions interact with protein to induce structural changes at ligand binding sites. The effects of anion complexation include structural stabilization and promote cation-protein interaction. This study was designed to examine the interaction of aspirin and ascorbate anions with the Na+, K+-dependent adenosine triphosphatase (Na,K-ATPase) in H2O and D2O solutions at physiological pH, using anion concentrations of 0.1 microM to 1 mM with final protein concentration of 0.5 to 1 mg/ml. Absorption spectra and Fourier transform infrared (FTIR) difference spectroscopy with its self-deconvolution, second derivative resolution enhancement and curve-fitting procedures were applied to characterize the anion binding mode, binding constant, and the protein secondary structure in the anion-ATPase complexes. Spectroscopic evidence showed that the anion interaction is mainly through the polypeptide C=O and C-N groups with minor perturbation of the lipid moiety. Evidence for this came from major spectral changes (intensity variations) of the protein amide I and amide II vibrations at 1651 and 1550 cm(-1). respectively. The anion-ATPase binding constants were K=6.45 x 10(3) M(-1) for aspirin and K=1.04 x 10(4) M(-1) for ascorbate complexes. The anion interaction resulted in major protein secondary structural changes from that of the alpha-helix 19.8%; beta-pleated sheet 25.6%; turn 9.1%; beta-antiparallel 7.5% and random 38% in the free Na,K-ATPase to that of the alpha-helix 24-26%; beta-pleated 17-18%; turn 8%; beta-antiparallel 5-3% and random 45.0% in the anion-ATPase complexes.     

The effects of drug complexation on the stability and conformation of human serum albumin

We report different analytical methods used to study the effects of 3\'-azido-3\'-deoxythymidine, aspirin, taxol, cisplatin, atrazine, 2,4-dichlorophenoxyacetic, biogenic polyamines, chlorophyll, chlorophyllin, poly(ethylene glycol), vanadyl cation, vanadate anion, cobalt-hexamine cation, and As2O3, on the stability and secondary structure of human serum albumin (HSA) in aqueous solution, using capillary electrophoresis, Fourier transform infrared, ultraviolet visible, and circular dichroism (CD) spectroscopic methods. The concentrations of HSA used were 4% to 2% or 0.6 to 0.3 mM, while different ligand concentrations were 1 microM to 1 mM. Structural data showed drugs are mostly located along the polypeptide chains with both specific and nonspecific interactions. The stability of drug-protein complexes were in the order K(VO(2+)) 1.2 x 10(8) M(-1) > K(AZT) 1.9 x 10(6) M(-)1 > K(PEG) 4.1 x 10(5) M(-1) > K(atrazine) 3.5 x 10(4) M(-1) > K(chlorophyll) 2.9 x 10(4) M(-1) > K2,4-D 2.5 x 10(4) M-1 > K(spermine) 1.7 x 10(4) M(-1) > K(taxol) 1.43 x 10(4) M(-1) > K(Co(3+)) > 1.1 x 10(4) M(-1) > K(aspirin) 1.04 x 10(4)i(-1) > K(chlorophyllin) 7.0 x 10(3) M(-1) > K(VO(3)(-)) 6.0 x 103 M(-1) > K(spermidine) 5.4 x 10(3) M(-1) > K(putrescine) 3.9 x 10(3) M(-1) > K(As(2)O(3)) 2.2 x 10(3) M(-1)> K(cisplatin) 1.2 x 10(2) M(-1). The protein conformation was altered (infrared and CD results) with major reduction of alpha-helix from 60 to 55% (free HSA) to 49 to 40% and increase of beta-structure from 22 to 15% (free HSA) to 33 to 23% in the drug-protein complexes. The alterations of protein secondary structure are attributed to a partial unfolding of HSA on drug complexation.     

RNase A - tRNA binding alters protein conformation.

