Testing water-mediated DNA recognition by the Hin recombinase

The Hin recombinase specifically recognizes its DNA-binding site by means of both major and minor groove interactions. A previous X-ray structure, together with new structures of the Hin DNA-binding domain bound to a recombination half-site that were solved as part of the present study, have revealed that two ordered water molecules are present within the major groove interface. In this report, we test the importance of these waters directly by X-ray crystal structure analysis of complexes with four mutant DNA sequences. These structures, combined with their Hin-binding properties, provide strong support for the critical importance of one of the intermediate waters. A lesser but demonstrable role is ascribed to the second water molecule. The mutant structures also illustrate the prominent roles of thymine methyls both in stabilizing intermediate waters and in interfering with water or amino acid side chain interactions with DNA.     

Effects of dimer interface mutations in Hin recombinase on DNA binding and recombination

Previous biochemical assays and a structural model of the protein have indicated that the dimer interface of the Hin recombinase is composed of two alpha-helices. To elucidate the structure and function of the helix, amino acids at the N-terminal end of the helix, where the two helices make their most extensive contact, were randomized, and inversion-incompetent mutants were selected. To investigate why the mutants lost their inversion activities, the DNA binding, hix pairing, invertasome formation, and DNA cleavage activities were assayed using in vivo and in vitro methodologies. The results indicated that the mutants could be divided into four classes based on their DNA binding activity. We propose that the alpha-helices might serve to place a DNA binding motif of Hin in the correct spatial relationship to the minor groove of the recombination site. All the mutants except those that failed to bind DNA were able to perform hix pairing and invertasome formation, suggesting that the dimer interface is not involved in either of these processes. The inversion-incompetent phenotype of the binders was caused by the inability of mutants to perform DNA cleavage. The mutants that showed less binding ability than the wild type nevertheless exhibited a wild-type level of hix pairing activity, because the hix pairing activity overcomes the defect in DNA binding. This phenotype of the mutants that are impaired in DNA binding suggests that the binding domains of Hin may mediate Hin-Hin interaction during hix pairing.     

The effects of symmetrical recombination site hixC on Hin recombinase function.

An artificial recombination site hixC composed of two identical half-sites that bind the Hin recombinase served as a better operator in vivo than the wild type site hixL (Hughes, K. T., Youderian, P., and Simon, M. I (1988) Genes & Dev. 2, 937-948). In vitro binding assays such as gel retardation assay and methylation protection assay demonstrated that Hin binds to hixC as tightly as it binds to hixL, even when the sites are located in negatively supercoiled plasmids. However, hixC served as a poor recombination site when it was subjected to the standard inversion assay in vitro. hixC showed a 16-fold slower inversion rate than the wild type. A series of biochemical assays designed to probe different stages of the Hin-mediated inversion reaction, demonstrated that Hin dimers bound to hixC have difficulty in forming paired hix site intermediates. KMnO4 and S1 nuclease assays detected an anomalous structure of the center of hixC only when the site was in negatively supercoiled plasmids. Mutational analysis in the central region of hixC and assays of paired hix site formation with topoisomers of the hixC substrate plasmid suggested that Hin is not able to pair hixC sites because of the presence of the anomalous structure in the center of the site. The structure does not behave like a DNA "cruciform" since Hin dimers still bind efficiently to the site. It is thought to consist of a short denatured "bubble" encompassing 2 base pairs. During the study of mutations in the center of hixC, it was found that Hin is not able to cleave DNA if a guanine residue is one of the two central nucleotides close to the cleavage site. Furthermore, Hin acts in a concerted fashion and cannot cleave any DNA strand if one of the four strands in the inversion intermediate is not cleavable.     

Importance of minor-groove contacts for recognition of DNA by the binding domain of Hin recombinase

Incorporation of the DNA-cleaving moiety EDTA.Fe at discrete amino acid residues along a DNA-binding protein allows the positions of these residues relative to DNA bases, and hence the organization of the folded protein, to be mapped by high-resolution gel electrophoresis. A 52-residue protein, based on the sequence-specific DNA-binding domain of Hin recombinase (139-190), with EDTA at the NH2 terminus cleaves DNA at Hin recombination sites. The cleavage data for EDTA-Hin(139-190) reveal that the NH2 terminus of Hin(139-190) is bound in the minor groove of DNA near the symmetry axis of Hin-binding sites [Sluka, J. P., Horvath, S. J., Bruist, M. F., Simon, M. I., & Dervan, P. B. (1987) Science 238, 1129]. Six proteins, varying in length from 49 to 60 residues and corresponding to the DNA-binding domain of Hin recombinase, were synthesized by solid-phase methods: Hin(142-190), Hin(141-190), Hin(140-190), Hin(139-190), Hin(135-190), and Hin(131-190) were prepared with and without EDTA at the NH2 termini in order to test the relative importance of the residues Gly139-Arg140-Pro141-Arg142, located near the minor groove, for sequence-specific recognition at five imperfectly conserved 12-base-pair binding sites. Footprinting and affinity cleaving reveal that deletion of Gly139 results in a protein with affinity and specificity similar to those of Hin(139-190) but that deletion of Gly139-Arg140 affords a protein with altered affinities and sequence specificities for the five binding sites. It appears that Arg140 in the DNA-binding domain of Hin is important for recognition of the 5'-AAA-3' sequence in the minor groove of DNA. Our results indicate modular DNA and protein interactions with two adjacent DNA sites (major and minor grooves, respectively) bound on the same face of the helix by two separate parts of the protein.     

