Co(II) derivatives of Cu,Zn-superoxide dismutase with the cobalt bound in the place of copper. A new spectroscopic tool for the study of the active site

Co(II) derivatives of Cu,Zn-superoxide dismutase having cobalt substituted for the copper (Co,Zn-superoxide dismutase and Co,Co-superoxide dismutase) were studied by optical and EPR spectroscopy. EPR and electronic absorption spectra of Co,Zn-superoxide dismutase are sensitive to solvent perturbation, and in particular to the presence of phosphate. This behaviour suggests that cobalt in Co,Zn-superoxide dismutase is open to solvent access, at variance with the Co(II) of the Cu,Co-superoxide dismutase, which is substituted for the Zn. Phosphate binding as monitored by optical titration is dependent on pH with an apparent pKa = 8.2. The absorption spectrum of Co,Zn-superoxide dismutase in water has three weak bands in the visible region (epsilon = 75 M-1 X cm-1 at 456 nm; epsilon = 90 M-1 X cm-1 at 520 nm; epsilon = 70 M-1 X cm-1 at 600 nm) and three bands in the near infrared region, at 790 nm (epsilon = 18 M-1 X cm-1), 916 nm (epsilon = 27 M-1 X cm-1) and 1045 nm (epsilon = 25 M-1 X cm-1). This spectrum is indicative of five-coordinate geometry. In the presence of phosphate, three bands are still present in the visible region but they have higher intensity (epsilon = 225 M-1 X cm-1 at 544 nm; epsilon = 315 M-1 X cm-1 at 575 nm; epsilon = 330 M-1 X cm-1 at 603 nm), whilst the lowest wavelength band in the near infrared region is at much lower energy, 1060 nm (epsilon = 44 M-1 X cm-1). The latter property suggests a tetrahedral coordination around the Co(II) centre. Addition of 1 equivalent of CN- gives rise to a stable Co(II) low-spin intermediate, which is characterized by an EPR spectrum with a highly rhombic line shape. Formation of this CN- complex was found to require more cyanide equivalents in the case of the phosphate adduct, suggesting that binding of phosphate may inhibit binding of other anions. Titration of the Co,Co-derivative with CN- provided evidence for magnetic interaction between the two metal centres. These results substantiate the contention that Co(II) can replace the copper of Cu,Zn-superoxide dismutase in a way that reproduces the properties of the native copper-binding site.     

Characterization of indo-1 and quin-2 as spectroscopic probes for Zn2(+)-protein interactions

1-[2-Amino-5-(6-carboxyindol-2-yl)phenoxyl]-2-(2'- amino-5'-methylphenoxy)ethane-N,N,N',N'-tetraacetic acid (indo-1) and 2-[2-(bis(carboxymethyl)amino-5-methylphenoxy) methyl]-6- methyl-8-[bis-(carboxymethyl)amino]quinoline (quin-2) are sensitive, spectral indicators for Zn2+. Additions of subsaturating Zn2+ to 10-80 microM indo-1 or quin-2 at pH 7.0 produce uv difference spectra with isosbestic wavelengths at 342 and 282 nm or at 342, 317, and 252 nm, respectively. Formation of 1:1 Zn2+:indicator complexes at pH 7.0 and 20 degrees C in the absence (presence) of 100 mM KCl gives delta epsilon max = -2.4 +/- 0.2 X 10(4) M-1 cm-1 at 367 nm (-2.1 +/- 0.2 X 10(4) M-1 cm-1 at 365 nm) for indo-1 and delta epsilon max = -2.7 +/- 0.1 X 10(4) M-1 cm-1 at 266 nm (-2.6 +/- 0.1 X 10(4) M-1 cm-1 at 265 nm) for quin-2. Competition experiments at pH 7.0 and 20 degrees C with indo-1 and quin-2 and also 4-(2-pyridylazo)resorcinol (PAR) as the second chelator in the absence (presence) of 100 mM KCl yield apparent affinity constants: K'A = 2.5 +/- 1.0 X 10(10) M-1 (6.2 +/- 0.5 X 10(9) M-1) for indo-1 binding Zn2+ and K'A = 9.4 +/- 3.3 X 10(11) M-1 (2.7 +/- 0.1 X 10(11) M-1) for quin-2 binding Zn2+. The above constants provide the basis for rapid steady-state spectrophotometric determinations of the affinity of a protein for Zn2+ with K'A approximately 10(10) - 10(13) M-1.(ABSTRACT TRUNCATED AT 250 WORDS)     

