The glycoprotein products of varicella-zoster virus gene 14 and their defective accumulation in a vaccine strain (Oka).

Many characteristics of the putative protein encoded by varicella-zoster virus (VZV) open reading fram (ORF) 14 indicate that it is a glycoprotein, which has been designated gpV. To identify the protein products of the gene, the coding sequences were placed under the control of the vaccinia virus p7.5 promoter and recombinant vaccinia viruses were constructed. Heterogeneous polypeptides with molecular weights of 95,000 to 105,000 (95K to 105K polypeptides) were expressed in cells infected by a vaccinia virus recombinant (vKIP5) containing ORF 14 from VZV Scott but were not expressed by control vaccinia viruses. These polypeptides were recognized by antibodies present in human sera that contained high levels of anti-VZV antibodies. Conversely, antisera raised in rabbits inoculated with vKIP5 reacted specifically with heterogeneous 95K to 105K polypeptides present in VZV Scott-infected but not uninfected cells; these polypeptides show a patchy plasma membrane fluorescence pattern in VZV Scott-infected cells. These same antisera neutralized VZV strain Scott infectivity in the absence of complement. Endoglycosidase F treatment of isolated gpV polypeptides and tunicamycin treatment of cells infected with the vKIP5 recombinant indicated that the polypeptides were glycosylated. Three sets of data imply that the VZV strain Oka, which has been used to produce a live attenuated virus vaccine, accumulates low levels of gpV polypeptides relative to wild-type strains: (i) blocking of antibodies in human sera with excess VZV Oka-infected cell antigen yielded residual antibodies which were reactive with the 95K to 105K gpV polypeptides expressed in cells infected by VZV strain Scott and by the vKIP5 vaccinia virus recombinant, but not with Oka-infected cell polypeptides; (ii) antisera raised to vKIP5 detected very low levels of reactive polypeptides made in VZV Oka-infected cells and neutralized VZV Oka virus much less efficiently than VZV Scott; and (iii) comparisons of the reactivity of sera from live attenuated virus vaccine vaccinees with sera derived from patients recovering from wild-type infections indicated greatly reduced levels of gpV-specific antibodies in some vaccinees.     

Tropism of varicella-zoster virus for human CD4+ and CD8+ T lymphocytes and epidermal cells in SCID-hu mice.

To investigate the cell tropism and pathogenicity of varicella-zoster virus (VZV) strains, we analyzed VZV replication by using SCID-hu mice that carry human fetal thymus/liver implants under the kidney capsule or as subcutaneous fetal skin implants. MRC-5 cells infected with wild-type VZV or the Oka strain, used in the live attenuated varicella vaccine, were injected into the implants. The implants were surgically removed 2, 7, 14, and 21 days postinfection. The VZV titer from infected thymus/liver implants peaked on day 7 for the wild-type strain and on day 14 for the Oka strain. Histological analysis showed necrotic areas characterized by thymocyte depletion and fibrosis. VZV protein synthesis was detectable by immunohistochemical staining in the necrotic areas and in distant regions that did not show cytopathic changes, and VZV DNA was detected by in situ hybridization in the same distribution. Fluorescence-activated cell sorting analysis of thymocytes harvested at day 7 postinfection showed that VZV proteins were expressed in CD4+, CD8+, and CD4+ CD8+ T cells; VZV was cultured from each T-cell subpopulation. The Oka strain had tropism for human cell types similar to that of wild-type VZV. T lymphocytes released infectious VZV, which is a novel and important observation about the replication of this otherwise highly cell associated virus. VZV-infected skin implants exhibited microscopic epidermal lesions that were indistinguishable histologically from the characteristic lesions of varicella. These experiments demonstrate a unique tropism of VZV for human T lymphocytes, explaining its capacity to cause viremia in natural disease, and demonstrate the value of the SCID-hu model for studies of VZV pathogenesis.     

