GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE IS RESPONSIBLE FOR INTRANUCLEAR LOCALIZATION OF SOME OLIGONUCLEOTIDES

Nuclear accumulation of ODNs has been associated with their binding to a series of nuclear proteins. These interactions could be responsible for the sequence-independent effects of ODNs as well as for their sequence-specific interactions and their intracellular distribution. Investigation of interaction of ODNs with these proteins may shed light on the mechanisms of cellular uptake and nuclear accumulation of oligonucleotides.     

Characterisation of membrane oligonucleotide-binding proteins and oligonucleotide uptake in keratinocytes.

Inadequate cellular compartmentalisation of plasmid DNA and antisense oligodeoxynucleotides (ODNs) is generally considered as a major limitation in their use. In this study, an approach combining in situ visual-isation of rhodamine-labelled ODNs and affinity modification of proteins by radiolabelled-alkylating ODN derivatives has been used to investigate the uptake of ODNs into keratinocytes. We confirm here that unmodified ODNs are efficiently taken up and accumulate in cell nuclei in primary keratinocytes as well as in HaCaT and A431 keratinocyte cell lines. Uptake is fast, irreversible, saturable and not significantly altered by incubation at low temperature. Affinity modification studies in keratinocyte cell lines has revealed two high-affinity, cell-specific interactions between ODNs and proteins of 61-63 kDa and 35 kDa. Trypsin pre-treatment of A431 cells and pre-incubation with polyanions, or with unlabelled nucleic acid competitors, inhibited the accumulation of rhodamine-labelled ODNs in nuclei as well as the affinity labelling of the 61-63 kDa doublet and 35 kDa ODN-binding proteins by reactive ODN derivatives. Finally, cell fractionation studies indicated that these ODN-binding proteins were essentially localised in the plasma membrane. Our results suggest that these ODN-binding proteins might be involved in the recognition and transport of ODNs into keratinocytes.     

Nucleocytoplasmic shuttling: a novel in vivo property of antisense phosphorothioate oligodeoxynucleotides

Phosphorothioate oligodeoxynucleotides (P=S ODNs) are frequently used as antisense agents to specifically interfere with the expression of cellular target genes. However, the cell biological properties of P=S ODNs are poorly understood. Here we show that P=S ODNs were able to continuously shuttle between the nucleus and the cytoplasm and that shuttling P=S ODNs retained their ability to act as antisense agents. The shuttling process shares characteristics with active transport since it was inhibited by chilling and ATP depletion in vivo. Transport was carrier-mediated as it was saturable, and nuclear pore complex-mediated as it was sensitive to treatment with wheatgerm agglutinin. Oligonucleotides without a P=S backbone chemistry were only weakly restricted in their migration by chilling, ATP depletion and wheatgerm agglutinin and thus moved by diffusion. P=S ODN shuttling was only moderately affected by disruption of the Ran/RCC1 system. We propose that P=S ODNs shuttle through their binding to yet unidentified cellular molecules that undergo nucleocytoplasmic transport via a pathway that is not as strongly dependent on the Ran/RCC1 system as nuclear export signal-mediated protein export, U-snRNA, tRNA and mRNA export. The shuttling property of P=S ODNs must be taken into account when considering the mode and site of action of these antisense agents.     

Oligonucleotide structure influences the interactions between cationic polymers and oligonucleotides

We examined the effect of oligodeoxynucleotide (ODN) structure on the interactions between cationic polymers and ODNs. Unstructured and hairpin structured ODNs were used to form complexes with the model cationic polymer, poly-L-lysine (pLL), and the characteristics of these polymer-ODN interactions were subsequently examined. We found that hairpin structured ODNs formed complexes with pLL at slightly lower pLL:ODN charge ratios as compared to unstructured ODNs and that, at high charge ratios, greater fractions of the hairpin ODNs were complexed, as measured by dye exclusion. The dissociation of pLL-ODN interactions was tested further by challenge with heparin, which induced complex disruption. Both the kinetics and heparin dose response of ODN release were determined. The absolute amount and the kinetic rate of ODN release from the complexes of pLL and unstructured ODN were greater, as compared to hairpin ODNs. Our results therefore highlight the role of ODN structure on the association-dissociation behavior of polymer-ODN complexes. These findings have implications for the selection of ODN sequences and design of polymeric carriers used for cellular delivery of ODNs.     

