Tetraplex formation of d(GGGGGTTTTT): 1H NMR study in solution.

The oligonucleotide d(G5T5) can in principle form a fully matched duplex with G.T pairing and/or a tetraplex. Non-denaturing gel electrophoresis, circular dichroism and NMR experiments show that the tetraplex is exclusively formed by this oligomer in solution. In the presence of its complementary strand d(A5C5) at low temperature, d(G5T5) forms the tetraplex over the normally expected Watson-Crick duplex. However, when d(G5T5) and d(A5C5) are mixed together in equimolar amounts and heated for several minutes at 85 degrees C, and then allowed to cool, the product was essentially the Watson-Crick duplex. The lack of resolution in the 500 MHz 1H NMR spectra and the presence of extensive spin diffusion do not allow us to derive a quantitative structure for the tetraplex from the NMR data. However, we find good qualitative agreement between the NOESY and MINSY data and a theoretically derived stereochemically sound structure in which the G's and T's are part of a parallel tetraplex.     

Circular dichroism spectroscopy reveals invariant conformation of guanine runs in DNA

We demonstrate that the characteristic circular dichroism (CD) features of the parallel-stranded DNA tetraplex of d(G4), especially the strong band at 260 nm, are characteristic for the B and A forms of the antiparallel duplex of d(C4G4). Hence, this band evidently originates from intrastrand guanine-guanine stacking, which is therefore very similar in the duplex and tetraplex DNA. In addition, the same type of the CD spectrum is provided by the ordered single strand of d(GA)10. This observation suggests that the ordered single strand of d(GA)10 is stabilized by a core of guanines stacked like in the parallel tetraplex. This view is used to start the modeling of the molecular structure of the ordered d(GA)10 single strand. Our studies suggest that guanine itself is strong enough to stabilize various secondary structures of DNA, which is a property relevant to thinking about the origin and evolution of molecular replicators.     

Infrared spectral studies of the non regularly alternating purine-pyrimidine hexamers d(m5CGGCM5CG), d(CBr8GGCCBr8G) and d(CGCGGC)

The oligonucleotides d(m5CGGCm5CG), d(CBr8GGCCBr8G) and d(CGCGGC) have been prepared and studied by infrared spectroscopy. The three sequences contain two GC pairs which are out of purine-pyrimidine alternation with the rest of the sequence. From the IR data of the d(m5CGGCm5CG) hexamer, it is shown that all of the dG residues adopt a syn conformation. The marker IR bands for the C3' endo syn conformation are at 1410, 1354, 1320 and 925 cm-1 whereas those for the C2' endo anti conformation at 1420, 1374 and 890 cm-1 are clearly absent. This result implies that the two adjacent guanines of the d(m5CGGCm5CG) sequence are in syn conformation. It is suggested that duplex formation occurs in d(CGCGGC) films and that all of the guanines are in syn conformation. In contrast, the central non-brominated guanine of the d(CBr8GGCCBr8G) hexamer is found in anti conformation, as expected in a Z type structure of the non-alternating region.     

On the chemical nature of DNA and RNA modification by a hemin model system.

In order to model the interaction of hemin with DNA and other polynucleotides, we have studied the degradation of DNA, RNA, and polynucleotides of defined structure by [meso-tetrakis(N-methyl-4-pyridyl)porphinato]manganese(III) (MnTMPP) + KHSO5. The activated porphyrin was shown to release adenine, thymine, and cytosine from DNA; RNA degradation afforded adenine, uracil, and cytosine. The same products were obtained from single- and double-stranded DNA oligonucleotides of defined sequence, and also from single-stranded DNA and RNA homopolymers. The overall yield of bases from the dode-canucleotide d(CGCT3A3GCG) was equal to 14% of the nucleotides present initially, indicating that each porphyrin catalyzed the release of approximately 4 bases. Although no guanine was detected as a product from any of the substrates studied, the ability of MnTMPP + KHSO5 to degrade guanine nucleotides was verified by the destruction of pGp, and by the appearance of bands corresponding to guanosine cleavage following treatment of 32P end labeled DNA restriction fragments with activated MnTMPP. Inspection of a number of sites of MnTMPP-promoted cleavage indicated that the process was sequence-selective, occurring primarily at G residues that were part of 5'-TG-3' or 5'-AG-3' sequences, or at T residues. Also formed in much greater abundance were alkali-labile lesions; these were formed largely at guanosine residues. Also studied was the degradation of a 47-nucleotide RNA molecule containing two hairpins. Degradation of the 5'-32P end labeled RNA substrate afforded no distinct, individual bands, suggesting that multiple modes of degradation may be operative.(ABSTRACT TRUNCATED AT 250 WORDS)     