Electronic spectroscopy of cobalt angiotensin converting enzyme and its inhibitor complexes

Zinc, the catalytically essential metal of angiotensin converting enzyme (ACE), has been replaced by cobalt(II) to give an active, chromophoric enzyme that is spectroscopically responsive to inhibitor binding. Visible absorption spectroscopy and magnetic circular dichroic spectropolarimetry have been used to characterize the catalytic metal binding site in both the cobalt enzyme and in several enzyme-inhibitor complexes. The visible absorption spectrum of cobalt ACE exhibits a single broad maximum (525 nm) of relatively low absorptivity (epsilon = 75 M-1 cm-1). In contrast, the spectra of enzyme-inhibitor complexes display more clearly defined maxima at longer wavelengths (525-637 nm) and of markedly higher absorptivities (130-560 M-1 cm-1). The large spectral response indicates that changes in the cobalt ion coordination sphere occur on inhibitor binding. Magnetic circular dichroic spectropolarimetry has shown that the metal coordination geometry in the inhibitor complexes is tetrahedral and of higher symmetry than in cobalt ACE alone. The presence of sulfur----cobalt charge-transfer bands in both the visible absorption and magnetic circular dichroic spectra of the cobalt ACE-Captopril complex confirm direct ligation of the thiol group of the inhibitor to the active-site metal.     

Azide-binding studies reveal type 3 copper heterogeneity in ascorbate oxidase from the green zucchini squash (Cucurbita pepo).

Titration of native ascorbate oxidase from green zucchini squash (Cucurbita pepo) with azide in 0.1 M-phosphate buffer, pH 6.8, exhibits a biphasic spectral behaviour. Binding of the anion with 'high affinity' (K greater than 5000 M-1) produces a broad increase of absorption in the 400-500 nm region (delta epsilon approximately 1000 M-1.cm-1) and c.d. activity in the 300-450 nm region, whereas azide binding with 'low affinity' (K approximately 100 M-1) is characterized by an intense absorption band at 420 nm (delta epsilon = 6000 M-1.cm-1), corresponding to negative c.d. activity and a decrease of absorption at 330 nm (delta epsilon = -2000 M-1.cm-1). The high-affinity binding involves a minor fraction of the protein containing Type 3 copper in the reduced state, and the spectral features of this azide adduct can be eliminated by treatment of the native enzyme with small amounts of H2O2, followed by dialysis before azide addition. As shown by e.s.r. spectroscopy, Type 2 copper is involved in both types of binding, its signal being converted into that of a species with small hyperfine splitting constant [12 mT (approximately 120 G)] in the case of the low-affinity azide adduct. The spectral similarities of the two types of azide adducts with the corresponding adducts formed by native laccase, which also exhibits Type 3 copper heterogeneity, are discussed.     

Romanowsky dyes and Romanowsky-Giemsa effect. 2. Eosin Y, erythrosin B, tetrachlorofluorescein, spectroscopic characterization of pure dyes, association of eosin Y

