Population and species variation of minisatellite DNA in Plantago

Three Plantago species were surveyed for within- and between-population variation at DNA sequences detected with the M13 minisatellite probe. The levels and patterns of variation detected by this probe correspond to those expected from the mating systems of the species. The highly-selfing species P. major has a relatively low variability of minisatellite sequences within populations and considerable differentiation between populations. The outcrossing species P. lanceolata exhibits higher minisatellite variability within populations and moderate differentiation between populations. P. coronopus, with a mixed mating system, has levels of variation intermediate between P. major and P. lanceolata. The levels of variation within and between populations corresponds, in general, to the levels of allozyme variation determined in an earlier study. Mating system and population structure appear to have a major influence on M13-detected fragment variation.     

A single-locus minisatellite discriminates chinook salmon (Oncorhynchus tshawytscha) populations

A knowledge of genetic structure in natural populations is often necessary for conservation and management purposes, especially in declining Pacific salmon populations. To test for genetic differentiation between nine populations of chinook salmon, Oncorhynchus tshawytscha, from south-western British Columbia, Canada, DNA was extracted from 603 fish and hybridized with a single-locus minisatellite probe. Multivariate statistical analyses of the resulting allele size data permitted successful overall population identification of 52% (individual population range: 24–78%; P < 0.005), indicating a high level of genetic differentiation among the nine populations. Two of the nine populations were further analysed using data from a second minisatellite locus. The discrimination success rate improved from 81.1% (one-locus analyses) to 90.0% (two-locus analyses), indicating the potential for greatly increased resolution gained by the addition of more loci. These results indicate that variation at minisatellite loci can be used for assessing population-level genetic structure, even with artificial gene flow.     

Serial population bottlenecks and genetic variation: Translocated populations of the New Zealand Saddleback (<Emphasis Type="Italic">Philesturnus carunculatus rufusater</Emphasis>)

The genetic effects of population bottlenecks have been well studied theoretically, in laboratory studies, and to some extent, in natural situations. The effects of serial population bottlenecks (SPBs), however, are less well understood. This is significant because recurrent population bottlenecks are likely to be a common feature of the life history of many species. The lack of understanding of SPBs in natural populations has certainly been hampered by a lack of good examples where it can be studied. We report the results of a study into island populations of North Island Saddleback (Philesturnus carunculatus rufusater) that have undergone 13 translocations since 1964, all but one of these has been deliberate and for which detailed records are available. We have examined nine island populations of this passerine bird, from the source population, three first-order bottlenecked and five second-order bottlenecked populations. We examine variation in these nine populations using multilocus minisatellite DNA markers, together with Mendelian loci comprising six microsatellite DNA loci and a variable isozyme locus. Despite the generally low level of genetic variation in the Saddleback source population, we were able to detect a pattern of significant changes in both the mean number of minisatellite DNA bands per individual and the frequency of alleles at the Mendelian loci, with increasing population bottlenecks. This study generally shows that in a natural population, SPBs result in more pronounced genetic changes than do single population bottlenecks by themselves, thereby highlighting their importance for the conservation of rare and endangered species.     

Human minisatellite alleles detectable only after PCR amplification.

We present evidence that a proportion of alleles at two human minisatellite loci is undetected by standard Southern blot hybridization. In each case the missing allele(s) can be identified after PCR amplification and correspond to tandem arrays too short to detect by hybridization. At one locus, there is only one undetected allele (population frequency 0.3), which contains just three repeat units. At the second locus, there are at least five undetected alleles (total population frequency 0.9) containing 60-120 repeats; they are not detected because these tandem repeats give very poor signals when used as a probe in standard Southern blot hybridization, and also cross-hybridize with other sequences in the genome. Under these circumstances only signals from the longest tandemly repeated alleles are detectable above the nonspecific background. The structures of these loci have been compared in human and primate DNA, and at one locus the short human allele containing three repeat units is shown to be an intermediate state in the expansion of a monomeric precursor allele in primates to high copy number in the longer human arrays. We discuss the implications of such loci for studies of human populations, minisatellite isolation by cloning, and the evolution of highly variable tandem arrays.     