Bovine pancreatic ribonuclease A (RNase A) catalyzes the cleavage of P-O5' bonds in RNA on the 3' side of pyrimidine to form cyclic 2',5'-phosphates. Even though extensive structural information is available on RNase A complexes with mononucleotides and oligonucleotides, the interaction of RNase A with tRNA has not been fully investigated. We report the complexation of tRNA with RNase A in aqueous solution under physiological conditions, using a constant RNA concentration and various amounts of RNase A. Fourier transform infrared, UV-visible, and circular dichroism spectroscopic methods were used to determine the RNase binding mode, binding constant, sequence preference, and biopolymer secondary structural changes in the RNase-tRNA complexes. Spectroscopic results showed 2 major binding sites for RNase A on tRNA, with an overall binding constant of K = 4.0 x 105 (mol/L)-1. The 2 binding sites were located at the G-C base pairs and the backbone PO2 group. Protein-RNA interaction alters RNase secondary structure, with a major reduction in alpha helix and beta sheets and an increase in the turn and random coil structures, while tRNA remains in the A conformation upon protein interaction. No tRNA digestion was observed upon RNase A complexation.     

DNA interaction with antitumor polyamine analogues: a comparison with biogenic polyamines

Biogenic polyamines, putrescine, spermidine, and spermine, are ubiquitous cellular cations and exert multiple biological functions. Polyamine analogues mimic biogenic polyamines at macromolecular level but are unable to substitute for natural polyamines and maintain cell proliferation, indicating biomedical applications. The mechanistic differences in DNA binding mode between natural and synthetic polyamines have not been explored. The aim of this study was to examine the interaction of calf thymus DNA with three polyamine analogues, 1,11-diamino-4,8-diazaundecane (333), 3,7,11,15-tetrazaheptadecane x 4 HCl (BE-333), and 3,7,11,15,19-pentazahenicosane x 5 HCl (BE-3333), using FTIR, UV-visible, and CD spectroscopy. Polyamine analogues bind with guanine and backbone PO2 group as major targets in DNA, whereas biogenic polyamines bind to major and minor grooves as well as to phosphate groups. Weaker interaction with DNA was observed for analogues with respect to biogenic polyamines, with K(333) = 1.90 (+/-0.5) x 10(4) M(-1), K(BE-333) = 6.4 (+/-1.7) x 10(4) M(-1), K(BE-3333) = 4.7 (+/-1.4) x 10(4) M(-1) compared to K(Spm) = 2.3 (+/-1.1) x 10(5) M(-1), K(Spd) = 1.4 (+/-0.6) x 10(5) M(-1), and K(Put) = 1.02 (+/-0.5) x 10(5) M(-1). A partial B- to A-DNA transition was also provoked by analogues. These data suggest distinct differences in the binding of natural and synthetic polyamines with DNA.     

Functional characterization of the dimerization domain of the ferric uptake regulator (Fur) of Pseudomonas aeruginosa

The functional properties of the recombinant C-terminal dimerization domain of the Pseudomonas aeruginosa Fur (ferric uptake regulator) protein expressed in and purified from Escherichia coli have been evaluated. Sedimentation velocity measurements demonstrate that this domain is dimeric, and the UV CD spectrum is consistent with a secondary structure similar to that observed for the corresponding region of the crystallographically characterized wild-type protein. The thermal stability of the domain as determined by CD spectroscopy decreases significantly as pH is increased and increases significantly as metal ions are added. Potentiometric titrations (pH 6.5) establish that the domain possesses a high-affinity and a low-affinity binding site for metal ions. The high-affinity (sensory) binding site demonstrates association constants (K(A)) of 10(+/-7)x10(6), 5.7(+/-3)x10(6), 2.0(+/-2)x10(6) and 2.0(+/-3)x10(4) M(-1) for Ni2+, Zn2+, Co2+ and Mn2+ respectively, while the low-affinity (structural) site exhibits association constants of 1.3(+/-2)x10(6), 3.2(+/-2)x10(4), 1.76(+/-1)x10(5) and 1.5(+/-2)x10(3) M(-1) respectively for the same metal ions (pH 6.5, 300 mM NaCl, 25 degrees C). The stability of metal ion binding to the sensory site follows the Irving-Williams order, while metal ion binding to the partial sensory site present in the domain does not. Fluorescence experiments indicate that the quenching resulting from binding of Co2+ is reversed by subsequent titration with Zn2+. We conclude that the domain is a reasonable model for many properties of the full-length protein and is amenable to some analyses that the limited solubility of the full-length protein prevents.     