Analytically pure samples of the Romanowsky dyes eosin y, erythrosin b and tetrachlorofluorescein are prepared. DC of the dye samples shows no contaminations. We measured the absorption spectra of the dye dianions in alkaline aqueous solution and of the dye acids in 95% ethanol at very low dye concentrations. The molar extinction coefficients of the long wavelength absorption of the monomeric dye species are determined (Table 1). The extinction coefficients may be used for standardisation of dye samples. The absorption spectra of eosin y in aqueous solution are dependent on concentration. Using a new very sensitive method it was possible to identify two association equilibria from the concentration dependency of the spectra. Dimers are formed even in very dilute solutions, at higher concentrations tetramers. The dissociation constant of the dimers D in monomers M at 293 K, pH = 12, is K21 = 2,9 X 10(-5) M; of the tetramers Q in dimers D K42 = 2,4 X 10(-3) M. From the experimental spectra of eosin solutions at various concentrations, pH = 12, and the equilibrium constants K21, K42 the absorption spectra of the pure monomers, dimers and tetramers are calculated. M has one long wavelength absorption band, VM = 19300 cm-1, epsilon M = 1,03 X 10(5) M-1 cm-1; D also one absorption band, VD = 19300 cm-1, epsilon D = 1,74 X 10(5) M-1 cm-1; Q two absorption bands, VQ1 = 19100, VQ2 = 20200 cm-1, epsilon Q1 = 1,65 X 10(5), epsilon Q2 = 1,96 X 10(5) M-1 cm-1. The absorption spectrum of the dimers is discussed by quantum mechanics.     

Interaction of the Escherichia coli trp aporepressor with its ligand, L-tryptophan

We have examined the interaction of the Escherichia coli trp aporepressor with its ligand, L-tryptophan, using both equilibrium dialysis and flow dialysis methods. Results obtained by the two procedures were equivalent and indicate that the trp aporepressor binds L-tryptophan with an equilibrium dissociation constant (Kd) of 40 microM at 25 degrees C under standard binding assay conditions (10 mM potassium phosphate, pH 7.4, 0.2 M potassium chloride, 0.1 mM EDTA, 5% glycerol). Molecular sizing of the purified trp aporepressor shows that in the absence of ligand the regulatory protein exists as a dimeric species with greater than 99% purity and an apparent molecular weight of 30,000. Under the storage and assay conditions used, the dimer appears quite stable, and essentially no monomer or higher multimeric species are detected. Analysis of binding data by Scatchard and direct linear plot methods shows two identical and independent ligand-binding sites/native trp aporepressor dimer. When examined as a function of temperature, L-tryptophan binding by trp aporepressor varied over 7-fold (Kd = 28 microM at 6.5 degrees C to Kd = 217 microM at 40 degrees C). At the optimal growth temperature for E. coli (37 degrees C), the dissociation constant was 160 microM for the ligand, L-tryptophan. From the relationship between temperature and L-tryptophan binding by trp aporepressor, the apparent enthalpy change delta H = -10.6 +/- 0.6 kcal mol-1 and the apparent entropy change delta S = -17 +/- 2 cal degree-1 mol-1 were determined.     

p10 single-stranded nucleic acid binding protein from murine leukemia virus binds metal ions via the peptide sequence Cys26-X2-Cys29-X4-His34-X4-Cys39

The RNA binding protein of 56 residues encoded by the extreme 3' region of the gag gene of Rauscher murine leukemia virus (MuLV) has been chemically synthesized by a solid-phase synthesis approach. Since the peptide contains a Cys26-X2-Cys29-X4-His34-X2-Cys39 sequence that is shared by all retroviral gag polyproteins which has been proposed to be a metal binding region, it was of considerable interest to examine the metal binding properties of the complete p10 protein. As postulated, p10 binds the metal ions Cd(II), Co(II), and Zn(II). The Co(II) protein shows a set of d-d absorption bands typical of a tetrahedral Co(II) complex at 695 (epsilon = 565 M-1 cm-1), 642 (epsilon = 655 M-1 cm-1), and 615 nm (epsilon = 510 M-1 cm-1) and two intense bands at 349 (epsilon = 2460 M-1 cm-1) and 314 nm (epsilon = 4240 M-1 cm-1) typical of Co(II)----(-)S- charge transfer. The ultraviolet absorption spectrum also indicates Cd(II) binding by the appearance of a Cd(II)----(-)S- charge-transfer band at 255 nm. The 113Cd NMR spectrum of 113Cd(II)-p10 reveals one signal at delta = 648 ppm. This chemical shift correlates well with that predicted for ligation of 113Cd(II) to three -S- from the three Cys residues of p10. The chemical shift of 113Cd(II)-p10 changes by only 4 ppm upon binding of d(pA)6, indicating that the chelate complex is little changed by oligonucleotide binding.(ABSTRACT TRUNCATED AT 250 WORDS)     

