DNA of Epstein-Barr virus. IV. Linkage map of restriction enzyme fragments of the B95-8 and W91 strains of Epstein-Barr Virus.

The arrangement of EcoRI, Hsu I, and Sal I restriction enzyme sites in the DNA of the B95-8 and W91 isolates of Epstein-Barr virus (EBV) has been determined from the size of the single-enzyme-cleaved fragments and from blot hybridizations that identify which fragments cut from the DNA with one enzyme contain nucleotide sequences in common with fragments cut from the DNA with a second enzyme. The DNA of the B95-8 isolate was the prototype for this study. The data indicate that (i) approximately 95 X 10(6) to 100 X 10(6) daltons of EBV (B95-8) DNA is in a consistent and unique sequence arrangement. (ii) Both termini are variable in length. One end of the molecule after Hsu I endonuclease cleavage consists of approximately 3,000 base pairs, with as many as 10 additional 500-base pair segments. The opposite end of the molecule after Sal I endonuclease cleavage consists of approximately 1,500 base pairs, with as many as 10 additional 500-base pair segments. (iii) The opposite ends of the molecule contain homologous sequences. The high degree of homology between the opposite ends of the molecule and the similarity in size of the "additional" 500-base pair segments suggests that there are identical repeating units at both ends of the DNA. The arrangement of restriction endonuclease fragments of the DNA of the W91 isolate of EBV is similar to that of the B95-8 isolate and differs from the latter in the presence of approximately 7 X 10(6) daltons of "extra" DNA at a single site. Thus, the size of almost all EcoRI, Hsu I, and Sal I fragments of EBV (W91) DNA is identical to that of fragments of EBV (B95-8) DNA. A single EcoRI fragment, C, of EBV (W91) DNA is approximately 7 X 10(6) daltons larger than the corresponding EcoRI fragment of EBV (B95-8) DNA. Digestion of EBV (W91) DNA with Hsu I or Sal I restriction endonucleases produces two fragments (Hsu I D1 and D2 or Sal I G2 and G3) which differ in total size by approximately 7 X 10(6) daltons from the fragments of EBV (B95-8) DNA. Furthermore, the EcoRI, Hsu I, and Sal I fragments of EBV (W91) and (B95-8) DNAs, which are of similar molecular weight, have homologous nucleotide sequences. Moreover, the W91 fragments contain only sequences from a single region of the B95-8 genome. Two lines of evidence indicate that the "extra" sequences present in W91 EcoRI fragment C are viral DNA and not cellular. (i) The molecular weight of the "enlarged" EcoRI C fragment of EBV (W91) DNA is identical to that of the EcoRI C fragment of another isolate of EBV (Jijoye), (ii) The HR-1 clone of Jijoye has previously been shown to contain DNA which is not present in the B95-8 strain but is present in the EcoRI C and Hsu I D2 and D1 fragments of EBV (W91) DNA (N. Raab-Traub, R. Pritchett, and E. Kieff, J. Virol. 27:388-398, 1978).     

Silver staining of DNA restriction fragments for the ultrarapid identification of pseudorabies virus strains.

Restriction endonuclease analysis of pseudorabies virus DNA has been used to study various virus strains. To make use of a rapid technique for the identification of viral strains, studies have been undertaken to facilitate purification of the DNA from viral particles present in cytoplasmic fractions. The ultrasensitive photochemical silver staining of nucleic acid, described by Beidler et al. (Analytic Biochemistry 1982: 126) has been adapted and applied to the detection of pseudorabies virus restriction fragments. In a period of 5 h more than 1 microgram of DNA can be extracted from a 25 cm2 plastic flask containing infected cells and purified without ultra centrifugation. Low molecular weight DNA was separated from high molecular weight DNA by polyacrylamide gel electrophoresis. The restriction fragments were selectively visualized by silver staining which can detect 0.025 micrograms of total pseudorabies virus DNA. The electrophoretic DNA pattern of vaccine and wild strains has been studied using these techniques and the results agree with previously published data.     

Transformation by Epstein-Barr virus requires DNA sequences in the region of BamHI fragments Y and H.