Arc repressor is tetrameric when bound to operator DNA

The Arc repressor of bacteriophage P22 is a member of a family of DNA-binding proteins that use N-terminal residues in a beta-sheet conformation for operator recognition. Here, Arc is shown to bind to its operator site as a tetramer. When mixtures of Arc (53 residues) and an active variant of Arc (78 residues) are used in gel retardation experiments, five discrete protein-DNA complexes are observed. This result is as expected for operators bearing heterotetramers containing 4:0, 3:1, 2:2, 1:3, and 0:4 ratios of the two proteins. Direct measurements of binding stoichiometry support the conclusion that Arc binds to a single 21-base-pair operator site as a tetramer. The Arc-operator binding reaction is highly cooperative (Hill constant = 3.5) and involves at least two coupled equilibria. In the first reaction, two unfolded monomers interact to form a folded dimer (Bowie & Sauer, 1989a). Rapid dilution experiments indicate that the Arc dimer is the kinetically significant DNA-binding species and allow an estimate of the equilibrium dissociation constant for dimerization [K1 = 5 (+/- 3) x 10(-9) M]. The rate of association of Arc-operator complexes shows the expected second-order dependence on the concentration of free Arc dimers, with k2 = 2.8 (+/- 0.7) x 10(18) M-2 s-1. The dissociation of Arc-operator complexes is a first-order process with k-2 = 1.6 (+/- 0.6) x 10(-4) s-1. The ratio of these kinetic constants [K2 = 5.7 (+/- 2.3) x 10(-23) M2] provides an estimate for the equilibrium constant for dissociation of the DNA-bound tetramer to two free Arc dimers and the operator. An independent determination of this complex equilibrium constant [K2 = 7.8 (+/- 4.8) x 10(-23) M2] was obtained from equilibrium binding experiments.     

Spectroscopic determination of the binding affinity of zinc to the DNA-binding domains of nuclear hormone receptors

Zinc binding to the two Cys(4) sites present in the DNA-binding domain (DBD) of nuclear hormone receptor proteins is required for proper folding of the domain and for protein activity. By utilizing Co(2+) as a spectroscopic probe, we have characterized the metal-binding properties of the two Cys(4) structural zinc-binding sites found in the DBD of human estrogen receptor alpha (hERalpha-DBD) and rat glucocorticoid receptor (GR-DBD). The binding affinity of Co(2+) to the two proteins was determined relative to the binding affinity of Co(2+) to the zinc finger consensus peptide, CP-1. Using the known dissociation constant of Co(2+) from CP-1, the dissociation constants of cobalt from hERalpha-DBD were calculated: K(d1)(Co) = 2.2 (+/- 1.0) x 10(-7) M and K(d2)(Co) = 6.1 (+/- 1.5) x 10(-7) M. Similarly, the dissociation constants of Co(2+) from GR-DBD were calculated: K(d1)(Co) = 4.1 (+/- 0.6) x 10(-7) M and K(d2)(Co) = 1.7 (+/- 0.3) x 10(-7) M. Metal-binding studies conducted in which Zn(2+) displaces Co(2+) from the metal-binding sites of hERalpha-DBD and GR-DBD indicate that Zn(2+) binds to each of the Cys(4) metal-binding sites approximately 3 orders of magnitude more tightly than Co(2+) does: the stoichiometric dissociation constants are K(d1)(Zn) = 1 (+/- 1) x 10(-10) M and K(d2)(Zn) = 5 (+/- 1) x 10(-10) M for hERalpha-DBD and K(d1)(Zn) = 2 (+/- 1) x 10(-10) M and K(d2)(Zn) = 3 (+/- 1) x 10(-10) M for GR-DBD. These affinities are comparable to those observed for most other naturally occurring structural zinc-binding sites. In contrast to the recent prediction by Low et. al. that zinc binding in these systems should be cooperative [Low, L. Y., Hernández, H., Robinson, C. V., O'Brien, R., Grossmann, J. G., Ladbury, J. E., and Luisi, B. (2002) J. Mol. Biol. 319, 87-106], these data suggest that the zincs that bind to the two sites in the DBDs of hERalpha-DBD and GR-DBD do not interact.     