G-rich oligonucleotides alter cell cycle progression and induce apoptosis specifically in OE19 esophageal tumor cells

Short synthetic oligonucleotides (ODNs) can be used to block cellular processes involved in cell growth and proliferation. Often acting as aptamers, these molecules interact with critical proteins that regulate the induction of apoptosis or necrosis. We have used a specialized class of ODNs that contain a monomeric sequence of guanosine to induce apoptosis specifically in the malignant esophageal cell line, OE19, in cell culture, and in a NODscid mouse model. OE19 cells were grown in culture and treated with a stable G-rich oligonucleotide (GRO). Cells were processed and apoptosis was measured by FACS analyses, caspase activity, and Hoescht staining. Circular dichroism (CD) was used to define the structure and stability of various GROs. The GRO works by first inducing retardation in the progression of the cell cycle and then by creating a sub-G1 population of apoptotic cells. The reaction is dose dependent, and appears to rely on the capacity of the G-rich ODN to adopt a G-quartet conformation. Apoptosis was measured by determining caspase 3/7 levels and by staining for nuclear fragmentation using the Hoechst dye. Importantly, nonmalignant esophageal cells or normal human lung fibroblasts are not impeded in their cell cycle progression when incubated with the G-rich ODNs. These results suggest that a selective killing of esophageal tumor cells is directed by G-rich ODNs. Selective killing was demonstrated in the unique activity of the GRO compared to other ODNs of different sequences as well as the response of oncogenic cells compared to nononcogenic cells.     

Nucleolar localization/retention signal is responsible for transient accumulation of histone H2B in the nucleolus through electrostatic interactions

The majority of known nuclear proteins are highly mobile. The molecular mechanisms by which they accumulate inside stable compartments that are not separated from the nucleoplasm by membranes are obscure. The compartmental retention of some proteins is associated with their biological function; however, some protein interactions within distinct nuclear structures may be non-specific. The non-specific retention may lead to the accumulation of proteins in distinct structural domains, even if the protein does not function inside this domain. In this study, we have shown that histone H2B-EGFP initially accumulated in the nucleolus after ectopic expression, and then gradually incorporated into the chromatin to leave only a small amount of nucleolus-bound histone that was revealed by removing chromatin-bound proteins with DNase I treatment. Nucleolar histone H2B had several characteristics: (i) it preferentially bound to granular component of the nucleolus and interacted with RNA or RNA-containing nucleolar components; (ii) it freely exchanged between the nucleolus and nucleoplasm; (iii) it associated with the nuclear matrix; and (iv) it bound to interphase prenuclear bodies that formed after hypotonic treatment. The region in histone H2B that acts as a nucleolar localization/retention signal (NoRS) was identified. This signal overlapped with a nuclear localization signal (NLS), which appears to be the primary function of this region. The NoRS activity of this region was non-specific, but the molecular mechanism was probably similar to the NoRSs of other nucleolar proteins. All known NoRSs are enriched with basic amino acids, and we demonstrated that positively charged motifs (nona-arginine (R9) and nona-lysine (K9)) were sufficient for the nucleolar accumulation of EGFP. Also, the correlation between measured NoRS activity and the predicted charge was observed. Thus, NoRSs appear to achieve their function through electrostatic interactions with the negatively charged components of the nucleolus. Though these interactions are non-specific, the functionally unrelated retention of a protein can increase the probability of its interaction with specific and functionally related binding sites.     

Nonspecific effects of oligodeoxynucleotide injection in Xenopus oocytes: a reevaluation of previous D7 mRNA ablation experiments

Microinjection of oligodeoxynucleotides (ODNs) complementary to cellular mRNAs has been advanced as an experimental approach to degrade target mRNAs in vivo and thereby obtain information as to the function of their cognate proteins. It is shown here that ODNs can induce a variety of aberrations in cell metabolism and structure when injected into Xenopus oocytes. Examination of histological sections of ODN-injected oocytes revealed the frequent abnormal accumulation of heavily staining basophilic material in the area of the germinal vesicle (gv). Ultrastructural analysis detected further abnormalities including blebbing of the plasma membrane, anomalous cytoskeletal structures, hyperorganised annulate lamellae, hyperinvagination of the gv, and formation of irregular nucleoli within the gv. Analysis of newly synthesised proteins by [35S]methionine radiolabelling of oocytes demonstrated that ODN injection can trigger a general decrease in both label uptake and protein synthesis. Qualitative effects on protein synthesis could also be observed, particularly a decrease in synthesis of high molecular weight proteins. The severity of ODN-induced effects is dose-dependent and highly variable from ODN to ODN. The previously reported delay in progesterone-induced maturation observed in oocytes depleted of the maternal mRNA D7 by ODN-directed degradation (Smith R. C., Dworkin M. B. and Dworkin-Rastl E. (1988) Genes and Devpt. 2, 1296-1306) is most likely a result of nonspecific ODN effects in the oocyte. Oocytes injected with effective antisense D7 ODNs that do not display detectable side effects matured with normal kinetics.     