Isolation and characterization of EST‐derived microsatellite loci from the fungal wheat pathogen Phaeosphaeria nodorum

Eleven polymorphic microsatellite loci and one minisatellite locus originating from expressed sequence tag (EST) libraries of Phaeosphaeria (syn. Stagonospora) nodorum were isolated and characterized. The satellite markers were used to genotype isolates from field populations collected in China, North America and South Africa. The number of alleles per locus ranged from two to 15. Genotype diversity ranged from 87.5 to 95.3 and gene diversity from 0.1 to 0.8. The variable levels of polymorphism within and among populations of P. nodorum renders these 12 satellite loci ideal markers for population genetic analysis of P. nodorum.     

Genetic markers for the Booroola fecundity (Fec) gene in sheep

Animals from the Booroola line of Australian Merino sheep are characterized by a high ovulation rate that can be attributed to the presence of a codominant allele (Fec ^B).The specific function of the gene has not been identified. Effective use of the trait within the sheep breeding industry requires one or more genetic markers that can distinguish between alternative alleles at the locus Fec. With a combination of DNA minisatellite markers and polymorphic protein markers, a cluster of seven minisatellite fragments has been identified as being linked to the Fec gene and to the ovine A blood group locus. The minisatellite fragments have been derived from multilocus probes and hence cannot be used to define the chromosomal location of the Fec gene or to serve as diagnostic markers for Fec. The derivation of cloned single locus markers from the minisatellite fragments will enable finer scale mapping of the Fec and the A blood group locus in sheep.     

Nucleotide sequence and genomic organization of bird minisatellites.

Two minisatellite loci from a Eurasian songbird, the willow warbler (Phylloscopus trochilus) were isolated, sequenced and used as probes to detect more than 20 related hypervariable loci. In addition, a sequence flanking one of the minisatellite loci was isolated, and used to study a VNTR locus. The bird minisatellites have a repeat unit of either 12 (AGGGAAGGGCTC) or 17 bp (GGGGACAGGGGACACCC), repeated in tandem 40-100 times per locus, and shows partial similarity to the sequence motifs of human minisatellites. These sequences are among the most variable minisatellites known, with the incidence per gamete of new length alleles estimated from family studies of warblers to about 5.6% per locus. The bird minisatellite alleles show mendelian inheritance and segregation analysis indicates that they are derived from families of sequences with members on several autosomal linkage groups. Some of the warbler core sequences cross-hybridize to hypervariable loci in other species of birds, mammals and fishes.     

Characterization of <Emphasis Type="Italic">TPMT</Emphasis> minisatellite locus in five ethnic groups of India

A total of 206 random, healthy individuals belonging to five distinct ethnic groups (Ezhavas, Arayas, Nairs, Vishwakarmas and Muslims) were analyzed for 18 bp VNTR repeat polymorphism present in the 5í flanking region of the Thiopurine Methyl Transferase gene (TPMT). In the present study, the population data of TPMT minisatellite was compared with the population data of other loci and the utility of minisatellite was evaluated in population studies. Human tandem repeat alleles of the TPMT minisatellite locus were characterized for the length polymorphism. The expected and observed heterozygosity did not show any significant difference. All five populations were in Hardy-Weinberg equilibrium. High polymorphism information iontent (PIC) (≥0.658) and power of discrimination (PD) (ranging from 0.775–0.860) value of this VNTR showed that this marker is informative. The combined power of discrimination of TPMT minisatellite along with other two loci studied earlier in our lab was 0.9964. The paternity exclusion power (PE) of TPMT VNTR ranged from 0.203 to 0.533 and the combined power of paternity exclusion (with two other loci D8S315 and D2S1328) was ≥0.8285. All these parameters (heterozygosity, PD, PIC, PE) of TPMT minisatellite locus showed that this marker is informative and can be used for DNA typing and population studies besides being used in clinical investigation in checking thiopurine drug sensitivity of individuals. The text was submitted by the autor in English.     