Specificity and affinity of substrate binding by a family 17 carbohydrate-binding module from Clostridium cellulovorans cellulase 5A

The C-terminal carbohydrate-binding module (CBM17) from Clostridium cellulovorans cellulase 5A is a beta-1,4-glucan binding module with a preference for soluble chains. CBM17 binds to phosphoric acid swollen Avicel (PASA) and Avicel with association constants of 2.9 (+/-0.2) x 10(5) and 1.6 (+/-0.2) x 10(5) M(-1), respectively. The capacity values for PASA and Avicel were 11.9 and 0.4 micromol/g of cellulose, respectively. CBM17 did not bind to crystalline cellulose. CBM17 bound tightly to soluble barley beta-glucan and the derivatized celluloses HEC, EHEC, and CMC. The association constants for binding to barley beta-glucan, HEC, and EHEC were approximately 2.0 x 10(5) M(-1). Significant binding affinities were found for cello-oligosaccharides greater than three glucose units in length. The affinities for cellotriose, cellotetraose, cellopentaose, and cellohexaose were 1.2 (+/-0.3) x 10(3), 4.3 (+/-0.4) x 10(3), 3.8 (+/-0.1) x 10(4), and 1.5 (+/-0.0) x 10(5) M(-1), respectively. Fluorescence quenching studies and N-bromosuccinimide modification indicate the participation of tryptophan residues in ligand binding. The possible architecture of the ligand-binding site is discussed in terms of its binding specificity, affinity, and the participation of tryptophan residues.     

Interaction of cisplatin drug with Na,K-ATPase: drug binding mode and protein secondary structure

cis-Pt(NH(3))(2)Cl(2) (cisplatin) is an antitumor drug with many severe toxic side effects including enzymatic changes associated with its mechanism of action. This study was designed to examine the interaction of cisplatin drug with the Na(+), K(+)-dependent adenosine triphosphatase (Na,K-ATPase) in H(2)O and D(2)O solutions at physiological pH, using drug concentrations of 0.1 microM to 1 mM. UV absorption spectra and Fourier transform infrared difference spectroscopy with its self-deconvolution, second derivative resolution enhancement and curve-fitting procedures were applied to characterize the drug binding mode, the drug binding constant and the protein secondary structure in the cisplatin-ATPase complexes. Spectroscopic evidence showed that at low drug concentration (0.1 microM), cisplatin binds mainly to the lipid portion of the enzyme, whereas at higher drug contents, the Pt cation interaction is through the polypeptide C==O and C-N groups with overall binding constant of K=1.93 x 10(4) M(-1). At high cisplatin concentration (1 mM), drug binding results in protein secondary structural changes from that of the alpha-helix 19.8%; beta-pleated 25.6%; turn 9.1%; beta-antiparallel 7.5% and random 38%, in the free Na,K-ATPase to that of the alpha-helix 22.2%; beta-pleated 23.2%; turn 9.4%; beta-antiparallel 2.2% and random 43%, in the cis-Pt-ATPase complexes.     

