Cloning and sequencing of the maltohexaose-producing amylase gene of Klebsiella pneumoniae

The molecular characterization of the maltohexaose-producing amylase gene of Klebsiella pneumoniae revealed an open reading frame in which 2,031 base pairs encode a protein of 677 amino acids with a calculated molecular weight of 75,921. The amylase gene had high similarities of 73.6% in DNA sequence and 79.3% in deduced amino acid sequence with the periplasmic alpha-amylase MalS gene of Escherichia coli.     

Nucleotide sequence of the G6-amylase gene from alkalophilic Bacillus sp. H-167

The nucleotide sequence of the G6-amylase gene from alkalophilic Bacillus sp. H-167 was determined. The open reading frame of the gene consisted of 2865 base pairs, encoding 955 amino acids. The NH2-terminal amino acid sequence analysis of the G6-amylase indicated that the enzyme had a single peptide of 33 amino acid residues and the mature enzyme was composed of 922 amino acids, giving a molecular mass of 102,598. Identity of the NH2-terminal amino acid sequences among each component of the multiform G6-amylase suggested the proteolytic processing of the COOH-terminal side of the enzyme. The DNA sequence and the deduced amino acid sequence of the G6-amylase gene showed no homology with those of other bacterial alpha-amylases although the consensus amino acid sequences of the active center were well conserved.     

Nucleotide sequence of the murE gene of Escherichia coli

The nucleotide sequence of the murE gene encoding the diaminopimelic acid adding enzyme of Escherichia coli is reported. The coding region consisted of 1413 base pairs and was separated from the ftsI (penicillin-binding protein 3) gene by 61 base pairs. The deduced primary structure of MurE comprised 471 amino acid residues with a molecular mass of 50.6 kilodaltons.     

Complete nucleotide sequence of a thermophilic alpha-amylase gene: homology between prokaryotic and eukaryotic alpha-amylases at the active sites

The nucleotide sequence of a thermophilic, liquefying alpha-amylase gene cloned from B. stearothermophilus was determined. The NH2-terminal amino acid sequence analysis of the B. stearothermophilus alpha-amylase confirmed that the reading frame of the gene consisted of 1,644 base pairs (548 amino acids). The B. stearothermophilus alpha-amylase had a signal sequence of 34 amino acids, which was cleaved at exactly the same site in E. coli. The mature enzyme contained two cysteine residues, which might play an important role in maintenance of a stable protein conformation. Comparison of the amino acid sequence inferred from the B. stearothermophilus alpha-amylase gene with those inferred from other bacterial liquefying alpha-amylase genes and with the amino acid sequences of eukaryotic alpha-amylases showed three homologous sequences in the enzymatically functional regions.     

Molecular cloning, characterization, and nucleotide sequence of an extracellular amylase gene from Aeromonas hydrophila.

The structural gene for excreted amylase from Aeromonas hydrophila JMP636 has been cloned within a 2.1-kilobase SmaI fragment of DNA. The amylase gene is transcribed from its own promoter in Escherichia coli, producing a gene product of Mr 49,000. The amylase gene product is secreted to the periplasm of E. coli; however, it is not excreted. Nucleotide sequencing revealed an open reading frame of 1,392 base pairs corresponding to a protein of 464 amino acid residues. A potential signal peptide of 21 amino acid residues is present at the NH2 terminal of the predicted protein. Three regions of homology with other procaryotic and eucaryotic alpha-amylases were detected within the predicted amino acid sequence.     

Escherichia coli exonuclease VII. Cloning and sequencing of the gene encoding the large subunit (xseA)

We have determined the sequence of the gene encoding the large subunit of Escherichia coli exonuclease VII (xseA) and the amino acid sequence of the protein it encodes. The coding region of the xseA gene is 1368 base pairs. The protein encoded by the gene contains 456 amino acids and has a calculated molecular weight of 51,823. The promoter for xseA is close to that for guaB, and these two genes are transcribed in opposite directions: xseA clockwise and guaB counterclockwise on the standard E. coli genetic map. The cloned xseA gene can complement an xseA deletion mutant strain. In an xseA+ genetic background production of large quantities of the xseA gene product appeared to decrease the amount of exonuclease VII activity in cell extracts. In fact, no exonuclease VII activity at all could be detected following induction of strains in which the xseA gene was under lambda pL regulation. These observations suggest that the proper ratio of the large and small exonuclease VII subunits must be maintained in order to produce active enzyme.     

alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases

The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

The aman6 gene encoding a yeast mannan backbone degrading 1,6-alpha-D-mannanase in Bacillus circulans: cloning, sequence analysis, and expression

A gene (aman6) encoding endo-1,6-alpha-D-mannanase, a yeast mannan backbone degrading enzyme from Bacillus circulans was cloned. The putative aman6 was 1,767 base pairs long and encoded a mature 1,6-alpha-D-mannanase protein of 589 amino acids and a signal peptide of 36 amino acids. The purified mature 1,6-alpha-D-mannanase from the Escherichia coli transformant showed 61-kDa protein, and N-terminal amino acid sequence and other general properties of the recombinant enzyme were identical to those of 1,6-alpha-D-mannanase from Bacillus circulans TN-31.     

Alkaline phosphatase from the Antarctic strain TAB5. Properties and psychrophilic adaptations.

The gene encoding alkaline phosphatase (AP) from the psychrophilic strain TAB5 was cloned, and its nucleotide sequence was determined. A single open reading frame consisting of 1125 base pairs which encodes a polypeptide consisting of signal peptide of 22 amino acids and a mature protein of 353 amino acids was identified. The deduced protein sequence of AP exhibits a 38% identity to the AP III and AP IV sequences of Bacillus subtilis and conserves the typical sequence motifs of the core structure and active sites of APs from various sources. Based on the crystal structure of the mutated Escerichia coli AP D153H, a homology-based 3D model of the TAB5 AP was constructed on the basis of which various features of the enzyme amino-acid sequence can be interpreted in terms of potential psychrophilic adaptations. The AP gene was expressed in E. coli BL21(DE3) cells, the recombinant protein was isolated to homogeneity from the membrane fraction of the cells and its properties were examined. The purified TAB5 AP shows typical features of a cold enzyme: high catalytic activity at low temperature and a remarkable thermosensitivity. The use of this heat-labile enzyme, for dephosphorylation of nucleic acids, simplifies dephosphorylation protocols.     

Cloning and expression of an alpha-L-arabinofuranosidase gene (stxIV) from Streptomyces thermoviolaceus OPC-520, and characterization of the enzyme

The gene encoding alpha-L-arabinofuranosidase (STX-IV), located upstream of the previously reported stxI gene, was cloned and sequenced. The gene is divergently transcribed from the stxI gene, and the two genes are separated by 661 nucleotides. The stxIV gene consists of a 1,092-bp open reading frame encoding 363 amino acids. The deduced amino acid sequence of the gene showed that STX-IV was an enzyme consisting of only a catalytic domain, and that the enzyme had significant similarity with alpha-L-arabinofuranosidases belonging to family 62 of glycosyl hydrolases. The stxIV gene was expressed in Escherichia coli, and the recombinant protein was purified to homogeneity. Arabinoxylan and oat spelt xylan were good substrates for STX-IV, however, the enzyme showed a low activity with p-nitrophenyl alpha-L-arabinofuranoside. The optimum pH and temperature were 5.0 and 60 degrees C, respectively.     

Expression and Export of Pseudomonas putida NTU-8 Creatinase by Escherichia coli Using the Chitinase Signal Sequence of Aeromonas hydrophila

The gene for the creatinase from Pseudomonas putida NTU-8 was sequenced and revealed an open reading frame (ORF) of 1209 base pairs encoding a polypeptide of 403 amino acids with a calculated molecular weight (M(r)) of 45,691. The deduced amino acid sequence is very similar to that of the creatinase of Pseudomonas putida and Flavobacterium sp. An overproduction system for the chitinase signal peptide--creatinase hybrid gene was constructed by using the pQE-51 expression vector in E. coli JM109. The amount of this fusion enzyme was about 50% exported into the periplasmic space of E. coli.     

alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.     

A DNA sequence containing the control sites for gene malT and for the malPQ operon

Summary The order of 802 base pairs was established in a DNA segment containing the promoter for malPQ which is one of the three maltose operons, and the promoter for malT, the positive regulator gene of the maltose regulon. The determination of the amino-terminal sequence of the MalT protein allowed us to identify the beginning of the malT gene on the sequence. The position of the malP gene was deduced from the published amino-terminal sequence of maltodextrin phosphorylase. A total of 611 base pairs separate the initiation codons for these two genes, which are transcribed in opposite directions. This large intergenic region does not code for any polypeptide of significant size. The main features of this sequence are discussed in terms of the regulation known to operate on malT and malPQ expression.