Studies of oligoadenylate formation on a poly(U) template

We have studied a variety of condensation reactions involving poly (U) as template and isomeric adenosine dinucleotides as substrates. We find that [3'-5']-linked dinucleotides such as A3pA and pA3pA are better acceptors than the corresponding [2'-5']-linked compounds, while ImpA2pA is a better donor than ImpA3pA. The reaction between A2pA and ImpA3pA, for example, yields only 4% of product while the reaction of A3pA with ImpA2pA yields 86% of product. The more efficient condensation reactions of dimers are about as efficient as the self-condensation of ImpA. They yield a few percent of material in which five or more substrate molecules are linked together. The percentage of the natural [3'-5']-linkage in the product varies greatly, from as little as 1% to as much as 45%.     

Efficient catalysis of polycytidylic acid-directed oligoguanylate formation by Pb2+

Pb²⁺ is a very effective catalyst for the template-directed self-condensation of guanosine 5′-phosphorimidazolide on a polycytidylate template. In the presence of 0.01 m-Pb²⁺ at 0 °C, up to 85% of the input ImpG ² is converted to a mixture of oligomers with a mean chain length of up to 17. Substantial amounts of material longer than (pG)₄₀ are formed. About half the ImpG reacts within an hour. The oligomeric products are predominantly (2′–5′)-linked.If poly(C) is incubated with ImpG and an equimolar quantity of the corresponding derivative of adenosine, uridine or cytidine, the “incorrect” nucleotide, is incorporated about 10% as often as G.     

Template-directed polymerization of oligoadenylates using cyanogen bromide

Cyanogen bromide (BrCN) condensed oligoadenylates [oligo(A)] on a poly(uridylic acid) [poly(U)] template in an aqueous solution. Imidazole and divalent metal ions such as Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Mg2+, and Fe2+ were required for the condensation. Chain length of oligo(A) and reaction temperature affected the coupling yield. Hexaadenylate [(pA)6] was converted to (pA)12, (pA)18, (pA)24, (pA)30, (pA)36, (pA)42, and (pA)48 in a 68% overall yield for 20 h at 25 degrees C. The coupling yield increased with increase in the poly(U) concentration. Five- to sevenfold molar excess of uridylyl residues of poly(U) to adenylyl residues of oligo(A) gave the best yield (68%). Metal ions affected the formation of linkage isomers of the phosphate bonds: The 2',5'- and 3',5'-phosphodiester bonds were predominant in the presence of Co2+, Zn2+, and Ni2+ and the 5',5'-pyrophosphate bond was predominant in the presence of Mn2+. In particular, Ni2+ gave the highest ratio of the 3',5'-phosphodiester bond (30%). N-Cyanoimidazole (1), N,N'-iminodiimidazole (2), and N-carboxamidoimidazole (3) were formed in a reaction of imidazole with BrCN in an aqueous solution. 1 and 2 had much the same condensing activity for the polymerization of adenylates as BrCN. A reaction pathway was proposed in which 1 and 2 are not only intermediates for the production of 3 but also the true condensing agent in the coupling reaction of oligo(A). Phosphorimidazolide derivative was detected in a reaction of 5'-AMP with either 1 or 2. The condensation would proceed by way of N-cyanoimidazole-phosphate adduct, the phosphorimidazolide derivative, or both.     

Non-enzymatic, template-directed ligation of 2'-5' oligoribonucleotides. Joining of a template and a ligator strand.

Decauridylate containing exclusively a 2'-5' phospho-diester bond ([2'-5']U10) served as a template for the synthesis of oligoadenylates [oligo(A)s] from the 5'-phosphorimidazolide of 2'-5' diadenylate (ImpA-2'p5'A). Joining of [2'-5']U10and ImpA2'p5'A also took place in substantial amounts to yield long-chain oligoribonucleotides in the template-directed reaction. An unusual CD spectrum ascribed to helix formation between [2'-5']U10and [2'-5'](pA)2was observed under the same conditions as that of the template-directed reaction. The 3'-5' linked decauridylate ([3'-5']U10) also promoted the template-directed synthesis of oligo(A)s from ImpA2'p5'A, but more slowly compared with [2'-5']U10. The results indicate that short-chain RNA oligomers with a 2'-5' phosphodiester bond could lead to longer oligoribonucleotides by template-directed chain elongation.     