Effects of monomethoxypoly(ethylene glycol) modification of ribonuclease on antibody recognition, substrate accessibility and conformational stability

The effects of modification of bovine pancreatic ribonuclease A by monomethoxypoly(ethylene glycol) (MPEG) were examined for changes in recognition by antiRNase antibodies, enzymatic activity against low and high molecular weight substrates and conformational stability to temperature elevation. Modified forms of RNase were prepared containing an average of 4, 9, and 11 mol of MPEG/mol protein, by amino group modification. These were analysed by binding to RNase antibodies crosslinked to solid phase-immobilized protein A. The affinity column was incorporated into a high performance liquid chromatograph and the RNase species were studied by both zonal and frontal analytical affinity chromatography. An antibody dissociation constant of 7.6 x 10(-8) M was found for unmodified RNase, as compared to values of 1.3 x 10(-7) and 1.2 x 10(-6) M for RNase with 4 and 9 covalently bound MPEG chains, respectively. Modification also led to progressive loss of enzymatic activity against RNA, down to 3% for the most highly modified enzyme. In contrast, enzymatic activity against cytidine-2',3'-cyclic monophosphate was suppressed to a maximum of only 33% at the highest modification level, and the stability to temperature, as followed by circular dichroism, was reduced only partially, from 67 degrees C for native protein to 57 degrees C for RNase with 11 mol equivalents MPEG incorporated. The above differential effects on enzymatic activity, antibody binding and temperature effects are consistent with the view that MPEG modification has relatively small effects on conformational stability and small molecule accessibility, but more dramatic effects on large molecule (substrate as well as antibody) accessibility.(ABSTRACT TRUNCATED AT 250 WORDS)     

Cleavage of DNA by electrochemically activated MnIII and FeIII complexes of meso-tetrakis (N-methyl-4-pyridiniumyl)porphine

Electrochemical methods were used to activate MnIII and FeIII complexes of meso-tetrakis(N-methyl-4-pyridiniumyl)porphine (H2TMPyP) to cause cleavage of pBR322 DNA and to study their interaction with sonicated calf thymus DNA. Electrochemical reduction of MnIIITMPyP and FeIIITMPyP (at low concentrations) in the presence of O2 was required to activate these complexes. However, FeIIITMPyP at 1 x 10(-6) M produced DNA strand breakage without being electrochemically reduced. At low concentrations, FeIITMPyP was more efficient at cleaving DNA than MnIITMPyP. Reduction of O2 at a platinum electrode also produced some cleavage but to a much smaller extent. The oxidized form of MnIIITMPyP (charge 5+) has higher affinity for sonicated calf thymus (CT) DNA than the reduced form (charge 4+), as determined by the negative shift in E degrees' for the voltammetric wave in the presence of DNA. Both forms of FeIIITMPyP (charge 4+) interact with DNA to about the same extent. Differential pulse voltammetry was used to determine binding constants (K) and binding-site sizes (s) of the interaction of these metalloporphyrins with sonicated CT DNA. The data were analyzed assuming both mobile and static equilibria. MnIIITMPyP binds to DNA (5 mM Tris, 50 mM NaCl, pH 7) with K = 5 (+/- 2) x 10(6) M-1, s = 3 bp (mobile) or K = 3.6 (+/- 0.3) x 10(6) M-1, s = 4 bp (static). FeIIITMPyP at that ionic strength caused DNA precipitation. At higher ionic strength (0.1 M Tris, 0.1 M NaCl, pH 7), FeIIITMPyP associates to DNA with K = 4.4 (+/- 0.2) x 10(4) M-1, s = 5 bp (mobile) or K = 1.9 (+/- 0.1) x 10(4) M-1, s = 6 bp (static).     