Eight independent recombinant Epstein-Barr virus genomes, each of which was a transforming strain, were made by superinfecting cell lines containing Epstein-Barr virus DNA (Raji or B95-8 strain) with a nontransforming virus (P3HR1 strain). A knowledge of the constitution of each transforming recombinant allowed the localization of the defect in the genome of the nontransforming parent to a 12-megadalton sequence within the EcoRI A fragment. Within this region, the nontransforming virus has a deletion of the BamHI Y fragment and about half of the sequences in the adjacent BamHI H fragment. The present data suggest that this deletion is responsible for the nontransforming phenotype. Furthermore, mapping a deletion in one of the recombinant genomes allowed the conclusion that a sequence (comprising about 20% of the Epstein-Barr virus genome) from the center of BamHI-D to BamHI-I' is not necessary for the maintenance of transformation by Epstein-Barr virus.     

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

A method which facilitates the ordering of DNA restriction fragments

Summary The Southern transfer technique has been used to provide a generally applicable method for ordering DNA restriction fragments. It involves electrophoresis of partially digested DNA, transfer to nitrocellulose filter paper and annealing to a ³²P-labelled fragment. Only those partials containing that particular fragment will reanneal to the probe and produce bands on autoradiography. The size of each partial in the labelled set is the sum of the size of the fragment used as probe and of one or more adjacent fragments. Thus the size of the adjacent fragments can be determined from the size increments of this set of partials. The method is illustrated by the mapping of certain BamHI sites on coliphage 186 DNA.     

Interaction of the MvaI restriction enzyme with synthetic DNA fragments

The cleavage of synthetic DNA duplexes by the restriction endonuclease MvaI has been studied. The main result of the cleavage experiments is that MvaI cleaves unmodified duplexes in two single strand scissions in separate events and that the two strands are cleaved at significantly different rates. One strand nicks within the recognition site do not affect the cleavage. Furthermore, neither a pyrophosphate internucleotide bond modification in one strand nor the absence of one phosphate group at the central dA-residue of the recognition site do inhibit the cleavage of the second strand.     

Identification and nucleotide sequences of two similar tandem direct repeats in Epstein-Barr virus DNA

Epstein-Barr virus DNA is known to have partially homologous segments, designated DL and DR, near the left and right ends of the long unique region (Raab-Traub et al., Cell 22:257-267, 1980). DL and DR are each partially composed of tandem direct repeat sequences. DL contains 11 to 14 repeats of a 124-base-pair sequence designated IR2. DR contains approximately 30 direct repeats of a 103-base-pair sequence designated IR4. The DL and DR sequences have colinear partial homology for approximately 2.4 and 1.5 kilobase pairs to the right of IR2 and IR4, respectively. IR2 and IR4 are similar sequences and evolved in part from a common ancestor. Both sequences are 84% guanine and cytosine and have limited homology to Epstein-Barr virus IR1 and to the herpes simplex virus type 1 inverted terminal repeat "a" sequence. IR2 encodes part of an abundant 2.5-kilobase persistent early EBV RNA expressed in productively infected cells, but does not encode part of the 3-kilobase Epstein-Barr virus RNA which is transcribed from the adjacent IR1-U2 region of the Epstein-Barr virus genome in latently infected cells.     

Identification of cellular factors that bind specifically to the Epstein-Barr virus origin of DNA replication.

The specific binding of HeLa cell factors to DNA sequences at the Epstein-Barr virus (EBV) latent origin of DNA replication was detected by gel shift experiments and DNase I footprinting analysis. These cellular proteins protected at least five discrete regions of the DNA replication origin. The viral protein required for EBV plasmid replication, EBV nuclear antigen 1 (EBNA-1), binds to specific sequences within the origin region. The HeLa cell proteins competed with EBNA-1 for binding to EBV origin DNA in vitro, leading to the possibility that these cellular proteins regulate EBV DNA replication by displacing EBNA-1 at the origin sites.     

Terminal fragments of herpes simplex virus DNA produced by restriction endonuclease.

Digestion of HSV-1 DNA with λ 5′-exonuclease prior to digesting the DNA with the $\text{Eco R}$ I restriction endonuclease specifically affects two of the fragments normally obtained after restriction endonuclease digestion. Therefore these two fragments contain the sequences which occur at the termini of HSV-1 DNA. One of the fragments affected is a “minor” fragment which is always present in less than molar yield. The possible relationship between the occurrence of minor $\text{Eco R}$ I fragments and the partial refractoriness of HSV-1 DNA to λ 5′-exonuclease digestion is discussed.     

Repeating restriction fragments of human DNA.