DNA fingerprinting analysis of Booroola pedigrees: a search for linkage to the Booroola gene

Seven minisatellite probes from a variety of sources were used to analyse 11 paternal half-sib families in which the Booroola gene was segregating. A total of 402 bands that showed segregation in the pedigrees were examined for linkage to the Booroola gene. None of the bands showed segregation with the Booroola gene. The most likely evidence for a linked band was produced by the HaRas HVR probe in Family 902 (=0.0; LOD 2.3). The conclusion, however, is that the minisatellite probes used in this study could not be used as markers for the Booroola gene. The study highlighted problems associated with the use of minisatellite probes in linkage studies in half-sib families. The complex banding patterns found on fingerprinting gels was a major source of scoring error. In a few cases both of the sire's alleles could be identified at a particular locus, but in most cases only one of the alleles could be identified. For the most part, the bands had to be treated as dominant alleles. The contribution of dam alleles to the banding pattern could only be estimated. There was an indication that minisatellite loci in sheep are clustered in particular regions of the sheep genome as the rate at which bands segregated with each other was higher than one would expect from loci randomly distributed throughout the genome.     

Comparative analysis of the DXPas34 regulatory region in rodents

Mouse X chromosome inactivation center contains the DXPas34 minisatellite locus which plays an important role in expression regulation of the Tsix and Xist genes, involved into female dosage compensation. Comparative analysis of the DXPas34 locus from mouse, rat, and four common vole species revealed similar organization of this region in the form of tandem repeat blocks. A search for functionally important elements in this locus showed that all the species examined carried the conservative motif monomers, which could be involved in regulation of X inactivation.     

Instability of (GATA)<Subscript> n</Subscript> microsatellite loci in the parthenogenetic Caucasian rock lizard<Emphasis Type="Italic"> Darevskia unisexualis</Emphasis> (Lacertidae)

Mini- and microsatellites, comprising tandemly repeated short nucleotide sequences, are abundant dispersed repetitive elements that are ubiquitous in eukaryotic genomes. In humans and other bisexual species hypervariable mini- and microsatellite loci provide highly informative systems for monitoring of germline and somatic instability. However, little is known about the mechanisms by which these loci mutate in species that lack effective genetic recombination. Here, multilocus DNA fingerprinting was used to study M13 minisatellite and (GATA) _n microsatellite instability in the parthenogenetic Caucasian rock lizard Darevskia unisexualis (Lacertidae). DNA fingerprinting of 25 parthenogenetic families, from six isolated populations in Armenia (comprising a total of 84 siblings), using the oligonucleotide (GATA)₄ as a hybridization probe, revealed mutant fingerprinting phenotypes in 13 siblings that differed from their mothers in several restriction DNA fragments. In three families (8 siblings), the mutations were present in the germline. Moreover, the mutant fingerprint phenotypes detected in siblings were also present in population DNA samples. No intrafamily variations in DNA fingerprint patterns were observed with the M13 minisatellite probe. Estimates of the mutation rate for (GATA) _n microsatellite loci in D. unisexualis showed that it was as high as that seen in some bisexual species, reaching 15% per sibling or 0.95% per microsatellite band. Furthermore, in one case, a somatic (GATA) _n microsatellite mutation was observed in an adult lizard. These findings directly demonstrate that mutations in (GATA) _n microsatellite loci comprise an important source of genetic variation in parthenogenetic populations of D. unisexualis.Communicated by G. P. Georgiev     

A new human hypervariable locus (K29) maps to the q37.3 region of chromosome 2 and reveals a fingerprint.

A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database.     