Determination of the enzymatic activity of lysine amidase

A technique is proposed for determining lysinamidase and aminolactamase activities of lysinamidase (EC 3.5.1.n.). It is based on spectrophotometric measurement of the optical density decrease of the substrate solution at 227 nm. For cyclic lysinamide L-alpha-amino-epsilon-caprolactam epsilon 227 M = 151 M-1.cm-1, for linear lysinamide epsilon 227 M = 73 M-1.cm-1, and for lysine epsilon 227 M = 5 M-1.cm-1. The technique is simple and requires no additional reagents.     

Spectrophotometric titration of tyrosyl residues in alkaline mesentericopeptidase.

At pH 7.0 the alkaline mesentericopeptidase has ultraviolet absorption spectrum with a minimum at 251 nm and a maximum at 280 nm and no visible absorption. From the tyrosine to tryptophan ratio a value of 3 tryptophyl residues per mole of protein is obtained. The molar extinction coefficient at 280 nm is 3.55 X 10(4)M-1cm-1. Spectrophotometric titration studies show that the molecule of mesentericopeptidase contains seven phenolic groups with a pKapp - 9.92 and four to five groups with a pKapp = 11.96. Denaturing agents, such as 5 M guanidine hydrochloride or alkali, normalize the ionization of the tyrosyl residues. There is a good correlation between the spectrophotometric titration data and the results for the reactivities of the tyrosines in mesentericopeptidase towards tetranitromethane. The correlation is explained by the mechanism of nitration. Conclusions about the state of the tyrosyl residues and the three-dimensional structure of mesentericopeptidase are made.     

Exciton chirality in trans-1,2-diamidocyclohexanes: fluorescent chromophores

N,N'-Carbonyl-bridged dipyrrinones constitute a new class of highly fluorescent chromophores suitable for investigations of stereochemistry and absolute configuration. Xanthoglow (N,N'-carbonylxanthobilirubic acid) diamides of trans-1,2-diaminocyclohexane are strongly fluorescent (phiF=0.37, lambdaem=500 nm, lambdaex=419 nm in CHCl3) but exhibit only weak exciton circular dichroism (CD). In contrast, the diamide of (1R,2R)-diaminocyclohexane from the xanthoglow analogue whose propionic acid has been replaced by benzoic acid (N,N'-carbonyl-8-(4-carboxyphenyl)-3-ethyl-2,7,9-trimethyl-(10H)-dipyrrin-1-one) exhibits even stronger fluorescence (phiF=0.62, lambdaem=495 nm, lambdaex=422 nm in CHCl3) and UV-visible absorption (epsilon=41,600 dm3.mol-1.cm-1 at 424 nm) in organic solvents. Its exciton CD (Deltaepsilon=-13 dm3.mol-1.cm-1, lambda=432 nm; Deltaepsilon=+2 dm3.mol-1.cm-1, lambda=382 nm) correlates with the exciton chirality rule.     

Romanowsky dyes and romanowsky-Giemsa effect. 1. Azure B, purity and content of dye samples, association (author's transl)

Azure B is the most important Romanowsky dye. In combination with eosin Y it produces the well known Romanowsky-Giemsa staining pattern on the cell. Usually commercial azure B is strongly contaminated. We prepared a sample of azure B-BF4 which was analytically pure and had no coloured impurities. The substance was used to redetermine the molar extinction coefficient epsilon (v)M of monomeric azur B in alcoholic solution. In the maximum of the long wavelength absorption at v = 15.61 kK (lambda = 641 nm) the absorptivity is epsilon (15.61)M = (9.40 +/- 0.15) x 10(4)M-1 cm-1. This extinction coefficient may be used for standardization of dye samples. In aqeuous solution azur B forms dimers and even higher polymers with increasing concentration. The dissociation constant of the dimers, K = 2,2 x 10(-4)M (293 K), and the absorption spectra of pure monomers and dimers in water have been calculated from the concentration dependence of the spectra using an iterative procedure. The molar extinction coefficient of the monomers at 15.47 kK (646 nm) is epsilon (15.47)M = 7.4 x 10(4)M-1 cm-1. The dimers have two long wavelength absorption bands at 14.60 and 16.80 kK (685 and 595 nm) with very different intensities 2 x 10(4) and 13.5 x 10(4)M-1 cm-1. The spectrum of the dimers in aqueous solution is in agreement with theoretical considerations of F?rster (1946) and Levinson et al. (1957). It agrees with an antiparallel orientation of the molecules in the dimers. It may be that dimers bound to a substrate in the cell have another geometry than dimers in solution. In this case the weak long wavelength absorption of the dimers can increase.     