Human DNA digested with Hae III showed multiple repeats of a 170 base pair fragment. The most prominent band was the 340 base pair dimer, estimated to be 0.8% of the entire genome. Eco R1 and Hha I yielded fragments with similar electrophoretic mobility to the Hae III dimer. In each case this band was markedly enriched in DNA reassociating at a 0t of less than or equal to 1. Hybridization of the Hae III dimer to gels eluted on to filters demonstrated that the multiple Hae III fragments and Eco R1 fragments contained compatible sequences. These sequences may comprise a distinct subclass of DNA.     

The presence of ovalbumin mRNA coding sequences in multiple restriction fragments of chicken DNA.

Chicken DNA has been digested with restriction enzymes and the size distribution of the DNA fragments containing ovalbumin specific sequences has been examined after separation of the fragments on agarose gels and transfer to nitrocellulose sheets. Hybridisation with terminally 32P-labelled ovalbumin mRNA fragments or with RNA populations transcribed from the DNA of a hybrid plasmid containing ovalbumin sequences was used to locate the DNA fragments coding for ovalbumin. Digestion with enzymes which do not cut within the portion of the ovalbumin gene synthesised from ovalbumin messenger RNA in vitro has shown the presence of several defined fragments carrying ovalbumin specific sequences. Possible explanations of these observations are discussed.     

Detection of specific sequences among DNA fragments separated by gel electrophoresis.

Ribosomal RNA and precursor ribosomal RNA from at least one representative of each vertebrate class have been analyzed by electron microscopic secondary structure mapping. Reproducible patterns of hairpin loops were found in both 28 S ribosomal and precursor ribosomal RNA, whereas almost all the 18 S ribosomal RNA molecules lack secondary structure under the spreading conditions used. The precursor ribosomal RNA of all species analyzed have a common design. The 28 S ribosomal RNA is located at or near the presumed 5′-end and is separated from the 18 S ribosomal RNA region by the internal spacer region. In addition there is an external spacer region at the 3′-end of all precursor ribosomal RNA molecules. Changes in the length of these spacer regions are mainly responsible for the increase in size of the precursor ribosomal RNA during vertebrate evolution. In cold blooded vertebrates the precursor contains two short spacer regions; in birds the precursor bears a long internal and a short external spacer region, and in mammals it has two long spacer regions. The molecular weights, as determined from the electron micrographs, are 2·6 to 2·8 × 10⁶ for the precursor ribosomal RNA of cold blooded vertebrates, 3·7 to 3·9 × 10⁶ for the precursor of birds, and 4·2 to 4·7 × 10⁶ for the mammalian precursor. Ribosomal RNA and precursor ribosomal RNA of mammals have a higher proportion of secondary structure loops when compared to lower vertebrates. This observation was confirmed by digesting ribosomal RNAs and precursor ribosomal RNAs with single-strandspecific S₁ nuclease in aqueous solution. Analysis of the double-stranded, S₁-resistant fragments indicates that there is a direct relationship between the hairpin loops seen in the electron microscope and secondary structure in aqueous solution.     

Restriction enzyme digests of rapidly renaturing fragments of vaccinia virus DNA.

Vaccinia virus DNA fragments that have been denatured by alkali and then neutralized contain a fraction that rapidly reforms duplex structures. The fraction is enriched by fractionating on hydroxyapatite columns and serves as as substrate for digestion by two restriction endonucleases isolated from Hemophilus parainfluenzae, Hpa I and HPa II. The patterns obtained by gel electrophoresis of the digested fragments show the presence of three major bands after Hpa I digestion and four major bands after Hpa II digestion. The DNA that is isolated from some of these bands quickly reforms duplex regions after alkaline denaturation. The size of the DNA segments in the major bands has been estimated to be in the range of 0.44 X 10(6) to 3.2 X 10(6) daltons. The fragments which rapidly reform duplex chains after denaturation are sensitive to single-strand-specific nucleases. These results are consistent with a model of vaccinia virus DNA which has a covalent link connecting complementary chains.     

Cleavage of Epstein-Barr virus DNA by restriction endonucleases EcoRI, HindIII and BamI.