Architecture of models for prebiotic synthesis of nucleic acids: template-directed synthesis of oligoguanylates using N-cyanoimidazole

N-Cyanoimidazole is an efficient condensing agent for the polymerization of guanosine 5'-phosphate (pG) on a poly(C) template in an aqueous solution. At 0 degree C, up to about 30% of input pG was converted to a mixture of oligomers with a mean chain length of up to 7. The effect of divalent metal ions in the polymerization of pG on a poly(C) template was not so considerable as in that of oligo(A) on a poly(U) template. In the polymerization of pG, the moderate yields were obtaind in the presence of Co2+, Ni2+ and Cu2+.     

Montmorillonite,Oligonucleotides, RNA and Origin of Life

Na-montmorillonite prepared from Volclay by the titration method facilitates the self-condensation of ImpA, the 5'-phosphorimidazolide derivative of adenosine. As was shown by AE-HPLC analysis and selective enzymatic hydrolysis of products, oligo(A)s formed in this reaction are 10 monomer units long and contain 67% 3',5'-phosphodiester bonds (Ferris and Ertem, 1992a). Under the same reaction conditions, 5'-phosphorimidazolide derivatives of cytidine, uridine and guanosine also undergo self-condensation producing oligomers containing up to 12-14 monomer units for oligo(C)s to 6 monomer units for oligo(G)s. In oligo(C)s and oligo(U)s, 75-80% of the monomers are linked by 2',5'-phosphodiester bonds. Hexamer and higher oligomers isolated from synthetic oligo(C)s formed by montmorillonite catalysis, which contain both 3',5'- and 2',5'-linkages, serve as catalysts for the non-enzymatic template directed synthesis of oligo(G)s from activated monomer 2-MeImpG, guanosine 5'-phospho-2-methylimidazolide (Ertem and Ferris, 1996). Pentamer and higher oligomers containing exclusively 2',5'-linkages, which were isolated from the synthetic oligo(C)s, also serve as templates and produce oligo(G)s with both 2',5'- and 3',5'-phosphodiester bonds. Kinetic studies on montmorillonite catalyzed elongation rates of oligomers using the computer program SIMFIT demonstrated that the rate constants for the formation of oligo(A)s increased in the order of 2-mer < 3-mer < 4-mer ... < 7-mer (Kawamura and Ferris, 1994). A decameric primer, dA(pdA)8pA bound to montmorillonite was elongated to contain up to 50 monomer units by daily addition of activated monomer ImpA to the reaction mixture (Ferris, Hill and Orgel, 1996). Analysis of dimer fractions formed in the montmorillonite catalyzed reaction of binary and quaternary mixtures of ImpA, ImpC, 2-MeImpG and ImpU suggested that only a limited number of oligomers could have formed on the primitive Earth rather than equal amounts of all possible isomers (Ertem and Ferris, 2000). Formation of phosphodiester bonds between mononucleotides by montmorillonite catalysis is a fascinating discovery, and a significant step forward in efforts to find out how the first RNA-like oligomers might have formed in the course of chemical evolution. However, as has been pointed out in several publications, these systems should be regarded as models rather than a literal representation of prebiotic chemistry (Orgel, 1998; Joyce and Orgel, 1999; Schwartz, 1999).     

Template controlled coupling and recombination of oligonucleotide blocks containing thiophosphoryl groups.

Oxidation of a pair of 3'- and 5'-thiophosphoryloligonucleotides in the presence of a complementary oligonucleotide template is shown to provide an effective means for selectively linking oligonucleotide blocks. Coupling proceeds rapidly and efficiently under mild conditions in dilute aqueous solutions (microM range for oligomers, 2-15 min at 0-4 degrees C with K3Fe(CN)6 or KI3 as oxidant). This chemistry was demonstrated by polymerization of a thymidylate decamer derivative (sTTTTTTTTTTs) in the presence of poly(dA) and by coupling oligomers possessing terminal thiophosphoryl groups (ACACCCAATTs + sCTGAAAATGG and ACACCCAATs + sCTGAAAATGG) in the presence of a template (CCATTTTCAGAATTGGGTGT). Efficient linking of 5' to 3' phosphoryl groups can be achieved under conditions where virtually no coupling takes place in absence of a template. A novel feature of the chemistry is that catalyzed recombinations of oligomers containing internal -OP(O)(O-)SSP(O)(O-)O- linkages can be directed by hydrogen bonding to a complementary oligonucleotide. Convenient procedures are reported for solid phase synthesis of the requisite oligonucleotide 3'- and 5'-phosphorothioates.     