13C-n.m.r. study of citrate metabolism in rabbit renal proximal-tubule cells.

U.v.-visible-absorption and e.p.r. spectroscopy were used to study the type 2 and type 3 copper centres in the mercury derivative of laccase. After treatment with peroxide the mercury derivative of laccase exhibits a fully developed absorption band at 330 nm (delta epsilon = 2900 +/- 100 M-1.cm-1, which is characteristic of type 3 copper in the oxidized state. In addition, there is a weak ligand-field absorption at 740 nm (epsilon = 380 +/- 30 M-1.cm-1), which can be assigned to the type 3 pair. Because the e.p.r. spectrum of the type 2 copper is well resolved in the case of the mercury derivative of laccase, for the first time we have been able to observe spectroscopic evidence for a pH-dependent structural transition that has been invoked to explain the kinetics of enzyme reduction [Andréasson & Reinhammar (1979) Biochim. Biophys. Acta 568, 145-156]. According to the e.p.r. data the pKa lies in the range 6-7, and comparisons with a model compound show that the spectral changes can plausibly be interpreted in terms of the deprotonation of a water molecule in the co-ordination sphere of the type 2 copper.     

Juvenile-hormone-binding protein from the hemolymph of Galleria mellonella (L). Isolation and characterization

A juvenile-hormone-binding protein (JHBP) has been isolated from Galleria mellonella hemolymph by gel filtration, phosphocellulose chromatography, and by chromatofocusing. The isolated protein is homogeneous as judged by column chromatography and gel electrophoresis in the presence and absence of denaturing agent. It has a relative molecular mass of 32,000, Stokes radius 2.4 nm, sedimentation coefficient of 2.3 S, molar absorption coefficient at 280 nm epsilon = 2.34 X 10(4) M-1 cm-1, and is composed of a single polypeptide chain. Chromatofocusing analysis (pI 8.6) and isoelectric focusing (pI 8.1) indicate that the JHBP is an alkaline protein. Its amino acid composition and fluorescence absorption spectra indicate that the protein does not contain tryptophan residues. The protein exhibits one class of binding sites for juvenile hormone (JH), 0.8 per molecule, with the following dissociation constants: JH I, 8.5 X 10(-8) M; JH II, 7.2 X 10(-8) M; JH III, 47 X 10(-8) M. The JHBP binds (10R, 11S)-JH II enantiomer with 2.3-times higher affinity then (10S, 11R)-JH II enantiomer. The pH optimum of binding is 7.0.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

Intrinsic tryptophan fluorescence of Schizosaccharomyces pombe mitochondrial F1-ATPase. A powerful probe for phosphate and nucleotide interactions