Determination of the dissociation constants for recombinant c-Myc, Max, and DNA complexes: the inhibitory effect of linoleic acid on the DNA-binding step

c-Myc, the protein product of protooncogene c-myc, functions in cell proliferation, differentiation, and neoplastic disease. In this study, recombinant c-Myc and Max proteins, encompassing DNA binding (basic region) and dimerization (helix-loop-helix/leucine zipper) domain of human origin, were expressed in bacteria as Myc87 and Max85. Myc87 was purified under denatured conditions and was renatured again. The dissociation constant for the protein dimers and for dimer/DNA complexes were not detectable by isothermal titration calorimetry because of the low degree of solubility of Myc87 and Max85. Therefore, we set up equations which were used to determine the dissociation constants from the proportion of protein-DNA complexes. The dimer dissociation constants in TBS were 5.90(+/-0.54)x10(-7)M for Max85/Max85 homodimer, 6.85(+/-0.25)x10(-3)M for Myc87/Myc87 homodimer, and 2.55(+/-0.29)x10(-8)M for Myc87/Max85 heterodimer, and the DNA-binding dissociation constants in TBS were 1.33(+/-0.21)x10(-9)M for Max85/Max85/DNA, 2.27(+/-0.08)x10(-12)M for Myc87/Myc87/DNA, and 4.43(+/-0.37)x10(-10)M for Myc87/Max85/DNA. In addition, we revealed that linoleic acid which is known as an inhibitor for the formation of Max/Max/DNA complex reduced the affinity of Max homodimer for DNA. This result indicates that linoleic acid may bind to the DNA-binding region of Max homodimer.     

Interaction of tRNA with Safranal, Crocetin, and Dimethylcrocetin

Saffron is the red dried stigmas of Crocus sativus L. flowers and used both as a spice and as a drug in traditional therapeutic. The biological activity of saffron in modern medicine is in development. Its numerous applications as an anti-oxidant and anti-cancer agent are due to its secondary metabolites and their derivatives (safranal, crocins, crocetin, dimethylcrocetin). The aim of this study was to examine the interaction of transfer RNA with safranal, crocetin, and dimethylcrocetin in aqueous solution at physiological conditions. Constant tRNA concentration (6.25 mM) and various drug/tRNA (phosphate) molar ratios of 1/48 to 1/8 were used. FT-IR and UV-Visible difference spectroscopic methods have been applied to determine the drug binding mode, the binding constants and the effects of drug complexation on the stability and conformation of tRNA duplex. External binding mode was observed for safranal crocetin and dimethylcrocetin, with overall binding constants K(safranal) = 6.8 (+/- 0.34) x 10(3) M(-1), K(CRT) = 1.4 (+/- 0.31) x 10(4) M(-1), and K(DMCRT) = 3.4 (+/- 0.30) x 10(4) M(-1). Transfer RNA remains in the A-family structure, upon safranal, crocetin and dimethylcrocetin complexation.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Independent binding sites in mouse 5.8S ribosomal ribonucleic acid for 28S ribosomal ribonucleic acid

Limited digestion of mouse 5.8S ribosomal RNA (rRNA) with RNase T2 generates 5'- and 3'-terminal "half-molecules". These fragments are capable of independently and specifically binding to 28S rRNA, so there exist at least two contacts in the 5.8S rRNA for the 28S rRNA. The dissociation constants for the 5.8S/28S, 5' 5.8S fragment/28S, and 3' 5.8S fragment/28S complexes are 9 x 10(-8) M, 6 x 10(-8) M, and 13 x 10(-8) M, respectively. Thus, each of the fragment binding sites contributes about equally to the overall binding energy of the 5.8S/28S rRNA complex, and the binding sites act independently, rather than cooperatively. The dissociation constants suggest that the 5.8S rRNA termini from short, irregular helices with 28S rRNA. Thermal denaturation data on complexes containing 28S rRNA and each of the half-molecules of 5.8S rRNA indicate that the 5'-terminal binding site(s) exist(s) in a single conformation while the 3'-terminal site exhibits two conformational alternatives. The functional significance of the different conformational states is presently indeterminate, but the possibility they may represent alternative forms of a conformational switch operative during ribosome function is discussed.