Ultraviolet irradiation of nucleic acids: formation, purification, and solution conformational analyses of oligothymidylates containing cis-syn photodimers

Acetone-photosensitized UV irradiation of three thymine oligomers, d(TpT), d(TpTpT), and d(TpTpTpT), forms predominantly cis-syn cyclobutyl photodimers. C-18 reverse-phase high-performance liquid chromatography is used to purify the following positional isomers: d(TpT[p]T), d(T[p]TpT), d(TpTpT[p]T), d(TpT[p]TpT), d(T[p]TpTpT), and d(T[p]TpT[p]T), where T[p]T represents the cis-syn photodimer. Conformational properties of the cis-syn dimers and adjacent thymine nucleotides have been investigated in solution by using 1H, 13C, and 31P NMR spectroscopy. These studies show that (1) the photodimer conformation in longer oligothymidylates is similar to that in the dinucleoside monophosphate and (2) the cis-syn dimer induces alterations to a greater degree on the 5' side than on the 3' side of the photodimer. Specifically, the photodimer distorts the exocyclic bonds epsilon(C3'-O3') in Tp- and gamma(C5'-C4') in -pT[p]- on the 5' side and slightly alters the furanose equilibrium of the -pT nucleotide on the 3' side of the dimer.     

Template-directed synthesis on the oligonucleotide d(C7-G-C7)

When the deoxynucleotide template d(C7-G-C7) is incubated with the activated nucleotides 2-MeImpG and 2-MeImpC, a series of oligomers of G up to the sevenmer and a series of copolymers of composition GnC with n = 3 to 13 are formed. Oligomers GnC with n greater than 7 are completely degraded by pancreatic ribonuclease, establishing that they contain a 3' to 5' internucleotide bond between 5'-C and 3'-G within a sequence of the form (pG)ipC(pG)j. As expected, (pG)7-Cp and (pG)6-Cp are major hydrolysis products. Detailed analysis of the product distribution shows that a substantial fraction of the oligomeric products are of the type (pG)ipC(pG)j with i less than 7. This shows that product synthesis does not necessarily begin at the 3' terminus of the template. The significance of this finding in terms of the origin of molecular replication is discussed.     

Uranyl ion-catalyzed synthesis of several 8-substituted 2'-5'-oligoadenylates, and their properties

We have synthesized 2'-5' linked oligomers from 8-substituted adenosine-5'-phosphorimidazolides using uranyl ion catalyst. 8-amino derivative, as highly susceptible to hydrolysis, gave short chained oligomers in a low yield, while the rest of 8-substituted or unsubstituted derivatives gave the corresponding oligomers in high yields. Properties of 8-substituted 2'-5' oligomers were studied applying spectrometer and through enzymatic digestion.     

Template-directed synthesis of oligoadenylates catalyzed by Pb2+ ions

The Pb2+ ion is an effective catalyst for the template-directed condensation of ImpA on poly(U). This reaction generates up to 35% of oligomers 5 or more units long. Furthermore, the product is predominantly 3'-5'-linked (75%) unlike that from the uncatalyzed reaction which is more than 90% 2'-5'-linked. The significance of metal-ion catalysis for prebiotic polynucleotide formation is discussed.     