Open reading frame S/L of varicella-zoster virus encodes a cytoplasmic protein expressed in infected cells

We report the discovery of a novel gene in the varicella-zoster virus (VZV) genome, designated open reading frame (ORF) S/L. This gene, located at the left end of the prototype VZV genome isomer, expresses a polyadenylated mRNA containing a splice within the 3' untranslated region in virus-infected cells. Sequence analysis reveals significant differences between the ORF S/Ls of wild-type and attenuated strains of VZV. Antisera raised to a bacterially expressed portion of ORF S/L reacted specifically with a 21-kDa protein synthesized in cells infected with a VZV clinical isolate and with the original vaccine strain of VZV (Oka-ATCC). Cells infected with other VZV strains, including a wild-type strain that has been extensively passaged in tissue culture and commercially produced vaccine strains of Oka, synthesize a family of proteins ranging in size from 21 to 30 kDa that react with the anti-ORF S/L antiserum. MeWO cells infected with recombinant VZV harboring mutations in the C-terminal region of the ORF S/L gene lost adherence to the stratum and adjacent cells, resulting in an altered plaque morphology. Immunohistochemical analysis of VZV-infected cells demonstrated that ORF S/L protein localizes to the cytoplasm. ORF S/L protein was present in skin lesions of individuals with primary or reactivated infection and in the neurons of a dorsal root ganglion during virus reactivation.     

Development and characterization of a live varicella vaccine (Oka strain)

A live varicella vaccine (Oka strain) was developed by serial passage of the Oka strain isolated in our laboratory, in human embryonic lung cells (11 times at 34 C) and guinea pig embryo cells (12 times at 37 C). It is slightly temperature sensitive at 39 C and shows a higher ratio of infectivity in guinea pig embryo cells to infectivity in human embryo cells than wild-type strains. The DNA digest with Hpa I enzyme of the Oka strain contained one unique fragment (K), although its mobility differed only slightly from that of the corresponding fragment of wild-type strains. Studies with clinical varicella zoster virus (VZV) isolates from vaccinees indicated that tests on the ratio of infectivity in guinea pig embryo fibroblasts (GPEF) to that in human embryo fibroblasts (HuEF) and the profile of the DNA digest with Hpa I are useful for differentiation of the vaccine strain from wild-type strains. The vaccine virus showed stable immunogenicity during at least 15 further repeated passages in human diploid cells, a character which seems helpful for production of a large quantity of vaccine virus for practical use.     

Successful infection of the common marmoset (Callithrix jacchus) with human varicella-zoster virus.

The common marmoset, Callithrix jacchus, can be infected with human varicella-zoster virus (VZV), both wild-type strain KMcC and attenuated vaccine strain Oka/Merck. Infection was accomplished with either whole-cell-associated or cell extract VZV by combined oral-nasal-conjunctival application and was characterized by substantial and persistent anti-VZV antibody responses. The infectivity of VZV for marmosets was destroyed by treatment of inocula with heat or UV light. Diluted inocula with as few as 40 PFU/ml were infectious for marmosets. The lungs were demonstrated to be a major site of viral replication; both the presence of viral antigens and signs of pneumonia were demonstrated in lung tissues. Four serial passages of VZV KMcC were carried out in C. jacchus by a process of in vitro isolation and culturing of VZV from infected lung tissue and reapplication of the cultured isolates to fresh animals. The isolated viruses were identified as VZV both serologically and by restriction endonuclease analyses. The C. jacchus infectivity model should prove useful for determining the efficacy of subunit and live recombinant VZV vaccines as well as for the study of zoster.     

