New phosphoramidates as protecting groups in ribooligonucleotides synthesis.

N, N-Dimethyl-p-phenylenediamine, glycine amide and p-methylthioaniline were condensed with uridine 5'-phosphate and the phosphoramidates obtained were tested for their stability in anhydrous pyridine, 50% aqueous pyridine or 80% acetic acid. The p-methylthioanilidate (IIc) was oxidized to give p-methylsulfoxylanilidate of uridine 5'-phosphate (IId) which was found to be 5 times more stable than the p-methylthio compound. The p-methylsulfoxylanilidate of 2'-O-benzoyluridine 3'-phosphate was condensed with the mononucleotide to yield the dinucleotide, MMTrU(OBz)-p-U(OBz)-p in 28% yield.     

The use of crude lipase in deprotection of C-terminal protecting groups

A crude lipase, Newlase F, was used to remove C-terminal protecting groups from dipeptide esters. Hydrolysis of dipeptide n-heptyl esters with Newlase F was conducted in aqueous media containing acetonitrile. The optimum pH and temperature of lipase in Newlase F were 7.0 and 30 °C, respectively. Low level acetonitrile promoted the hydrolysis of dipeptide n-heptyl esters, while high level acetonitrile inhibited the hydrolysis. However, the protease activity in Newlase F was significantly inhibited by acetonitrile. Lipase in Newlase F worked better in a medium containing water-miscible organic solvents than in water-immiscible ones. N-terminal protecting groups were not affected by the protease in the crude enzyme. It was found that the protease in Newlase F did not hydrolyze amide bond with hydrophilic amino acids on either side under these conditions (pH 7.0, room temperature). Newlase F may consequently be used widely in the synthesis of peptide conjugates. The crude enzyme was immobilized on SBA-15 mesoporous molecular sieve. The lipase activity of immobilized preparation was more active on hydrolysis of C-terminal protecting groups and stable than the free enzyme. The immobilization also reduced the protease activity.     

The use of cyclic bifunctional protecting groups in oligosaccharide synthesis--an overview

A historical overview is presented on stereo-directing effects of cis- and trans-fused diol protective groups used on both donor and acceptor glycosides. Attention is focused on the use of cyclic carbonates and carbamates, diacetals and acetals and finally the special case of 1,2-O-orthoesters and 1,2-O-cyanoalkylidene functionalised residues.     

Semisynthetic analogues of the marine cembranoid sarcophine as prostate and breast cancer migration inhibitors

Sarcophine (1) is a bioactive cembranoid diterpene isolated from the Red Sea soft coral Sarcophyton glaucum. Previous semisynthesis attempts resulted in decreased or complete loss of 1's anticancer activity. Sarcophine and analogues showed antimigratory activity against breast and prostate cancer cell lines. This encouraged further semisynthestic optimizations to improve its activity and establish a preliminary structure-activity relationship. Eight new and five known semisynthetic analogues were generated. These compounds were evaluated for their ability to inhibit growth, proliferation, and migration of the prostate and breast metastatic cancer cell lines PC-3 and MDA-MB-231, respectively. Most analogues exhibited enhanced antimigratory activity.     

Semisynthetic derivatives of glucagon. The contribution of histidine-1 to hormone conformation and activity

Semisynthetic N epsilon- acetimidoglucagon was prepared from the [des- His1 ]analogue by coupling the N-hydroxysuccinimide ester of N alpha- tBoc - Nimidazole -DNP-L-histidine to the peptide in dimethylformamide in the presence of 1-hydroxybenzotriazole. The deprotected, purified product was chemically identical to N epsilon- acetimidoglucagon and equipotent to N epsilon- acetimidoglucagon and native glucagon in its ability to activate adenylate cyclase and displace [125I] iodoglucagon from rat liver plasma membranes. Semisynthetic [ Phe1 ]-, [ Ala1 ]-, and [des- His1 ] glucagons prepared similarly achieved 85, 55, and 35% of the maximal activity and 22, 2, and 6% of the binding potency of N epsilon- acetimidoglucagon . The biological assays indicate that the amino group is involved to a greater extent in transduction than in binding, but the aromatic nature and hydrogen bonding capability of the imidazole ring of histidine-1 are important for both binding and transduction. In circular dichroism studies, all derivatives exhibited increased helicity in 2-chloroethanol. The [ Phe1 ] analogue although less soluble behaved similarly to native glucagon, while the [ Ala1 ] and [des- His1 ] derivatives exhibited an increased helical content in 0.01 N HCl as a result of an increased propensity of these derivatives to self-associate in the absence of 2-chloroethanol. The unexpected conformational changes throughout the molecule may have relevance for the functional activity.     

Anti-HIV pronucleotides: SATE versus phenyl as a protecting group of AZT phosphoramidate derivatives.