Mechanisms of degradation of 2′-5′ oligoadenylates

We have studied the mechanisms of breakdown of 2'-5' oligoadenylates. We monitored the time-courses of degradation of ppp(A2'p5')nA (dimer to tetramer) and of 5'OH-(A2'p5')nA (dimer to pentamer) in unfractionated L1210 cell extract. The 5' triphosphorylated 2'-5' oligoadenylates are converted by a phosphatase activity. However, 2'-5' oligoadenylates are degraded mainly by phosphodiesterase activity which splits the 2'-5' phosphodiester bond sequentially at the 2' end to yield 5' AMP and one-unit-shorter oligomers. The nonlinear least-squares curve-fitting program CONSAM was used to fit these kinetics and to determine the degradation rate constant of each oligomer. Trimers and tetramers, whether 5' triphosphorylated or not, are degraded at the same rate, whereas 5' triphosphorylated dimer is rapidly hydrolyzed and 5'-OH dimer is the most stable oligomer. The interaction between degradation enzymes and the substrate strongly depends on the presence of a 5' phosphate group in the vicinity of the phosphodiester bond to be hydrolyzed; indeed, when this 5' phosphate group is present, as in pp/pA2'p5'A/or A2'/p5'A2'p5'A/, affinity is high and maximal velocity is low. Such a degradation pattern can control the concentration of 2'-5' oligoadenylates active on RNAse L either by limiting their synthesis (5' triphosphorylated dimer is the primer necessary for the formation of longer oligomers) and/or by converting them into inhibitory (e.g., monophosphorylated trimer) or inactive (e.g., nonphosphorylated oligomers) molecules.     

Enzymatic analysis of isomeric trithymidylates containing ultraviolet light-induced cyclobutane pyrimidine dimers. II. Phosphorylation by phage T4 polynucleotide kinase

Phage T4 polynucleotide kinase (EC 2.7.1.78) proved incapable of catalyzing the phosphorylation of thymidylyl-(3'----5')-thymidine containing either a cis-syn-cyclobutane pyrimidine dimer (d-T less than p greater than T) or a 6-4'-[pyrimidin-2'-one]pyrimidine photoproduct (d-T[p]-T), and similarly the UV-modified compounds of (dT)3 bearing either photoproduct at their 5'-end (d-T less than p greater than TpT and d-T[p]TpT). In contrast, the 3'-structural isomers of these trinucleotides (d-TpT less than p greater than T and d-TpT[p]T) were phosphorylated at the same rate as the parent compound. These phosphorylatable lesion-containing oligonucleotides are quantitatively released from UV-irradiated poly(dA):poly(dT) by enzymatic hydrolysis with snake venom phosphodiesterase and alkaline phosphatase (Liuzzi, M., Weinfeld, M., and Paterson, M. C. (1989) J. Biol. Chem. 264, 6355-6363). By combining this digestion regimen with phosphorylation by polynucleotide kinase and [gamma-32P]ATP, pyrimidine dimers were quantitated at the fmol level following exposure of poly(dA):poly(dT) and herring sperm DNA to biologically relevant UV fluences. The rate of dimer induction in the synthetic polymer, approximately 10 dimers/10(6) nucleotides/Jm-2, was in close agreement with that obtained by conventional methods. Dimers were induced at one-fourth of this rate in the natural DNA. Further treatment of the phosphorylated oligonucleotides derived from irradiated herring sperm DNA with nuclease P1 released the labeled 5'-nucleotide, thus permitting analysis of the nearest-neighbor bases 5' to the lesions. We observed a ratio for pyrimidine-to-purine bases of almost 6:1, implicating tripyrimidine stretches as hotspots for UV-induced DNA damage.     

Catalysis of accurate poly(C)-directed synthesis of 3'-5'-linked oligoguanylates by Zn2+

Zn²⁺ is an efficient catalyst for the oligomerization of guanosine 5′-phosphorimidazolide on a polycytidylic acid template. Up to 75% of the input ImpG² is converted to oligomers with a mean chain length up to 10. Material longer than (pG)₃₀ can be detected. The oligomeric products are predominantly 3′-5′-linked.If poly(C) is incubated with ImpG and an equimolar quantity of the 5′-phosphorimidazolides of adenosine, uridine or cytidine, in the presence of Zn²⁺, ImpG is incorporated at least 200 times more efficiently than “incorrect” nucleotides.     