Peripheral-type benzodiazepine receptor-mediated action of steroidogenic acute regulatory protein on cholesterol entry into leydig cell mitochondria

Hormone-induced steroid biosynthesis begins with the transfer of cholesterol from intracellular stores into mitochondria. Steroidogenic acute regulatory protein (StAR) and peripheral-type benzodiazepine receptor (PBR) have been implicated in this rate-determining step of steroidogenesis. MA-10 mouse Leydig tumor cells were treated with and without oligodeoxynucleotides (ODNs) antisense to PBR and StAR followed by treatment with saturating concentrations of human choriogonadotropin. Treatment with ODNs antisense but not missense for both proteins inhibited the respective protein expression and the ability of the cells to synthesize steroids in response to human choriogonadotropin. Treatment of the cells with either ODNs antisense to PBR or a transducible peptide antagonist to PBR resulted in inhibition of the accumulation of the mature mitochondrial 30-kDa StAR protein, suggesting that the presence of PBR is required for StAR import into mitochondria. Addition of in vitro transcribed/translated 37-kDa StAR or a fusion protein of Tom20 (translocase of outer membrane) and StAR (Tom/StAR) to mitochondria isolated from control cells increased pregnenolone formation. Mitochondria isolated from cells treated with ODNs antisense, but not missense, to PBR failed to form pregnenolone and respond to either StAR or Tom/StAR proteins. Reincorporation of in vitro transcribed/translated PBR, but not PBR missing the cholesterol-binding domain, into MA-10 mitochondria rescued the ability of the mitochondria to form steroids and the ability of the mitochondria to respond to StAR and Tom/StAR proteins. These data suggest that both StAR and PBR proteins are indispensable elements of the steroidogenic machinery and function in a coordinated manner to transfer cholesterol into mitochondria.     

Cellular uptake of intracerebroventricularly administered biotin- or digoxigenin-Labeled antisense oligodeoxynucleotides in the rat

Summary 1. Antisense oligodeoxynucleotides (ODNs) internally labeled with biotin or digoxigenin were injected into the lateral ventricle of rats and the distribution of the labeled ODNs was examined at several timepoints following the intracerebroventricular (icv) injections. The stability of these injected antisense ODNs, which had no backbone modifications, was also studied by performing recovery experiments.2. The most intense labeling was observed near the injection site, in periventricular areas, and in perivascular regions. Many of the labeled cells appeared to be neurons, and both the cytoplasm and the nuclei were stained. The labeled cells were detected 15 min after icv injection, demonstrating that the antisense ODNs were taken up rapidly by cells in the parenchyma. The digoxigeninated antisense ODNs were presented in both the cytoplasmic and the nuclear fractions of rat brain extracts, however, the levels appeared to be much lower in the nuclear fractions.3. Antisense ODNs injected into the lateral ventricle seemed to follow the bulk flow of cerebrospinal fluid (CSF), i.e., from the injection site in the lateral ventricle, through the ventricular system, to the subarachnoid spaces and the perivascular spaces. From the ventricular and perivascular spaces, the antisense ODNs diffused into the extracellular space and were taken up by cells. The full-length digoxigeninated antisense ODNs were detectable within cells after only 15 min, indicating their rapid uptake. In addition, the antisense ODNs appeared to be relatively stable in the brain since the full-length digoxigeninated ODNs were still detectable after 4 hr.     