Crystal structure of a bulged RNA tetraplex at 1.1 a resolution: implications for a novel binding site in RNA tetraplex

Bulges are an important structural motif in RNA and can be used as recognition and interaction sites in RNA-protein interaction and RNA-RNA interaction. Here we report the first crystal structure of a bulged RNA tetraplex at 1.1 A resolution. The hexamer r(U)(BrdG)r(UGGU) forms a parallel tetraplex with the uridine sandwiched by guanines bulging out. The bulged uridine adopts the syn glycosidic conformation and its O2 and N3 atoms face outwards, serving as an effective recognition and interaction site. The bulge formation both widens the groove width and changes the groove hydrogen-bonding pattern on its 5' side. However, the bulge does not make any bends or kinks in the tetraplex structure. The present study demonstrates the dramatic difference between uridine and guanine in forming tetraplex structure. In addition, both G(syn) tetrad and G(anti) tetrad have been observed. They display the same base-pairing pattern and similar C1'-C1' distance but different hydrogen-bonding patterns in the groove.     

Tetraplex folding of telomere sequences and the inclusion of adenine bases.

Telomeres are required for eukaryotic chromosome stability. They consist of regularly repeating guanine-rich sequences, with a single-stranded 3' terminus. Such sequences have been demonstrated to have the propensity to adopt four-stranded structures based on a tetrad of guanine bases. The formation of an intramolecular foldback tetraplex is associated with markedly increased mobility in polyacrylamide. Most telomeric sequences are based either on a repeat of d(TnGGGG) or d(TnAGGG) sequences. We have used a combination 7-deazaguanine or 7-deaza-adenine substitution, chemical modification and gel electrophoresis to address the following aspects of intramolecular tetraplex formation. (i) Intramolecular tetraplex formation by d(TTTTGGGG)4 sequences is prevented by very low levels of 7-deazaguanine substitution. This confirms the important role of guanine N7 in the formation of the tetraplex. (ii) The sequences d(TTAGGG)4 and d(TTTTAGGG)4 fold into tetraplexes. By contrast, the electrophoretic behaviour of d(TTTTGGGA)4, d(TTTTAGAG)4 and d(TTTTGAGA)4 does not indicate formation of stable intramolecular tetraplexes under available conditions. (iii) Selective 7-deazaguanine and 7-deaza-adenine substitutions in d(TTTTAGGG)4 give results consistent with tetraplex folding by the formation of three G4 tetrads, with the adenine bases formally part of the single-stranded loops, where they probably interact with thymine bases. These results demonstrate that eukaryotic cells appear to have selected just those sequences that can adopt the tetraplex conformation for their telomeres, while those that cannot have been avoided. This suggests that the conformation may be significant in the function of the telomere, such as attachment to nuclear structures.     