Mitochondrial F1 from the yeast Schizosaccharomyces pombe, in contrast to the mammalian enzyme, exhibits a characteristic intrinsic tryptophan fluorescence with a maximal excitation at 291 nm and a maximal emission at 332 nm. Low values of Stern-Volmer quenching constants, 4.0 M-1 or 1.8 M-1, respectively, in the presence of either acrylamide or iodide, indicate that tryptophans are mainly buried inside the native enzyme. Upon subunit dissociation and unfolding by 6 M guanidine hydrochloride (Gdn.HCl), the maximal emission is shifted to 354 nm, a value very similar to that obtained with N-acetyltryptophanamide, a solute-tryptophan model compound. The tryptophan content of each isolated subunit has been estimated by fluorescence titration in the presence of Gdn.HCl with free tryptophan as a standard. Two tryptophans and one tryptophan are found respectively in the alpha and epsilon subunits, whereas none is detected in the beta, gamma, and delta subunits. These subunit contents are consistent with the total of seven tryptophans estimated for native F1 with alpha 3 beta 3 gamma 1 delta 1 epsilon 1 stoichiometry. The maximal emission of the isolated epsilon subunit is markedly blue-shifted to 310-312 nm by interaction with the isolated delta subunit, which suggests that the epsilon subunit tryptophan might be a very minor contributor to the native F1 fluorescence measured at 332 nm. This fluorescence is very sensitive to phosphate, which produces a marked blue shift indicative of tryptophans in a more hydrophobic environment. On the other hand, ADP and ATP quench the maximal emission at 332 nm, lower tryptophan accessibility to acrylamide, and reveal tryptophan heterogeneity.     

The acceptor quinone complex of Rhodopseudomonas viridis reaction centers

The acceptor complex of isolated reaction centers from Rhodopseudomonas viridis contains both menaquinone and ubiquinone. In a series of flashes the ubiquinone was observed to undergo binary oscillations in the formation and disappearance of a semiquinone, indicative of secondary acceptor (QB) activity. The oscillating signal, Q-B, was typical of a ubisemiquinone anion with a peak at 450 nm (delta epsilon = 6 mM-1 X cm-1) and a shoulder at 430 nm. Weak electrochromic bandshifts in the infrared were also evident. The spectrum of the reduced primary acceptor (Q-A) exhibited a major peak at 412 nm (delta epsilon = 10 mM-1 X cm-1) consistent with the assignment of menaquinone as QA. The Q-A spectrum also had minor peaks at 385 and 455 nm in the blue region. The same spectrum was recorded after quantitative removal of the secondary acceptor, when only menaquinone was present in the reaction centers. Spectral features in the near-infrared due to Q-A were attributed to electrochromic effects on bacteriochlorophyll (BChl) b and bacteriopheophytin (BPh) b pigments resulting in a distinctive split peak at 810 and 830 nm (delta epsilon = 8 mM-1 X cm-1). The menaquinone was identified as 2-methyl-3-nonylisoprenyl-1,4-naphthoquinone (menaquinone-9). The native QA activity was uniquely provided by this menaquinone and ubiquinone was not involved. QB activity, on the other hand, displayed at least a 40-fold preference for ubiquinone (Q-10) as compared to menaquinone. Thus, both quinone-binding sites display remarkable specificity for their respective quinones. In the absence of donors to P+, charge recombination of the P+Q-A and P+Q-B pairs had half-times of 1.1 +/- 0.2 and 110 +/- 20 ms, respectively, at pH 9.0, indicating an electron-transfer equilibrium constant (Kapp2) of at least 100 for Q-AQB in equilibrium QAQ-B. Also observed was a slow recombination of the cytochrome c-558+ Q-A pair, with t 1/2 = 2 +/- 0.5 s at pH 6.     

Unique,pH-dependent biphasic band shape of the visible circular dichroism of curcumin-serum albumin complex

Interaction between the plant derived polyphenolic type curcumin molecule having anticarcinogenic, antiinflammatory, and antioxidant activities, and human serum albumin was studied at different pH values by circular dichroism (CD) and electronic absorption spectroscopy. The weak, induced CD spectrum of curcumin-HSA complex measured at pH 7.4 in the visible spectral region shows striking changes upon alkalization; CD spectra collected between pH 7.7 and 9.3 exhibit characteristic, oppositely signed CD band pair according to the visible absorption band of HSA-bound curcumin. At 0.3 curcumin/HSA molar ratio, typical molar CD values are Delta epsilon (496.6nm)+40M(-1)cm(-1) and Delta epsilon (426.8nm)-40M(-1)cm(-1), respectively (pH 9.0, t=37 degrees C). The induced optical activity is attributed to a bent, right-handed chiral conformation of the HSA-bound curcumin molecule within which intramolecular exciton coupling occurs between the electric dipole transition moments of the dissymmetrically juxtaposed feruloyl chromophores. Deprotonation of phenolic OH group(s) of curcumin seems to be the reason leading to the conformational alteration of HSA-bound curcumin.     