Varicella vaccination: evidence for frequent reactivation of the vaccine strain in healthy children

Wild-type varicella zoster virus (VZV) causes chickenpox, a common childhood illness characterized by fever and a vesicular rash and rare serious complications. Wild-type VZV persists in a latent form in the sensory ganglia, and can re-activate to cause herpes zoster. More than 10 million American children have received the live attenuated Oka strain VZV vaccine (OkaVZV) since its licensure in 1995. Pre-licensure clinical studies showed that mean serum anti-VZV levels among vaccinees continued to increase with time after vaccination. This was attributed to immunologic boosting caused by exposure to wild-type VZV in the community. Here, we examine the alternative, that large-scale asymptomatic reactivation of OkaVZV might occur in vaccinees. We analyzed serum antibody levels and infection rates for 4 years of follow-up in 4,631 children immunized with OkaVZV. Anti-VZV titers decreased over time in high-responder subjects, but rose in vaccinees with low titers. Among subjects with low anti-VZV titers, the frequency of clinical infection and immunological boosting substantially exceeded the 13%-per-year rate of exposure to wild-type varicella. These findings indicate that OkaVZV persisted in vivo and reactivated as serum antibody titers decreased after vaccination. This has salient consequences for individuals immunized with OkaVZV.     

Infection by human varicella-zoster virus confers norepinephrine sensitivity to sensory neurons from rat dorsal root ganglia.

Varicella-zoster virus (VZV) is a widespread human herpes virus causing chicken pox on primary infection and persisting in sensory neurons. Reactivation causes shingles, which are characterized by severe pain and often lead to postherpetic neuralgia. To elucidate the mechanisms of VZV-associated hyperalgesia, we elaborated an in vitro model for the VZV infection of sensory neurons from rat dorsal root ganglia. Between 35 and 50% of the neurons showed strong expression of the immediate-early virus antigens IE62 and IE63 and the late glycoprotein gE. When the intracellular calcium concentration was monitored microfluorometrically for individual cells after infection, the sensitivity to GABA or capsaicin was similar in controls and in VZV-infected neurons. However, the baseline calcium concentration was increased. Neurons became de novo sensitive to adrenergic stimulation after VZV infection. Norepinephrine-responsive neurons were more frequent and calcium responses to norepinephrine were significantly higher after infection with wild-type isolates than with the attenuated vaccine strain OKA. The adrenergic agonists phenylephrine and isoproterenol had similar efficacy. We suggest that the infection with wild-type VZV isolates confers norepinephrine sensitivity to sensory neurons by using alpha(1)- and/or beta(1)-adrenergic receptors providing a model for the pathophysiology of the severe pain associated with the acute reactivation of VZV.     

The Attenuated Genotype of Varicella-Zoster Virus Includes an ORF0 Transitional Stop Codon Mutation

Varicella-zoster virus (VZV) is the first of the human herpesviruses to be attenuated and subsequently approved as a live vaccine to prevent varicella and herpes zoster. Both the attenuated VZV vaccine, called vaccine Oka or vOka, and the parental strain pOka have been completely sequenced. Yet the specific determinants of attenuation are uncertain. The open reading frame (ORF) with the most single nucleotide polymorphisms (SNPs), ORF62, encodes the regulatory protein IE62, but IE62 studies have failed to define a specific SNP associated with attenuation. We have completed next-generation sequencing of the VZV Ellen genome, a strain known to be highly attenuated by its very limited replication in human skin xenografts in the SCID mouse model of VZV pathogenesis. A comparative analysis of the Ellen sequence with all other complete VZV sequences was extremely informative. In particular, an unexpected finding was a stop codon mutation in Ellen ORF0 (herpes simplex virus UL56 homolog) identical to one found in vOka, combined with the absence of polymorphisms in most Ellen ORFs that were known to be mutated in vOka. The mutated ORF0 protein was also imaged in both two dimensions and three dimensions by confocal microscopy. The probability of two VZV strains not connected by a recent common ancestor having an identical ORF0 SNP by chance would be 1 × 10(-8), in other words, extremely unlikely. Taken together, these bioinformatics analyses strongly suggest that the stop codon ORF0 SNP is one of the determinants of the attenuation genotype of live VZV vaccines.     