Sequence-specific interaction of the Salmonella Hin recombinase in both major and minor grooves of DNA.

The Hin recombinase of Salmonella catalyzes a site-specific recombination event which leads to flagellar phase variation. Starting with a fully symmetrical recombination site, hixC, a set of 40 recombination sites which vary by pairs of single base substitutions was constructed. This set was incorporated into the Salmonella-specific bacteriophage P22 based challenge phage selection and used to define the DNA sequence determinants for the binding of Hin to DNA in vivo. The critical sequence-specific contacts between a Hin monomer and a 13 bp hix half-site are at two T:A base pairs in the major groove of the DNA which are separated by one base pair, and two consecutive A:T contacts in the minor groove. The base substitutions in the major groove recognition portion which were defective in binding Hin still retained residual binding capability in vivo, while the base pair substitutions affecting the minor groove recognition region lost all in vivo binding. Using in vitro binding assays, Hin was found to bind to hix symmetrical sites with A:T base pairs or I:C base pairs in the minor groove recognition sequences, but not to G:C base pairs. In separate in vitro binding assays, Hin was equally defective in binding to either a G:C or a I:C contact in a major groove recognition sequence. Results from in vitro binding assays to hix sites in which 3-deazaadenine was substituted for adenine are consistent with Hin making a specific contact to either the N3 of adenine or O2 of thymine in the minor groove within the hix recombination site on each symmetric half-site. These results taken with the results of previous studies on the DNA binding domain of Hin suggest a sequence-specific minor groove DNA binding motif.     

Role of arginine-43 and arginine-69 of the Hin recombinase catalytic domain in the binding of Hin to the hix DNA recombination sites

The Hin recombinase mediates the site-specific inversion of a segment of the Salmonella chromosome between two flanking 26 bp hix DNA recombination sites. Mutations in two amino acid residues, R43 and R69 of the catalytic domain of the Hin recombinase, were identified that can compensate for loss of binding resulting from elimination of certain major and minor groove contacts within the hix recombination sites. With one exception, the R43 and R69 mutants were also able to bind a hix sequence with an additional 4 bp added to the centre of the site, unlike wild-type Hin. Purified Hin mutants R43H and R69C had both partial cleavage and inversion activities in vitro while mutants R43L, R43C, R69S, and R69P had no detectable cleavage and inversion activities. These data support a model in which the catalytic domain plays a role in DNA-binding specificity, and suggest that the arginine residues at positions 43 and 69 function to position the Hin recombinase on the DNA for a step in the recombination reaction which occurs either at and/or prior to DNA cleavage.     

Induced DNA recombination by Cre recombinase protein transduction

Cre is a DNA recombinase that recognizes 34 base-pair loxP sites of recombination. We have developed a cell-permeable Cre recombinase, TATCre, that is capable of mediating deletion of loxP-flanked targets by simply adding TATCre to cell cultures. Thus, TATCre allows efficient induced DNA recombination without the use of a Cre recombinase transgene or any other genetic material and should prove useful for the genetic manipulation of a wide variety of cell types that have been engineered to possess loxP sites.     

Fate of DNA lesions that elicit sister-chromatid exchanges

Using 3-way differential staining (TWD) of sister chromatids, the fate of DNA lesions involved in sister-chromatid exchange (SCE) formation was determined in murine bone marrow cells in vivo, after treatment with either mitomycin C (MMC) or cyclophosphamide (CP). Both MMC (2.6 mg/kg b.w.) and CP (7 mg/kg b.w.) induced an SCE frequency near the expected in the 2 subsequent cell divisions, but the frequency of SCE occurring at the same locus in successive cell divisions was substantially lower than expected. The results are compared with previous data obtained after exposure to gamma-rays. A model of SCE induction is proposed.     

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.     