Proton nuclear magnetic resonance studies on the kinetics of tryptic fragments of calmodulin upon calcium binding

The kinetics of the Ca2+-dependent conformational change of the tryptic fragments F12 (residues 1-75) and F34 (residues 78-148) of calmodulin were studied by 1H-NMR. Resonances of two phenylalanines, 16 (or 19) and 65 (or 68), N epsilon, N epsilon, N epsilon-trimethyllysine-115 and tyrosine-138 were examined by the saturation-transfer technique or computer-aided line-shape simulation to obtain the rate of the conformational exchange between the Ca2+-free form and the Ca2+-bound form. The rates for F12 and F34 in the presence of 0.2 M KCl at 22 degrees C were 300-500 s-1 and 3-10 s-1, respectively. Activation parameters are as follows: Delta H not equal to = 11(+/- 2) kcal X M-1 and delta S not equal to = -9(+/- 5) cal X K-1 X M-1 for F12, and delta H not equal to = 16(+/- 2) kcal X M-1 and delta S not equal to = -2(+/- 5) cal X K-1 X M-1 for F34. These kinetic data for the conformational exchange are in agreement with those of Ca2+ dissociation from the binding sites obtained by 43Ca-NMR and stopped-flow fluorescence studies.     

A four-iron, four-sulfide ferredoxin with high thermostability from Clostridium thermoaceticum.

A ferredoxin containing only one [Fe4S4] cluster was purified from Clostridium thermoaceticum. It has a molecular weight of about 7,300, a partial specific volume of 0.67, and an isoelectric point of 3.25. Its absorption spectrum has two maxima at 390 nm (epsilon = 16.8 X 10(3)M-1cm-1) and at 280 nm (epsilon = 24.2 X 10(3)M-1cm-1). The absorption at 390 nm is almost half that of other clostridial ferredoxins, which have two [Fe4S4] clusters, and is similar to other ferredoxins with only one [Fe4S4] cluster. The ferredoxin had high thermal stability and retained over 50% of its activity after treatment at 80 degrees C. It functions in the transfer of electrons from pyruvate to nicotinamide adenine dinucleotide phosphate (NADP), which indicates the presence of pyruvate:ferredoxin oxidoreductase and reduced ferredoxin-NADP reductase in C, thermoaceticum. NADPH is used in the synthesis of acetate from CO2 in this organism.     

Action mechanism of Escherichia coli DNA photolyase. III. Photolysis of the enzyme-substrate complex and the absolute action spectrum

The absolute action spectrum of Escherichia coli DNA photolyase was determined in vitro. In vivo the photoreactivation cross-section (epsilon phi) is 2.4 X 10(4) M-1 cm-1 suggesting that the quantum yield (phi) is about 1.0 if one assumes that the enzyme has the same spectral properties (e.g. epsilon 384 = 1.8 X 10(4) M-1 cm-1) in vivo as those of the enzyme purified to homogeneity. The relative action spectrum of the pure enzyme (blue enzyme that contains FAD neutral semiquinone radical) agrees with the relative action spectrum for photoreactivation of E. coli, having lambda max = 384 nm. However, the absolute action spectrum of the blue enzyme yields a photoreactivation cross-section (epsilon phi = 1.2 X 10(3) at 384 nm) that is 20-fold lower than the in vivo values indicative of an apparent lower quantum yield (phi approximately equal to 0.07) in vitro. Reducing the enzyme with dithionite results in reduction of the flavin semiquinone and a concomitant 12-15-fold increase in the quantum yield. These results suggest that the flavin cofactor of the enzyme is fully reduced in vivo and that, upon absorption of a single photon in the 300-500 nm range, the photolyase chromophore (which consists of reduced FAD plus the second chromophore) donates an electron to the pyrimidine dimer causing its reversal to two pyrimidines. The reduced chromophore is regenerated at the end of the photochemical step thus enabling the enzyme to act catalytically.+