Complete-genome phylogenetic approach to varicella-zoster virus evolution: genetic divergence and evidence for recombination

Recent studies of varicella-zoster virus (VZV) DNA sequence variation, involving large numbers of globally distributed clinical isolates, suggest that this virus has diverged into at least three distinct genotypes designated European (E), Japanese (J), and mosaic (M). In the present study, we determined and analyzed the complete genomic sequences of two M VZV strains and compared them to the sequences of three E strains and two J strains retrieved from GenBank (including the Oka vaccine preparation, V-Oka). Except for a few polymorphic tandem repeat regions, the whole genome, representing approximately 125,000 nucleotides, is highly conserved, presenting a genetic similarity between the E and J genotypes of approximately 99.85%. These analyses revealed that VZV strains distinctly segregate into at least four genotypes (E, J, M1, and M2) in phylogenetic trees supported by high bootstrap values. Separate analyses of informative sites revealed that the tree topology was dependent on the region of the VZV genome used to determine the phylogeny; collectively, these results indicate the observed strain variation is likely to have resulted, at least in part, from interstrain recombination. Recombination analyses suggest that strains belonging to the M1 and M2 genotypes are mosaic recombinant strains that originated from ancestral isolates belonging to the E and J genotypes through recombination on multiple occasions. Furthermore, evidence of more recent recombination events between M1 and M2 strains is present in six segments of the VZV genome. As such, interstrain recombination in dually infected cells seems to figure prominently in the evolutionary history of VZV, a feature it has in common with other herpesviruses. In addition, we report here six novel genomic targets located in open reading frames 51 to 58 suitable for genotyping of clinical VZV isolates.     

Errant processing and structural alterations of genomes present in a varicella-zoster virus vaccine.

Five minority populations of aberrant, varicella-zoster virus (VZV)-derived genomes were identified among the encapsidated DNAs obtained from the nuclear and cytoplasmic fractions of an in vitro infection initiated with a lyophilized sample of the BIKEN VZV vaccine (strain Oka). These were (i) VZV genomes, present within nuclear but not cytoplasmic viral capsids, which had been cleaved at a specific site within the short segment and which were, therefore, 3.15 megadaltons (approximately 4% of the VZV genome length) short of full length; (ii) highly deleted, repetitive VZV genomes which contained the errant cleavage site but not the usual VZV genome terminal sequences; (iii) VZV genomes into which multiples of 1 through 5 defective genome repeat units had been inserted into a homologous site; (iv) VZV genomes with additions of 0.1 or 0.18 megadaltons of DNA at both the terminal and internal ends of the short segment; and (v) VZV DNA which had lost the HindIII restriction site at map position 0.11.     

Attenuation of the Vaccine Oka Strain of Varicella-Zoster Virus and Role of Glycoprotein C in Alphaherpesvirus Virulence Demonstrated in the SCID-hu Mouse

The SCID-hu mouse implanted with human fetal tissue is a novel model for investigating human viral pathogenesis. Infection of human skin implants was used to investigate the basis for the clinical attenuation of the varicella-zoster virus (VZV) strain, V-Oka, from which the newly licensed vaccine is made. The pathogenicity of V-Oka was compared with that of its parent, P-Oka, another low-passage clinical isolate, strain Schenke (VZV-S), and VZV-Ellen, a standard laboratory strain. The role of glycoprotein C (gC) in infectivity for human skin was assessed by using gC-negative mutants of V-Oka and VZV-Ellen. Whereas all of these VZV strains replicated well in tissue culture, only low-passage clinical isolates were fully virulent in skin, as shown by infectious virus yields and analysis of implant tissues for VZV DNA and viral protein synthesis. The infectivity of V-Oka in skin was impaired compared to that of P-Oka, providing the first evidence of a virologic basis for the clinical attenuation of V-Oka. The infectivity of V-Oka was further diminished in the absence of gC expression. All strains except gC-Ellen retained some capacity to replicate in human skin, but cell-free virus was recovered only from implants infected with P-Oka or VZV-S. Although VZV is closely related to herpes simplex virus type 1 (HSV-1) genetically, experiments in the SCID-hu model revealed differences in tropism for human cells that correlated with differences in VZV and HSV-1 disease. VZV caused extensive infection of epidermal and dermal skin cells, while HSV-1 produced small, superficial lesions restricted to the epidermis. As in VZV, gC expression was a determinant for viral replication in skin. VZV infects human CD4⁺ and CD8⁺ T cells in thymus/liver implants, but HSV-1 was detected only in epithelial cells, with no evidence of lymphotropism. These SCID-hu mouse experiments show that the clinical attenuation of the varicella vaccine can be attributed to decreased replication of V-Oka in skin and that tissue culture passage alone reduces the ability of VZV to infect human skin in vivo. Furthermore, gC, which is dispensable for replication in tissue culture, plays a critical role in the virulence of the human alphaherpesviruses VZV and HSV-1 for human skin.     