DNA fingerprinting in three species of neotropical primates

DNA fingerprinting allows the simultaneous detection of a large number of hypervariable loci consisting of highly polymorphic tandem repeat units that are extensively dispersed in the genome. With the 33.6 human minisatellite probe, hypervariable fragments were detected, for the first time, in the genome of three different species of wild-caught neotropical primates: Aotus infulatus, Aotus azarae, and Cebus apella. As in the human, these species were highly polymorphic, showing distinctive, individual-specific patterns. Estimates of relatedness within each group were calculated from interspecific comparisons based on the number of shared fragments between individuals. This work shows that the 33.6 human minisatellite probe can be very useful for increasing our understanding of population dynamics and behavior of these species in their natural habitat. © 1996 Wiley-Liss, Inc.     

Application of DNA fingerprinting to population study of chamois (Rupicapra rupicapra)

Hypervariable minisatellite DNA probes 33.15 and 33.6, originally developed for studies in human populations, were used to study genetic variation in chamois (Rupicapra rupicapra). The mean number of bands per individual was 25 for probe 33.15 and 15 for probe 33.6. The average band frequency was 0.33 for both probes. The mean similarity was 0.44, greater than that reported for human and natural populations and close to values found in domestic populations of mammals. This lack of variability could be related to the bottleneck suffered by the population due to large-scale hunting after the Spanish Civil War. Levels of variability are high compared with variability at the level of protein markers, so the use of minisatellite DNA is recommended for future population studies in this species. We did not find large genetic differences between subpopulations, indicating that the population is genetically homogeneous.     

Fine-scale phylogeographical analysis of Mediterranean Anacamptis palustris (Orchidaceae) populations based on chloroplast minisatellite and microsatellite variation

The phylogeographical history of the rare marsh orchid Anacamptis palustris (Orchidaceae) was reconstructed using highly polymorphic chloroplast minisatellite and microsatellite loci. Allelic variation at chloroplast microsatellite loci was due to length variation in poly(A/T) repeats and was informative on a regional scale, but was not sufficient to unravel relationships among populations on a local geographical scale. The minisatellite locus, however, was found to be highly variable. Nine distinct repeat types were found and variation in repeat number occurred in five repeat types. The distribution of chloroplast haplotypes, combining microsatellite and minisatellite repeat type variation, provided a clear phylogeographical picture on a large geographical scale, whereas length variation in one highly polymorphic minisatellite repeat type provided fine-scale phylogeographical information. Mediterranean populations could be divided into four main lineages, a western European lineage, a northern and central Italian lineage, a well-isolated southern Italian (Apulian) lineage, and an eastern European lineage. Variation at the most variable minisatellite repeat type N revealed 19 alleles and allowed the study of seed-mediated gene flow and an estimation of the ratio of pollen to seed flow among neighbouring populations.     

Investigation of genetic diversity in wild colonies of naked mole-rats (Heterocephalus glaber) by DNA fingerprinting

DNA from 20 individuals from four wild colonies of naked mole-rats, Heterocephalus glaber , were analysed for restriction fragment length polymorphism of class I major histocompatibility complex genes and minisatellite DNA, both of which have been shown to be highly variable between individuals in other species. The minisatellite probe employed in this study revealed limited polymorphism in the DNA of naked mole-rats, both within and between neighbouring colonies. Of the two class I major histocompatibility complex probes, both showed a lack of polymorphism within colonies, while one revealed a single difference in the restriction fragment pattern between one colony and the other three. This probe also revealed a possible variation in copy number of genes in some individuals. The low numbers of bands on the restriction fragment pattern also indicated that the naked mole-rat MHC I, in contrast to that of other mammalian species, may contain relatively few genes homologous to the class I major histocompatibility complex of the mouse. The absence of variability in naked mole-rat DNA in these normally highly polymorphic loci suggests that there may be little or no genetic diversity either within or between closely neighbouring colonies of naked mole-rats in the wild. The lack of polymorphism in the MHC I questions its possible role in individual odour recognition in this species of rodent.     