Conformations of duplex structures formed by oligodeoxynucleotides covalently linked to the intercalator 2-methoxy-6-chloro-9-aminoacridine

A family of covalent complexes between oligonucleotides and derivatives of the intercalating agent 9-amino acridine has been synthesized (Asseline, U., Thuong, N.T. and Helene, C. (1983) C.R.Acad. Sci. (Paris) 297 (III), 369-372) and studied (Lancelot, G., Asseline, U., Thuong, N.T., and Helene, C. (1985) Biochemistry 24, 2521-2529; Lancelot, G., Asseline, U., Thuong, N.T., and Helene, C. (1985) J. Biomol. Str. Dyn. 3, 913-921) with a view to understand nucleic acid-nucleic acid recognition. In order to understand the nature of interactions between the intercalator and the oligonucleotides in such complexes and the sensitivity of such interactions to the polymorphic form of the DNA, we have carried out molecular mechanics simulations on duplex deoxyoligonucleotides d(A)6.d(T)6 (A and B forms) and d(TATC).d(GATA) (B form) covalently bound to 2-methoxy-6-chloro-9-aminoacridine through a pentamethylene linker chain. Structures in which the acridine derivative is end stacked (at the 3' and 5' ends) and in which the dye is intercalated between the terminal base pairs (at both the ends) and between second and third base pairs from the 3' end are all of reasonably low energy in both A and B forms of DNA. Our studies on 3' end complexes find that in the B form, intercalation of the dye between the second and third base pairs is preferred over the other two modes of binding, while in the A form, intercalation between the terminal base pairs is preferred. In the 5' end A and B form complexes, outside stacking and intercalation between the terminal base pairs are preferred, respectively. Our calculations suggest the possibility that the presence of the dye attached covalently to the DNA can induce conformational transitions in the DNA. For example, intercalation of the dye two base pairs from the end could induce an A----B transition.     

Structural polymorphism of telomeric DNA regulated by pH and divalent cation

DNA oligonucleotides can form multi-stranded structures such as a duplex, triplex, and quadruplex, while the double helical structure is generally considered as the canonical structure of DNA oligonucleotides. Guanine-rich or cytosine-rich oligonucleotides, which are observed in telomere, centromere, and other biologically important sequences in vivo, can form four-stranded G-quadruplex and I-motif structures in vitro. In this study, we have investigated the effects of pH and cation on the structures and their stabilities of d(G4T4G4) and d(C4A4C4). The CD spectra and thermal melting curves of DNAs at various pHs demonstrated that acidic conditions induced a stable I-motif structure of d(C4A4C4), while the pH value did not affect the G-quadruplex structure and stability of d(G4T4G4). The CD spectra of the 1:1 mixture of d(G4T4G4) and d(C4A4C4) indicated that the acidic conditions inhibit the duplex formation between d(G4T4G4) and d(C4A4C4). Isothermal titration calorimetry measurements of the duplex formation at various pHs also quantitatively indicated that the acidic conditions inhibit the duplex formation. On the other hand, the CD spectra and thermal melting curves of DNAs in the absence and presence of Ca2+ indicated that Ca2+ induces a parallel G-quadruplex structure of d(G4T4G4) and then inhibits the duplex formation. These results lead to the conclusion that both the pH and coexisting cation can induce and regulate the structural polymorphisms the oligonucleotides in which they form the G-quadruplex, I-motif, and duplex depending on the conditions. Thus, the results reported here indicate pivotal roles of pH and coexisting cations in biological processes by regulating the conformational switching between the duplex and quadruplexes structures of the guanine-rich or cytosine-rich oligonucleotides in vivo.     

Fold-back tetraplex DNA species in DNase I-resistant DNA isolated from HeLa cells

A DNase I-resistant DNA species has been isolated and purified from HeLa cells by gel electrophoresis. Our studies indicate that the DNase I-resistant DNA species was about 40-60 bp fragment sizes responding to double-strand DNA marker and has higher guanine content. The image of AFM showed that this species has been assumed to be tetraplex structure according to its apparent width and height. Its CD, UV spectrum also exhibited characteristics similar to some tetraplex structure, which was different from the standard duplex DNA. 32P-labeled probes (TTAGGG)4 and 5'-TGGGGAGGGTGGGGAGGGTGGGGAAGG-3' could be hybridized to purified DNase I-resistant species. All results suggest that the DNase I-resistant DNA species have at least two components, which adopt an intrastrand fold-back DNA tetraplex. Their sequences were similar to human telomere and human c-myc locus (NHE), respectively.     