DIMERIZATION IN HIGHLY CONCENTRATED SOLUTIONS OF PHOSPHOIMIDAZOLIDE ACTIVATED MONONUCLEOTIDES

Phosphoimidazolide activated ribomononucleotides (*pN) are useful substrates for the non-enzymatic synthesis of polynucleotides. However, dilute neutral aqueous solutions of *pN typically yield small amounts of dimers and traces of polymers; most of *pN hydrolyzes to yield nucleoside 5-monophosphate. Here we report the self-condensation of nucleoside 5-phosphate 2-methylimidazolide (2-MeImpN with N = cytidine, uridine or guanosine) in the presence of Mg2+ in concentrated solutions, such as might have been found in an evaporating lagoon on prebiotic Earth. The product distribution indicates that oligomerization is favored at the expense of hydrolysis. At 1.0 M, 2-MeImpU and 2-MeImpC produce about 65% of oligomers including 4% of the 3,5-linked dimer. Examination of the product distribution of the three isomeric dimers in a self-condensation allows identification of reaction pathways that lead to dimer formation. Condensations in a concentrated mixture of all three nucleotides (U,C,G mixtures) is made possible by the enhanced solubility of 2-MeImpG in such mixtures. Although percent yield of internucleotide linked dimers is enhanced as a function of initial monomer concentration, pyrophosphate dimer yields remain practically unchanged at about 20% for 2-MeImpU, 16% for 2-MeImpC and 25% of the total pyrophosphate in the U,C,G mixtures. The efficiency by which oligomers are produced in these concentrated solutions makes the evaporating lagoon scenario a potentially interesting medium for the prebiotic synthesis of dimers and short RNAs.     

A simple and convenient synthesis of 3''-5''- or 2''-5''-linked oligoribonucleotide by polymerization of unprotected ribonucleoside using phosphorus tris-azole

Oligoribonucleotides have been synthesized directly from unprotected ribonucleosides by a chemical polymerization approach using phosphorus tris-azoles. The procedure involves two steps: (i) the reaction of unprotected ribonucleoside with phosphorus tris-azole and (ii) the in situ oxidation of the resulting phosphite with iodine and water. Several phosphorus tris-azoles were investigated for generating oligoribonucleotide chains. Phosphorus tris-azoles of which azoles are imidazole, 2-methylimidazole, and 2-ethyl-4-methylimidazole were found to be most effective. Uridine, adenosine, and cytidine oligonucleotides were obtained rapidly in high yields without any protection. The inter-ribonucleotidic linkage of the oligomers consists of 3'-5'- and 2'-5'-linkages. The linkage isomers were easily separated by a reverse phase column chromatography. The present approach provides a convenient and potentially useful method for preparing 3'-5'- or 2'-5'-linked oligoribonucleotides.     

New sequential-assignment routes of nucleic acid NMR signals using a [5'-(13)C]-labeled DNA dodecamer

NMR signal assignments for DNA oligomers have been performed by the well-established sequential assignment procedures based on NOESY and COSY. The H4'/H5'/H5' resonance region is congested and difficult to analyze without the use of isotope-labeled DNA oligomers. Here a DNA dodecamer constructed with 2'-deoxy[5'-(13)C]ribonucleotides, 5'-d(*C*G*C*G*A*A*T*T*C*G*CG)-3' (*N = [5'-(13)C]Nucleotide), was prepared in an effort to analyze the H4'/H5'/H5' resonance region by 2D 1H-13C HMQC-NOESY. In the C5' and H1' resonance region, weak and strong cross peaks for C5'(i)-H1'(i) and C5'(i)-H1'(i-1), respectively, were found, thus enabling the sequential assignment within this region. A similar sequential assignment route was found between C5' and H2'. Proton pair distances evaluated from the canonical B-DNA as well as A-DNA indicated that these sequential-assignment routes on a 2D 1H-13C HMQC-NOESY spectrum work for most nucleic acid stem regions.     