Linkage of two distinct AT-rich minisatellites at multiple loci in the genome of Theileria parva

Minisatellite tandem repeat elements are well known components of vertebrate genomes, but have not yet been extensively characterized in lower eukaryotes. We describe two unusual, AT-rich minisatellites of the protozoan parasite Theileria parva whose sequences are unrelated to the G/C-rich `chi minisatellite superfamily' of vertebrate and plant genomes. The T. parva tandem repeats, one with a conserved sequence T_2-5ACACA (6–17 copies), and the other with a 6-bp core sequence of either ACTATA or TATACT associated with additional variable sequences in repeats of 10–17 bp (3–7 copies), were closely linked at more than 20 sites in the T. parva genome, separated by 390, 510 and 660 bp at three loci analysed in detail. Such linkage is without precedent in minisatellites so far analysed in other organisms. The minisatellite loci were widely dispersed on 13 out of 33 genomic SfiI fragments, on all four T. parva chromosomes and did not exhibit a telomeric bias in their distribution. Analysis of flanking sequences revealed no obvious conserved sequences between the five loci, or other multicopy repeat sequences outside the minisatellite regions. The T_2-5 ACACA minisatellite was highly effective as a multilocus fingerprinting probe for discrimination of T. parva isolates. Analysis of two individual minisatellite loci revealed variation between the genomic DNAs of two T. parva isolates in the copy number of the constituent repeats within the array, similar to that typical of vertebrate minisatellites.     

Evolutionary transience of hypervariable minisatellites in man and the primates.

Using PCR, two minisatellite loci showing extreme repeat-unit copy-number variation in humans have been characterized in great apes and monkeys. In contrast to humans, minisatellite locus MS32 is monomorphic with only 3-4 diverged repeat units in great apes, Old World and New World monkeys, this organization presumably representing the relatively stable ancestral precursor state of the human hypervariable locus. Similarly, minisatellite MS1 shows extreme repeat-copy-number variability in man compared with low copy number and minimal variability in great apes. Analysis of variant repeat units shows that the 5' and 3' regions of MS1 are relatively stable in great apes and man, and that variability in man is confined to the central region of the minisatellite. In contrast to the great apes, MS1 is highly variable in Old World monkeys. These results, as well as computer simulations of minisatellite evolution based on known mutation rates, show that short minisatellites are stable within the genome, and that the degree of polymorphism at a given locus can change dramatically over a short period of evolutionary time. The ability of hypervariable minisatellites to detect highly informative loci by cross-species hybridization is therefore largely unpredictable.     

Tetrad analysis shows that gene conversion is the major mechanism involved in mutation at the human minisatellite MS1 integrated in Saccharomyces cerevisiae

Minisatellites are arrays of tandemly repeated DNA sequences which occur at thousands of locations in the human genome. They are frequently hypervariable with respect to allele length as a result of high rates of complex and incompletely understood recombination-based germline mutation events that alter the repeat copy number. MS1 is one of the most variable minisatellites so far isolated from the human genome. We have integrated MS1, flanked by synthetic markers, in the vicinity of a hot spot for meiotic double-strand breaks upstream of the LEU2 locus in chromosome III of Saccharomyces cerevisiae. Here we present the first tetrad analysis of mutations at a human minisatellite locus. The data showed that mutant alleles occur as single mutants in one of the spores in a tetrad, also when the mutant structure was the result of a combination of intra- and inter-allelic rearrangements. The conversional transfer of repeat units from one allele to the other was associated with flanking marker conversion which always involved the same flank of the minisatellite. The results demonstrate that conversion is the predominant mechanism by which minisatellite alleles mutate to new lengths, and also support the assumption that cis-acting elements are involved in the regulation of the mutational process in humans.