The differences in the T2 relaxation rates of the protons in the partially-deuteriated and fully protonated sugar residues in a large oligo-DNA ('NMR-window') gives complementary structural information.

Selective incorporation of the stereospecifically deuteriated sugar moieties (> 97 atom % 2H enhancements at H2', H2', H3' and H5'/5' sites, approximately 85 atom % 2H enhancement at H4' and approximately 20 atom % 2H enhancement at H1') in DNA and RNA by the 'NMR-window' approach has been shown to solve the problem of the resonance overlap [refs. 1, 2 & 3]. Such specific deuterium labelling gives much improved resolution and sensitivity of the residual sugar proton (i.e. H1' or H4') vicinal to the deuteriated centers (ref. 3). The T2 relaxation time of the residual protons also increases considerably in the partially-deuteriated (shown by underline) sugar residues in dinucleotides [d(CpG), d(GpC), d(ApT), d(TpA)], trinucleotide r(A2'p5'A2'p5'A) and 20-mer DNA duplex 5'd(C1G2C3-G4C5G6C7G8A9A10T11T12C13G14C15G16C17G18C19G20)(2) 3'. The protons with shorter T2 can be filtered away using a number of different NMR experiments such as ROESY, MINSY or HAL. The NOE intensity of the cross-peaks in these experiments includes only straight pathway from H1' to aromatic proton (i-i and i-i + 1) without any spin-diffusion. The volumes of these NOE cross-peaks could be measured with high accuracy as their intensity is 3 to 4 times larger than the corresponding peaks in the fully protonated residues in the normal NOESY spectra. The structural informations thus obtainable from the residual protons in the partially-deuteriated part of the duplex and the fully protonated part in the 'NMR window' can indeed complement each other.     

Hybrid characteristics of oligonucleotides consisting of isonucleoside 2',5'-anhydro-3'-deoxy-3'-(thymin-1-yl)-D-mannitol with different linkage modes

Oligonucleotides consisting of the isonucleoside repeating unit 2',5'-anhydro-3'-deoxy-3'-(thymin-1-yl)-D-mannitol (4) were synthesized with the monomeric unit 4 incorporated into oligonucleotides as 1'-->4' linkage 4a (oligomer I) or 6'-->4' linkage 4b (oligomer II). The hybrid properties of the two oligonucleotides I and II with their complementary strands were investigated by thermal denaturation and CD spectra. Oligonucleotide I (4a) formed a stable duplex with d(A)(14) with a slightly reduced T(m) value of 36.6 degrees C, relative to 38.2 degrees C for the control duplex d(T)(14)/d(A)(14), but oligomer II (4b) failed to hybridize with a DNA complementary single strand. The spectrum of the duplex oligomer I/d(A)(14) showed a positive CD band at 217 nm and a negative CD band at 248 nm attributable to a B-like conformation. Molecular modeling showed that in the case of oligomer I: the C6' hydroxy group of each unit could be located in the groove area when hybridized to the DNA single strand, which might contribute additional hydrogen bonding to the stability of duplex formation.     

Unusual duplex formation in purine rich oligodeoxyribonucleotides

The purine rich oligodeoxyribonucleotides 1C, d(ATGACGGAATA) and 2C, d(ATGAGCGAATA) alone exhibit highly cooperative melting transitions. Analysis of the concentration dependence of melting, and electrophoretic studies indicate that these oligomers can form an unusual purine rich offset double helix. The unusual duplex is predicted to contain four A.T, two G.C, and four G.A mismatch base pairs as well as a single A base stacked on the 3' end of each chain of the helix. Other possible models for the duplex are unlikely because they are predicted to contain many base pairs of low stability. Changing the central sequence to CGG or GGG should destabilize the duplex and this is observed. The unusual duplex of 2C is more stable than the duplex of 1C indicating that the stability of G.A base pairs is quite sensitive to the surrounding sequence. Addition of 1C and 2C to their complementary pyrimidine strands results in normal duplexes of similar stability. We feel that the unusual duplexes are significantly stabilized by the intrinsic stacking tendency of purine bases.     