Identification of the site of cross-linking in 16S rRNA of an aromatic azide photoaffinity probe attached to the 5'-anticodon base of A site bound tRNA

The site of Escherichia coli 16S ribosomal RNA cross-linked to the 5'-anticodon base of A site bound E. coli valyl-tRNA was identified. Cross-linking was via the affinity probe 6-[(2-nitro-4-azidophenyl)amino]caproate (NAK) or 3-[[2-[(2-nitro-4-azidophenyl)amino]ethyl]dithio]propionate (SNAP) attached to the carboxyl group of the 5'-anticodon base 5-(carboxyethoxy)uridine via an ethylenediamine spacer [Gornicki, P., Ciesiolka, J., & Ofengand, J. (1985) Biochemistry (preceding paper in this issue)]. With both probes, RNase T1 digestion of the isolated 16S RNA-tRNA covalent complex, 5'-32P postlabeling, and gel electrophoresis yielded two oligonucleotides larger than any fragments from non-cross-linked tRNA or rRNA. Appearance of the oligomers was dependent on the presence of the probe on the tRNA. Unmodified tRNA in the A and/or P sites did not yield any product. The presence of elongation factor Tu in the incubation mixture was also required. Dithiothreitol (DDT) treatment of the SNAP-induced covalent complex prior to electrophoresis also abolished the oligomers. Only the larger of the two oligomers (present in a 3:1 ratio) was sequenced. The SNAP dimer was cleaved with DTT, and the rRNA and tRNA oligomers were separated and sequenced as monomers. The NAK dimer was sequenced without cleavage by taking advantage of the differences in electrophoretic mobility among sequence and/or composition isomers of the same length. In both cases, the rRNA oligomer was identified as UACACACCG1401, and the nucleotide cross-linked was shown to be the C1400 residue. The expected tRNA modification site was also identified.(ABSTRACT TRUNCATED AT 250 WORDS)     

Synthesis and template-directed polymerization of adenylyl(3'-5')adenosine cyclic 2', 3'-phosphate.

Adenylyl(3'-5')adenosine cyclic 2',3'-phosphate (A-A greater than p) was synthesized and its polymerization was attempted under various conditions inthe presence of poly(uridylic acid) and1,3-propanediamine. Reaction at -20 degrees C for 16 days gave polymerized products (up to the 8-mer) in 15% yield and was proved to be dependent on the template. Reaction at 0 degrees C for 16 days gave more extensive (up to the 10-mer) and more efficient (35%) polymerization. The newly formed phosphodiester linkage was exclusively 2'-5'. These results are discussed in comparison with the monomer-condensation reaction.     

Synthesis of oligoguanylates on oligocytidylate templates

Summary Short oligocytidylates can act as templates for the self-condensation of guanosine 5-phosphorimidazolide. In the absence of a catalytic metal ion or in the presence of Pb²⁺ a noticeable template effect is already observed with the dimer and the yield of long oligomers reaches a plateau with a hexamer template. Short templates give oligomers longers than the template length. The products are predominantly 2-5 linked for the Pb²⁺-catalyzed reaction while mixed linkages are observed in the uncatalyzed reaction.In the presence of Zn²⁺, a template effect is first observed with the pentamer and is maximal by the heptamer. The products are predominantly 3-5 linked. Oligomers shorter than or as long as the template are obtained in substantial yield, and longer products in much lower yields.Abbreviations G Guanosine - Gp guanosine 2(3)-phosphate - pG guanosine 5-phosphate - Gp! guanosine cyclic 2,3-phosphate - ImpG guanosine 5-phosphorimidazolide - ImpG^* [8-¹⁴C]-guanosine 5-phosphorimidazolide - pGp 5-phosphoguanosine 2(3)-phosphate - G²pG guanylyl-[2-5]-guanosine - G³pG guanylyl-[3-5]-guanosine - ImpGpG 5-phosphorimidazolide of GpG - (pG)_n (n = 2,3) oligomers of pG - GppG P₁, P₂-diguanosine 5-diphosphate - GppGpG 5-[guanosine 5-pyrophosphate] of GpG - NH₂pG guanosine 5-phosphoramidate - (pG)₄₊ tetramer and higher oligoguanylates with 5 terminal phosphate - oligo(G) oligoguanylate - Cp cytidine 2(3)-phosphate - Cp! cytidine cyclic 2,3-phosphate - (Cp)_n–1 Cp! (n= 2,3,4) oligocytidylates terminated by 5-OH groups and 2,3-cyclic phosphates - oligo(C) oligocytidylate - poly(C) polycytidylic acid - poly(U) polyuridylic acid - poly(C,G) random copolymer of C and G - BAP bacterial alkaline phosphatase (E. coli) - EDTA ethylenediaminetetraacetic acid - R_f chromatographic mobility