The cleavage of the DNAs of the B95-8 and P3HR-1 virus strains of Epstein-Barr virus by the restriction endonucleases EcoRI, HindIII and BamI was investigated using a new technique for quantitative evaluation of the fluorescence of ethidium stained DNA fragments separated on agarose gels. The results obtained with B95-8 DNA showed that in addition to the limited repetitions of nucleotide sequences observed in the EcoRI and HindIII cleavage patterns, the molecule contained a BamI fragment with a molecular mass of 2.0 megadaltons which was present in a total of about 11 copies and localized to a limited part of the DNA molecule. The same sequences were also present in the P3HR-1 DNA albeit in a lower molar ratio. P3HR-1 DNA yielded restriction enzyme cleavage patterns suggesting DNA sequence heterogeneity of P3HR-1 virus. No fragment was present in more than about 4 copies per molecule of P3HR-1 DNA. Comparison of the restriction enzyme cleavage patterns of P3HR-1 and B95-8 DNA revealed a high degree of structural homology emphasized by nucleic acid hybridization experiments with EBV complementary RNA synthesized in vitro.     

Molecular cloning of the complete Epstein-Barr virus genome as a set of overlapping restriction endonuclease fragments.

A complete collection of fragments of Epstein-Barr virus DNA, obtained by cleavage with restriction endonuclease Eco RI, has been cloned. Fourteen different internal fragments of the virus genome, derived from linear virion DNA of the B95-8 strain, and sequences corresponding to the terminal regions of virion DNA, derived from intracellular circular EBV DNA isolated from 895-8 cells, were cloned. Sizes of fragments were determined by agarose gel electrophoresis and their sum leads to an estimated molecular weight of 110 x 10(6) for virion DNA. Large Eco RI DNA fragments of special interest were also cloned in cosmids using another source of EBV DNA, that is, to circular viral DNA derived from Raji cells. In order to provide a set of overlapping sequences, all the 29 internal Bam HI fragments of B95-8 virion DNA were cloned in pBR322. The map location within the viral genome of each cloned DNA fragment was identified by hybridizing to blots of virion DNA cleaved with several different restriction endonucleases.     

Identification of the DNA sequences encoding the large subunit of the mRNA-capping enzyme of vaccinia virus.

The DNA sequences encoding the large subunit of the mRNA-capping enzyme of vaccinia virus were located on the viral genome. The formation of an enzyme-guanylate covalent intermediate labeled with [alpha-32P]GTP allowed the identification of the large subunit of the capping enzyme and was used to monitor the appearance of the enzyme during the infectious cycle. This assay confirmed that after vaccinia infection, a novel 84,000-molecular-weight polypeptide corresponding to the large subunit was rapidly synthesized before viral DNA replication. Hybrid-selected cell-free translation of early viral mRNA established that vaccinia virus encoded a polypeptide identical in molecular weight with the 32P-labeled 84,000-molecular-weight polypeptide found in vaccinia virions. Like the authentic capping enzyme, this virus-encoded cell-free translation product bound specifically to DNA-cellulose. A comparison of the partial proteolytic digestion fragments generated by V8 protease, chymotrypsin, and trypsin demonstrated that the 32P-labeled large subunit and the [35S]methionine-labeled cell-free translation product were identical. The mRNA encoding the large subunit of the capping enzyme was located 3.1 kilobase pairs to the left of the HindIII D restriction fragment of the vaccinia genome. Furthermore, the mRNA was determined to be 3.0 kilobases in size, and its 5' and 3' termini were precisely located by S1 nuclease analysis.     

Structure of Marek's disease virus DNA: detailed restriction enzyme map.

Purified virion DNA (120 X 10(6) molecular weight [MW]) of Marek's disease virus strain GA was cleaved with BamHI restriction endonuclease, and 27 out of the 29 fragments were cloned into bacterial plasmids. Restriction maps for BamHI, BglI, and SmaI endonucleases were constructed. The genomic structure of Marek's disease virus DNA was found to be similar to that of herpes simplex virus types 1 and 2. A long unique region (75 X 10(6) MW, located at 10 X 10(6) to 85 X 10(6) MW [10-85] from the left end of the genome), which was subdivided into segment 1 (22 X 10(6) MW, located at 10-32) and segment 2 (51 X 10(6) MW, located at 34-85) by direct repeats (32-34), was flanked by a long terminal region (10 X 10(6) MW, located at 0-10) and a long inverted region (10 X 10(6) MW, located at 85-95). A short unique region (8 X 10(6) MW, located at 103-111) was flanked by a short terminal region (8 X 10(6) MW, located at 111-119) and a short inverted region (8 X 10(6) MW, located at 95-103). The direct repeat fragments (0.9 X 10(6) could be isolated by cleavage with SmaI. The right terminal end was found to be heterogenous .