Infection of human T lymphocytes with varicella-zoster virus: an analysis with viral mutants and clinical isolates

Varicella-zoster virus (VZV) disseminates in the body in peripheral blood mononuclear cells during chickenpox. Up to 1 in 10,000 mononuclear cells are infected during the viremic phase of the disease. We developed an in vitro system to infect human mononuclear cells with VZV by using umbilical cord blood. In this system, 3 to 4% of T cells were infected with VZV. VZV mutants unable to express certain genes, such as open reading frame 47 (ORF47) or ORF66, were impaired for growth in T cells, while other mutants showed little difference from parental virus. VZV unable to express ORF47 was even more impaired for spread from umbilical cord blood cells to melanoma cells in vitro. Early-passage clinical isolates of VZV infected T cells at a similar rate to the Oka vaccine strain; however, the clinical isolates were more efficient in spreading from infected T cells to melanoma cells. This in vitro system for infecting human T cells with VZV should be useful for identifying cellular and viral proteins that are important for virus replication in T cells and for the spread of virus from T cells to other cells.     

Characterization and phylogenetic analysis of Varicella-zoster virus strains isolated from Korean patients

Varicella-zoster virus (VZV) is a causative agent of chickenpox in primary infection and shingles after its reactivation from latency. Complete or almost-complete genomic DNA sequences for various VZV strains have been reported. Recently, clinical VZV strains were isolated from Korean patients whose genome was sequenced using high-throughput sequencing technology. In this study, we analyzed single nucleotide polymorphism (SNP) of VZV strains to genetically characterize Korean clinical isolates. Phylogenetic analyses revealed that three Korean strains, YC01, YC02, and YC03, were linked to clade 2. Comprehensive SNP analysis identified 86 sites specific for the 5 VZV clades. VZV strains isolated from Korea did not form a phylogenetic cluster. Rather, YC02 and YC03 clustered strongly with Chinese strain 84-7 within clade 2, more specifically cluster 2a. Signature sequences for the cluster 2a were identified and found to play an important role in the separation of cluster 2a strains from other clade 2 strains, as shown in substitution studies. Further genetic analysis with additional strains isolated from Japan, China, and other Asian countries would provide a novel insight into the significance of two distinct subclades within clade 2.     

Genetic analysis of varicella-zoster virus ORF0 to ORF4 by use of a novel luciferase bacterial artificial chromosome system

To efficiently generate varicella-zoster virus (VZV) mutants, we inserted a bacterial artificial chromosome (BAC) vector in the pOka genome. We showed that the recombinant VZV (VZV(BAC)) strain was produced efficiently from the BAC DNA and behaved indistinguishably from wild-type virus. Moreover, VZV's cell-associated nature makes characterizing VZV mutant growth kinetics difficult, especially when attempts are made to monitor viral replication in vivo. To overcome this problem, we then created a VZV strain carrying the luciferase gene (VZV(Luc)). This virus grew like the wild-type virus, and the resulting luciferase activity could be quantified both in vitro and in vivo. Using PCR-based mutagenesis, open reading frames (ORF) 0 to 4 were individually deleted from VZV(Luc) genomes. The deletion mutant viruses appeared after transfection into MeWo cells, except for ORF4, which was essential. Growth curve analysis using MeWo cells and SCID-hu mice indicated that ORF1, ORF2, and ORF3 were dispensable for VZV replication both in vitro and in vivo. Interestingly, the ORF0 deletion virus showed severely retarded growth both in vitro and in vivo. The growth defects of the ORF0 and ORF4 mutants could be fully rescued by introducing wild-type copies of these genes back into their native genome loci. This work has validated and justified the use of the novel luciferase VZV BAC system to efficiently generate recombinant VZV variants and ease subsequent viral growth kinetic analysis both in vitro and in vivo.     