CpG oligodeoxynucleotides modulate the osteoclastogenic activity of osteoblasts via Toll-like receptor 9

Regulation of osteoclastogenesis by lipopolysaccharide (LPS) is mediated via its interactions with toll-like receptor 4 (TLR4) on both osteoclast- and osteoblast-lineage cells. We have recently demonstrated that CpG oligodeoxynucleotides (CpG ODNs), known to mimic bacterial DNA, modulate osteoclastogenesis via interactions with osteoclast precursors. In the present study we characterize the interactions of CpG ODNs with osteoblasts, in comparison with LPS. We find that, similar to LPS, CpG ODNs modulate osteoclastogenesis in bone marrow cell/osteoblast co-cultures, although in a somewhat different pattern. Osteoblasts express receptors for both LPS and CpG ODN (TLR4 and TLR9, respectively). The osteoblastic TLR9 transmits signals into the cell as demonstrated by NFkappaB activation as well as by extracellular-regulated kinase (ERK) and p38 phosphorylation. Similar to LPS, CpG ODN increases in osteoblasts the expression of tumor necrosis factor (TNF)-alpha and macrophage-colony stimulating factor (M-CSF). The two TLR ligands do not affect osteoprotegerin expression in osteoblasts. CpG ODN does not significantly affect receptor activator of NFkappaB ligand (RANKL) expression, in contrast to LPS, which induces the expression of this molecule. In the co-cultures CpG ODN induces RANKL expression in osteoblasts as a result of the more efficient TNF-alpha induction. CpG ODN activity (modulation of osteoclastogenesis, gene expression, ERK and p38 phosphorylation, and nuclear translocation of NFkappaB) is specific, because the control oligodeoxynucleotide, not containing CpG, is inactive. Furthermore, these effects (unlike the LPS effects) are inhibited by chloroquine, suggesting a requirement for endosomal maturation/acidification, the classic CpG ODN mode of action. We conclude that CpG ODN, upon TLR9 ligation, induces osteoblasts osteoclastogenic activity.     

Functional Interaction of CREB Binding Protein (CBP) with Nuclear Transport Proteins and Modulation by HDAC Inhibitors

Nuclear transport proteins such as CSE1, NUP93 and Importinα have recently been shown to be chromatin-associated proteins in yeast, which have unexpected functions in gene regulation. Here we report interactions between the mammalian histone acetyltransferase CBP with nuclear transport proteins CAS (a CSE1 homologue) and Importin-α (Impα) and NUP93. CAS was found to bind the SRC1 interaction domain (SID) of CBP via a leucine-rich motif in the N-terminus of the protein, that is conserved in other SID-binding proteins. Co-immunoprecipitation experiments also revealed that CBP and Impα proteins form a complex. As Impα is a known acetylation target of CBP/p300, and is recycled to the cytoplasm via the exportin CAS, we investigated whether HDAC inhibitors would alter the subcellular localisation of these proteins. Treatment of COS-1 cells with the HDAC inhibitors trichostatin A or sodium butyrate resulted in sequestration of Impα in the nuclear envelope, accumulation of CAS in nuclear aggregates, and an increased number of CBP-containing PML bodies per cell. In addition, HDACi treatment appeared to enhance the association of Impα and CBP in co-immunoprecipitation experiments. Our results provide evidence for novel functional interactions between the chromatin modification enzyme CBP and nuclear transport proteins in mammalian cells.     

Efficient cationic lipid-mediated delivery of antisense oligonucleotides into eukaryotic cells: down-regulation of the corticotropin-releasing factor receptor

Oligonucleotides (ODNs) can be employed as effective gene-specific regulators. However, before ODNs can reach their targets, several physical barriers have to be overcome, as although ODNs may pass cell membranes, most become sequestered in endocytic compartments. Accordingly, sophisticated strategies are required for efficient delivery. Here we have employed a pyridinium-based synthetic amphiphile, called SAINT-2, which carries ODNs into cells in a highly efficient, essentially non-toxic and serum-insensitive manner. Intracellular delivery was examined by monitoring the trafficking of fluorescent ODNs and lipid, and by measuring the effect of specific antisense ODNs on target mRNA and protein levels of the receptor for the neuropeptide corticotropin-releasing factor (CRF-R), expressed in Chinese hamster ovary cells. ODN delivery is independent of lipoplex size, and fluorescently tagged ODNs readily acquire access to the nucleus, whereas the carrier itself remains sequestered in the endosomal–lysosomal pathway. While the release is independent of the presence of serum, it is not observed when serum proteins gain access within the lipoplex, and which likely stabilizes the lipoplex membrane. We propose that the amphiphile-dependent aggregate structure governs complex dissociation, and hence, the biological efficiency of ODNs. We demonstrate an essentially non-toxic and effective antisense-specific down-regulation of the CRF-R, both at the mRNA and protein level.     

Analysis of interaction between dendriplexes and bovine serum albumin

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.