Architecture of the hin synaptic complex during recombination: the recombinase subunits translocate with the DNA strands

Most site-specific recombinases can be grouped into two mechanistically distinct families. Whereas tyrosine recombinases exchange DNA strands through a Holliday intermediate, serine recombinases such as Hin generate double-strand breaks in each recombining partner. Here, site-directed protein crosslinking is used to elucidate the configuration of protein subunits and DNA within the Hin synaptic complex and to follow the movement of protein subunits during DNA strand exchange. Our results show that the protein interface mediating synapsis is localized to a region within the catalytic domains, thereby positioning the DNA strands on the outside of the Hin tetrameric complex. Unexpected crosslinks between residues within the dimerization helices provide evidence for a conformational change that accompanies DNA cleavage. We demonstrate that the Hin subunits, which are linked to the cleaved DNA ends by serine-phosphodiester bonds, translocate between synapsed dimers to exchange the DNA strands.     

DNA swivel enzyme activity in a nuclear membrane fraction.

DNA swivel (nicking-rejoining) enzyme activity has been studied in various cell fractions of a human lymphoid cell line. Swivel activity is found only in chromatin and in a nuclear membrane fraction containing DNA and possessing endogenous DNA synthesizing activity. Twenty percent of the total swivel activity and less than one percent of the total DNA are in the membrane fraction. The swivel enzyme is more tightly bound to the membrane fraction than to the chromatin fraction. These observations suggest that the swivel enzyme may be a replication factor, specifically bound to replicating DNA in the membrane fraction.     

The ShuS protein of Shigella dysenteriae is a heme-sequestering protein that also binds DNA

The ability of Shigella dysenteriae to utilize heme as an iron source is dependent on the iron-regulated expression of a number of genes including the outermembrane receptor ShuA and the cytoplasmic protein ShuS. The ShuS protein has no sequence homology with any proteins of known function and its role in heme acquisition has not been determined. In this paper we describe the purification and characterization of ShuS. The soluble oligomeric protein (650 kDa) is composed of a single type of subunit with a molecular mass of 37 kDa and binds one heme per monomer (Kd = 13 microM). In addition, the ShuS protein was shown to nonspecifically bind double-stranded DNA. It appears, therefore, that ShuS may function as both a heme storage protein, during periods of active heme transport, and as a DNA binding protein to protect the DNA from any ensuing heme mediated oxidative damage.     

Growth arrest and DNA damage-inducible protein GADD34 assembles a novel signaling complex containing protein phosphatase 1 and inhibitor 1

The growth arrest and DNA damage-inducible protein, GADD34, was identified by its interaction with human inhibitor 1 (I-1), a protein kinase A (PKA)-activated inhibitor of type 1 protein serine/threonine phosphatase (PP1), in a yeast two-hybrid screen of a human brain cDNA library. Recombinant GADD34 (amino acids 233 to 674) bound both PKA-phosphorylated and unphosphorylated I-1(1-171). Serial truncations mapped the C terminus of I-1 (amino acids 142 to 171) as essential for GADD34 binding. In contrast, PKA phosphorylation was required for PP1 binding and inhibition by the N-terminal I-1(1-80) fragment. Pulldowns of GADD34 proteins expressed in HEK293T cells showed that I-1 bound the central domain of GADD34 (amino acids 180 to 483). By comparison, affinity isolation of cellular GADD34/PP1 complexes showed that PP1 bound near the C terminus of GADD34 (amino acids 483 to 619), a region that shows sequence homology with the virulence factors ICP34.5 of herpes simplex virus and NL-S of avian sarcoma virus. While GADD34 inhibited PP1-catalyzed dephosphorylation of phosphorylase a, the GADD34-bound PP1 was an active eIF-2alpha phosphatase. In brain extracts from active ground squirrels, GADD34 bound both I-1 and PP1 and eIF-2alpha was largely dephosphorylated. In contrast, the I-1/GADD34 and PP1/GADD34 interactions were disrupted in brain from hibernating animals, in which eIF-2alpha was highly phosphorylated at serine-51 and protein synthesis was inhibited. These studies suggested that modification of the I-1/GADD34/PP1 signaling complex regulates the initiation of protein translation in mammalian tissues.     

A novel nucleic acid-binding protein that interacts with human rad51 recombinase.