We comparatively studied the decomposition pathways in CEM cell extract of several PHENYL phosphoramidate diesters of AZT. A correlation between anti-HIV activities in TK- cell lines and pharmacokinetic data has been observed. This study would help to design corresponding SATE phosphoramidate diesters which revealed potent anti-HIV properties.     

Biochemical and regulatory effects of methionine analogues in Saccharomyces cerevisiae.

The effect of three methionine analogues, ethionine, selenomethionine, and trifluoromethionine, on the biosynthesis of methionine in Saccharomyces cerevisiae has been investigated. We have found the following to be true. (i) A sharp decrease in the endogenous methionine concentration occurs after the addition of any one of these analogues to growing cells. (ii) All of them can be transferred to methionine transfer ribonucleic acid in vitro as well as in vivo with, as a consequence, their incorporation into proteins. In the absence of radioactive trifluoromethionine, this conclusion results from experiments of an indirect nature and must be taken as an indication rather than a direct demonstration. (iii) Ethionine and selenomethionine can be activated as homologues of S-adenosylmethionine, whereas trifluoromethionine cannot. (iv) All of them can act as repressors of the methionine biosynthetic pathway. This has been shown by measuring the de novo rate of synthesis of methionine in a culture grown in the presence of any one of the three analogues.     

Biological activity and pharmacological prospects of lupane terpenoids: II. Semisynthetic lupane derivatives

The discussion of lupane triterpenoids as prospective medicinal preparations is continued, and semisynthetic triterpenoids are being discussed. Acyl derivatives that mainly exhibit high anti-HIV, antitumor, and organo-protective activities are described. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2006, vol. 32, no. 3; see also http://www.maik.ru.     

Biological activity and pharmacological prospects of lupane terpenoids: II. Semisynthetic lupane derivatives

The discussion of lupane triterpenoids as prospective medicinal preparations is continued, and semisynthetic triterpenoids are being discussed. Acyl derivatives that mainly exhibit high anti-HIV, antitumor, and organoprotective activities are described.     

Reactive derivatives of oligonucleotide phosphorothioate analogues. IV.Site-directed modification of nucleic acids in intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.     

New Syntheses of benzoporphyrin derivatives and analogues for use in photodynamic therapy

An efficient route for the synthesis of isomerically pure benzoporphyrin derivative (BPD) is presented. To understand more about structure/activity relationships in photodynamic therapy, a series of BPD derivatives, including dimers linked with carbon-carbon bonds were also prepared. The structure of the most effective (ring A) BPD isomer (14) was confirmed by a single crystal X-ray study.     

Synthesis of certain 2'-deoxyuridine derivatives containing substituted phenoxy groups attached to C-5'; evaluation as potential dUTP analogues

Derivatives of 2'-deoxyuridine in which the 5'-OH group is replaced by a 2,3,6-trifluoro-5-hydroxy-4-nitrophenoxy or a 4-carboxy-2,3,6-trifluoro-5-hydroxyphenoxy group have been prepared for evaluation as possible dUTP analogues. They showed a weak ability to displace radiolabelled dUTP from a dUTP-binding antiserum. The corresponding compounds lacking the three fluorine substituents were prepared for comparison.     

Exclusive and complete introduction of amino groups and their N-sulfo and N-carboxymethyl groups into the 6-position of cellulose without the use of protecting groups

A new regioselective synthesis of 6-amino-6-deoxycellulose with a DS 1.0 (degree of substitution) at C-6, and its 6-N-sulfonated and its 6-N-carboxymethylated derivatives, without using protecting groups is described in this paper. The reaction conditions were optimized for preparing cellulose tosylate with full tosylation at C-6 and partial tosylation at C-2 and C-3. The nucleophilic substitution (S(N)) reaction of the tosyl group by NaN(3) at low temperature of 50 degrees C in Me(2)SO was achieved completely at C-6, whereas the tosyl groups at C-2 and C-3 were not displaced. In contrast to this, at 100 degrees C the tosyl groups at C-6, and also those at C-2 and C-3, were replaced by azido groups. This regioselective reaction that depends on temperature makes it possible to reach a selective and quantitative S(N) reaction at C-6 at low temperatures. In the subsequent reduction step with LiAlH(4), the azido group at C-6 was reduced to the amino group, and the tosyl groups at C-2 and C-3 were simultaneously completely removed. Also reported is a temperature-dependent, regioselective and complete iodination by nucleophilic substitution of the tosyl group at C-6 at 60 degrees C. At higher temperatures from 75 to 130 degrees C, substitution is also observed to occur at C-2. The selective iodination at 60 degrees C was employed to confirm the complete tosylation at C-6 of cellulose. The reaction products were identified by four different independent quantitative methods, namely 13C NMR, elemental analysis, ESCA, and fluorescence spectroscopy. 6-N-Sulfonated and 6-N-carboxymethylated cellulose derivatives were also synthesized. The new derivatives are potent candidates for structure-function studies, e.g., studies in relation to regioselectively 2-N-sulfonated and 2-N-carboxymethylated chitosan derivatives.