Evaluation of the neurovirulence test for mumps vaccines.

Neurovirulence tests in Macaca fascicularis using commercial preparations of different vaccine bulks and a wild-type strain revealed that the test was unable to distinguish mixed from pure populations or a suitable vaccine from a related strain which has been shown to be associated with clinical meningitis. However, the test was able to distinguish a wild-type strain from the vaccine strains successfully. The ability of the test to discriminate between acceptable and unacceptable seeds requires further examination.     

Proteins specified by the short unique region of the genome of pseudorabies virus play a role in the release of virions from certain cells.

Two pseudorabies virus vaccine strains (Bartha and Norden) that have a similar deletion in the short unique (Us) region of the genome have been identified previously (B. Lomniczi, M. L. Blankenship, and T. Ben-Porat, J. Virol. 49:970-979, 1984). These strains do not code for the glycoprotein gI, a glycoprotein that has been mapped on the wild type virus genome by T. C. Mettenleiter, N. Lukacs, and H. J. Rziha (J. Virol. 53:52-57, 1985) to the sequences deleted from the vaccine strain. Restoration of these deleted sequences to the Bartha strain genome restores to the virus the ability to specify the gI glycoprotein. The Bartha vaccine strain grows as well as wild-type virus in pig kidney and in rabbit kidney (RK) cells, but is not released efficiently from and forms small plaques in RK cells. The rescued Bartha 43/25a strain (which has an intact Us) is released considerably more efficiently than the Bartha vaccine strain, but less efficiently than wild-type virus from RK cells; it also forms larger plaques on RK cells than does the parental Bartha vaccine strain. The Norden vaccine strain, which has a deletion in the Us, is released better from RK cells than is the Bartha strain, but not as well as is wild-type virus. We conclude that whereas the sequences in the Us that are deleted from the Bartha and Norden strain genomes specify functions that play a role in the release of virions from some cell types, at least one other function (which is defective in the Bartha strain but not in the Norden strain) also affects release of virus from these cells. Since restoration to the Bartha strain of an intact Us restores to the virus both the ability to grow in chicken brains (B. Lomniczi, S. Watanabe, T. Ben-Porat, and A. S. Kaplan, J. Virol. 52:198-205, 1984) and to be released from RK cells, the possibility that the lack of virulence of the Bartha vaccine strain may be related to its limited release from some target cells is discussed.     

Identification of small molecule compounds that selectively inhibit varicella-zoster virus replication

A series of nonnucleoside, N-alpha-methylbenzyl-N'-arylthiourea analogs were identified which demonstrated selective activity against varicella-zoster virus (VZV) but were inactive against other human herpesviruses, including herpes simplex virus. Representative compounds had potent activity against VZV early-passage clinical isolates and an acyclovir-resistant isolate. Resistant viruses generated against one inhibitor were also resistant to other compounds in the series, suggesting that this group of related small molecules was acting on the same virus-specific target. Sequencing of the VZV ORF54 gene from two independently derived resistant viruses revealed mutations in ORF54 compared to the parental VZV strain Ellen sequence. Recombinant VZV in which the wild-type ORF54 sequence was replaced with the ORF54 gene from either of the resistant viruses became resistant to the series of inhibitor compounds. Treatment of VZV-infected cells with the inhibitor impaired morphogenesis of capsids. Inhibitor-treated cells lacked DNA-containing dense-core capsids in the nucleus, and only incomplete virions were present on the cell surface. These data suggest that the VZV-specific thiourea inhibitor series block virus replication by interfering with the function of the ORF54 protein and/or other proteins that interact with the ORF54 protein.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.