Using the yeast two-hybrid system, we isolated a cDNA encoding a novel human protein, named Pir51, that strongly interacts with human Rad51 recombinase. Analysis in vitro confirmed the interaction between Rad51 and Pir51. Pir51 mRNA is expressed in a number of human organs, most notably in testis, thymus, colon and small intestine. The Pir51 gene locus was mapped to chromosome 12p13.1-13. 2 by fluorescence in situ hybridization. The Pir51 protein was expressed in Escherichia coli and purified to near homogeneity. Biochemical analysis shows that the Pir51 protein binds both single- and double-stranded DNA, and is capable of aggregating DNA. The protein also binds RNA. The Pir51 protein may represent a new member of the multiprotein complexes postulated to carry out homologous recombination and DNA repair in mammalian cells.     

The Escherichia coli colibactin resistance protein ClbS is a novel DNA binding protein that protects DNA from nucleolytic degradation

Cells employ specific and nonspecific mechanisms to protect their genome integrity against exogenous and endogenous factors. The clbS gene is part of the polyketide synthase machinery (pks genomic island) encoding colibactin, a genotoxin implicated in promoting colorectal cancer. The pks is found among the Enterobacteriaceae, in particular Escherichia coli strains of the B2 phylogenetic group. Several resistance mechanisms protect toxin producers against toxicity of their products. ClbS, a cyclopropane hydrolase, was shown to confer colibactin resistance by opening its electrophilic cyclopropane ring. Here we report that ClbS sustained viability and enabled growth also of E. coli expressing another genotoxin, the Usp nuclease. The recA::gfp reporter system showed that ClbS protects against Usp induced DNA damage. To elucidate the mechanism of ClbS mediated protection, we studied the DNA binding ability of the ClbS protein. We show that ClbS directly interacts with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), whereas ssDNA seems to be the preferred substrate. Thus, the ClbS DNA-binding characteristics may serve bacteria to protect their genomes against DNA degradation.     

Adenovirus DNA replication in vitro: a protein linked to the 5' end of nascent DNA strands.

Soluble nuclear extracts prepared from adenovirus-infected HeLa cells supported adenovirus DNA replication with exogenous DNA-protein complex as template, but protease-treated, phenol-extracted DNA was less active. Replication was enhanced when creatine phosphate and creatine phosphokinase were included in the reaction mixture, rendering the reaction independent of exogenous ATP. Genomic-length, newly synthesized DNA strands were first observed 30 min after initiation of replication and continued to increase in amount for at least 4 h. Thus, the rate of replication is consistent with previous estimates of the rate of replication in vivo. Nascent DNA strands bound to benzoylated, naphthoylated DEAE-cellulose due to their association with protein. The 5' termini of nascent DNA strands were resistant to the 5'- to 3'-specific T7 exonuclease, and the 3' termini of nascent strands were sensitive to the 3'- to 5'-specific exonuclease III. These results suggest that a protein becomes covalently linked to the 5' termini of nascent DNA strands replicated in vitro. Nuclear extracts prepared from adenovirus type 2-infected cells also supported replication of DNA-protein complex prepared from the unrelated type 7 adenovirus. The limited sequence homology between these two viruses at the origin of replication further defines recognition sequences at the origin. These results are discussed in terms of a model for adenovirus DNA replication in which the terminal protein and sequences within the inverted terminal repetition are involved in the formation of an initiation complex that is able to prime DNA replication.     

Kinetic modeling of the recA protein promoted renaturation of complementary DNA strands

Quantitative agarose gel assays reveal that the recA protein promoted renaturation of complementary DNA strands (phi X DNA) proceeds in two stages. The first stage results in the formation of unit-length duplex DNA as well as a distribution of other products ("initial products"). In the second stage, the initial products are converted to complex multipaired DNA structures ("network DNA"). In the presence of ATP, the initial products are formed within 2 min and are then rapidly converted to network DNA. In the absence of ATP, the initial products are formed nearly as fast as with ATP present, but they are converted to network DNA at a much lower rate. The time-dependent formation of initial products and network DNA from complementary single strands for both the ATP-stimulated and ATP-independent reactions can be modeled by using a simple two-step sequential kinetic scheme. This model indicates that the primary effect of ATP in the recA protein promoted renaturation reaction is not on the initial pairing step (which leads to the formation of initial products) but rather is to increase the rate at which subsequent pairing events can occur.     

Ligation activity of FLP recombinase. The strand ligation activity of a site-specific recombinase using an activated DNA substrate.

The FLP protein of the 2-microns plasmid of yeast belongs to the integrase family of site-specific recombinases whose members form a covalent bond between a conserved tyrosine of the recombinase and the 3'-phosphoryl group at the site of cleavage. We have made an activated DNA substrate and have shown that FLP can promote efficient strand ligation without forming a covalent intermediate with the DNA substrate. The strand ligation activity of FLP is independent of its ability to cleave DNA. Since site-specific recombinases are members of the larger class of topoisomerases, these findings may be generally applicable to other members of this class of enzymes.