Photochemical deoxyribose C2' oxidation in 5-iodouracil-containing hexanucleotide.

To investigate photochemistry of 5-iodouracil (IU) in DNA, photoreaction of IU-containing oligonucleotides was examined. It was found that d(GCAIU G C) 2 undergoes selective photochemical C1' and C2' oxidation at the 5' side of IU residue to provide ribonolactone-containing hexamer 1 and erythrose-containing hexamer 2. Upon heating under alkaline conditions, erythrose-containing hexamer 2 was found to undergo retro aldol condensation to provide two fragments having glycolaldehyde termini.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Tetraplex Formation of d(GGGGGTTTTT): 1H NMR Study in Solution

Abstract

The oligonucleotide d(G₅T₅) can in principle form a fully matched duplex with G · T pairing and/or a tetraplex. Non-denaturing gel electrophoresis, circular dichroism and NMR experiments show that the tetraplex is exclusively formed by this oligomer in solution. In the presence of its complementary strand d(A₅C₅) at low temperature, d(G₅T₅) forms the tetraplex over the normally expected Watson-Crick duplex. However, when d(G₅T₅) and d(A₅C₅) are mixed together in equimolar amounts and heated for several minutes at 85°C, and then allowed to cool, the product was essentially the Watson-Crick duplex. The lack of resolution in the 500 MHz ¹H NMR spectra and the presence of extensive spin diffusion do not allow us to derive a quantitative structure for the tetraplex from the NMR data. However, we find good qualitative agreement between the NOESY and MINSY data and a theoretically derived stereochemically sound structure in which the G's and T's are part of a parallel tetraplex.     

Cytosine methylation in a CpG sequence leads to enhanced reactivity with Benzo[a]pyrene diol epoxide that correlates with a conformational change.

Benzo[a]pyrene (B[a]P) is a widespread environmental carcinogen that must be activated by cellular metabolism to a diol epoxide form (BPDE) before it reacts with DNA. It has recently been shown that BPDE preferentially modifies the guanine in methylated 5'-CpG-3' sequences in the human p53 gene, providing one explanation for why these sites are mutational hot spots. Using purified duplex oligonucleotides containing identical methylated and unmethylated CpG sequences, we show here that BPDE preferentially modified the guanine in hemimethylated or fully methylated CpG sequences, producing between 3- and 8-fold more modification at this site. Analysis of this reaction using shorter duplex oligonucleotides indicated that it was the level of the (+)-trans isomer that was specifically increased. To determine if there were conformational differences between the methylated and unmethylated B[a]P-modified DNA sequences that may be responsible for this enhanced reactivity, a native polyacrylamide gel electrophoresis analysis was carried out using DNA containing isomerically pure B[a]P-DNA adducts. These experiments showed that each adduct resulted in an altered gel mobility in duplex DNA but that only the presence of a (+)-trans isomer and a methylated C 5' to the adduct resulted in a significant gel mobility shift compared with the unmethylated case.     

A density functional theory study on the kinetics and thermodynamics of N-glycosidic bond cleavage in 5-substituted 2'-deoxycytidines

B3LYP/6-311+G(2d,p)//B3LYP/6-31+G(d) density functional theory calculations were employed to explore the kinetics and thermodynamics of gas-phase N-glycosidic bond cleavage induced by nucleophilic attack of C1' with a hydroxide ion in 5-substituted 2'-deoxycytidines. The results showed that, among the 5-substituted 2'-deoxycytidine derivatives examined [XdC, where X = H (dC), CH(3) (medC), CH(2)OH (hmdC), CHO (fmdC), COOH (cadC), F (FdC), or Br (BrdC)], fmdC and cadC exhibited the lowest energy barrier and largest exothermicity for N-glycosidic bond cleavage. These results paralleled previously reported nucleobase excision activities of human thymine DNA glycosylase (hTDG) toward duplex DNA substrates harboring a thymine and 5-substituted cytosine derivatives when paired with a guanine. Our study suggests that the inherent chemistry associated with the nucleophilic cleavage of N-glycosidic bond constitutes a major factor contributing to the selectivity of hTDG toward 5-substituted dC derivatives. These findings provided novel insights into the role of TDG in active cytosine demethylation.     

Mechanism of interstrand migration of organoruthenium anticancer complexes within a DNA duplex

Organometallic ruthenium(ii) anticancer complexes [(η(6)-arene)Ru(en)Cl][PF(6)] (e.g. arene = biphenyl (bip, 1), indane (ind, 2); en = ethylenediamine) bind to N7 of guanine (G) in DNA selectively. The fragment {(η(6)-bip)Ru(en)}(2+) (1') bound to N7 of one guanine residue at a 14-mer duplex DNA migrates readily to other guanine residues in both the same strand and the complementary strand when the strands are hybridized at elevated temperature. In this work, by applying HPLC coupled to mass spectrometry, the mechanism of such intra- and interstrand migration was investigated using a 15-mer duplex, in which one strand 5'-CTCTCTTG(8)TCTTCTC-3' (I) contained a single guanine (G(8)). The results show that the interstrand migration of complexes 1 and 2 within the duplex involves an SN1 pathway, firstly solvent-assisted dissociation of the initially G(8)-bound adducts I-G(8)-1' and I-G(8)-2' (2' = {(η(6)-ind)Ru(en)}(2+)) as the rate-controlling step, and secondly the coordination of the dissociated 1' and 2' to guanine bases (G(21) for 1', either G(21) or G(18) for 2') on strand II. The high temperature used to anneal the single strands was found to increase the migration rate. The formation of the duplex acts as a key driving force to promote the dissociation of G(8)-bound 1' and 2' due to the competition of cytosine in II with the en-NH(2) groups in 1' and 2' for H-bonding with C6O of guanine. Complex 2 (t(1/2) = 18 h) containing a mono-ringed arene ligand dissociates more readily from the initially binding site G(8) than complex 1 (t(1/2) = 23 h). The extended biphenyl arene ligand which is intercalated into DNA stabilizes the adduct I-G(8)-1'. These results provide new insight into this unusual metal migration, and are of significance for the design and development of more active organometallic ruthenium anticancer complexes.     

NMR evidence of the stabilisation by the carcinogen N-2-acetylaminofluorene of a frameshift mutagenesis intermediate.

Two heteroduplexes d(C1A2C3T4C5G6C7A8C9A10C11)-d (G12T13G14T15G16G17A18G19T20G21) containing a bulged guanine either unmodified or modified with the carcinogen N-2-acetylaminofluorene (AAF) have been studied by nuclear magnetic resonance (NMR) as models of slipped mutagenic intermediates (SMI). Conformational equilibria are observed in both the unmodified and the AAF-modified heteroduplexes. The major conformation of the unmodified duplex is one where the extra guanine is stacked in the helix and the major conformation of the AAF-modified heteroduplex is one where the AAF is external to the helix. Unusual sugar proton chemical shifts of C5- and G6-AAF indicate that the AAF ring is pointing out in the 5' direction. A strong increase in the modified heteroduplex melting temperature (+15 degrees C) is observed. Moreover, in contrast to the unmodified heteroduplex, which shows extensive melting in the vicinity of the bulged guanine, the base pairs around the bulge in the AAF-modified heteroduplex remain paired at temperatures up to 30 degrees C. This exceptional stability of the site around the bulged modified guanine is suggested to be responsible for the high rate of -1 mutation induced by AAF at repetitive sequences.