Site-specific deletion at the replication origin of the antibiotic resistance factor R1

Summary The recombinant plasmid pRK101 carrying the complete replication origin of the antibiotic resistance factor R1 suffers frequently a deletion of 218 base pairs, removing parts or all of the origin sequence. This deletion seems to occur always when the Pst-E fragment carrying the replication origin is inserted into the cloning vector pBR322 in an orientation where the direction of R1 replication is the same as that of the vector plasmid and frequently when it is inserted in the opposite direction. DNA sequence analysis around the junction site generated by the deletion in three independently isolated deletion mutants reveals that the deletion occurs at a specific site, namely the end of a 22 bp sequence which is repeated almost identically at the other end of a segment of 197 bp. During the deletion one repeat unit is removed whereas the other is retained. The DNA sequence included by the two repeats contains high symmetric structures, i.e. inverted repeats, direct repeats and palindromes which may represent regulatory sites of the origin.     

Activity of the replication terminus of plasmid R6K in hybrid replicons in Escherichia coli.

Hybrids between the antibiotic resistance plasmid R6K and RSF2124, a derivative of plasmid ColEl were constructed in vetro. These hybrids exhibit the replication properties of both parents in Escherichia coli, including the use of either the R6K or the ColEl origin of replication during logarithmic phase growth. Incompatibility properties of both parental plasmids also are expressed by the hybrid plasmids. Analysis of replicative intermediates showed that the asymmetric terminus of R6K was functional in the hybrids. In the absence of protein synthesis where replication of the hybrid plasmid is initiated only from the ColE1 origin, the R6K terminus either prevents or severely impedes the progress of the replication fork. The activity of the R6K terminus region is expressed independent of the direction of DNA replication and in the absence of the R6K replication origin.     

The nucleotide sequence of a DNA fragment from the replication origin of the antibiotic resistance factor R1drd19

Summary The recombinant plasmid pRK101 contains a DNA fragment which carries the complete replication origin of the antibiotic resistance factor R1drd-19 inserted into the vector plasmid pBR322. In a spontaneously arising mutant of this plasmid (pRK 103) a deletion of about 215 base pairs (bp) has been detected by heteroduplex analysis and mapping with restriction endonucleases. Essential parts of the replication origin must be located in the deleted sequence. The deletion mutant pRK103, in contrast to its parent plasmid pRK101 is not replicated under the control of the R1 replicon, even when the R1 factor or copy mutants of it are present within the same cell. These latter plasmids can complement a plasmid-specific protein not coded by pRK101 but essential for R1-directed replication. The nucleotide sequence of a 252 bp HpaII fragment covering about 170–200 bp of the deletion was determined. This piece of DNA is rich in G and C and contains a series of small palindromes, symmetrically arranged repeated sequences and short selfcomplementary structures which may be of significance for the initiation of the DNA replication. The possibility that the sequenced DNA fragment comprises a major part of the replication origin of R1drd-19 is discussed.     

Replication of antibiotic resistance plasmid R6K DNA in vitro.

A soluble extract prepared from cells of an Escherichia coli strain carrying the antibiotic resistance plasmid R6K is capable of carrying out the complete process of R6K DNA replication. DNA synthesis in vitro is dependent on the four deoxyribo- and ribonucleotide triphosphates and is sensitive to rifampin and streptolydigin, inhibitors of DNA-dependent RNA polymerase. The incorporation of deoxyribonucleotides into R6K DNA also is sensitive to actinomycin D, novobiocin, arabinofuranosyl-CTP, and N-ethylmaleimide. Kinetics of synthesis are linear for 60 to 120 min. Replication proceeds semiconservatively and supercoiled closed-circular DNA molecules are synthesized. Analysis by alkaline sucrose gradient centrifugation indicated that the early R6K DNA products contain DNA fragments of approximately 18 S in size, corresponding to the length between the R6K alpha origin of replication and the terminus of replication observed in vivo. Addition of exogenous supercoiled R6K DNA is inhibitory to the in vitro system, whereas the addition of R6K DNA in the form of relaxation complex stimulates R6K DNA synthesis to a small extent.     

Identification and mapping of the replication genes of an R factor, R100-1, integrated into the chromosome of Escherichia coli K-12

A stable Hfr strain of Escherichia coli K-12 was obtained by integrative suppression by an R factor, R100-1. The R factor was integrated into the right of 81 min, and chromosome transfer occurred counterclockwise. Mating experiments revealed two linkage groups of genes on the R factor. Drug-resistant transductants of a dnaA-ts recipient from an R-factor Hfr and from an R(+) strain differ in their drug resistance patterns, temperature sensitivity, and transferability of drug resistance as well as chromosome markers. Transductants that transferred chromosome markers were further classified as to the origin and direction of chromosome transfer. For temperature-sensitive transductants, the reversion frequency to temperature resistance was determined, and these revertants were scored for transfer of drug resistance as well as chromosome markers. Two genes responsible for integrative suppression (designated as repA) and the other for autonomous replication (designated as repB) were identified and mapped. The arrangement of genes on the R factor is... (sul, str, cml)... repA... tra... (tet, repB).... The map of the autonomously replicating R factor is probably a circle connecting both sides of this linear map. Thus, a method has been established to map a plasmid that could not finely be analyzed under autonomous state by transduction. It also permits genetic analysis of genes responsible for replication of the plasmid without making use of a conditional mutant of itself but with that of the host, dnaA.     

A 140 base-pair DNA segment from the kanamycin resistance region of plasmid R1 acts as an origin of replication and promotes site-specific recombination

A 140 base-pair DNA segment situated just upstream of the kanamycin resistance gene of transposon Tn2350, a transposon carried by the plasmid R1, was found to act as an origin of replication and allow autonomous replication of a plasmid composed only of the segment and of the tetracycline resistance gene of pBR322. This segment also promotes site-specific recombination: when cloned in pBR322 it promotes multimer formation in a recA- strain. If two copies are cloned on the same plasmid they promote either deletion or inversion of the intervening region, depending on their orientation relative to each other. DNA gyrase seems to be involved in this process since the inversion rate, in a plasmid carrying sequences in opposite orientations, varies in different nalidixic acid-resistant strains (gyr A mutants) independently isolated.     

Characterization of small ampicillin resistance plasmids (Rsc) originating from the mutant antibiotic resistance factor R1drd-19B2.

Summary Four plasmids Rsc10–13 ranging in size from 5.1×10⁶ to 13.4×10⁶ Dalton have been isolated from a strain carrying the copy mutant R1drd-19B2 of the antibiotic resistance factor R1. The Rsc plasmids have been cloned by transformation in Escherichia coli C. They determine high level resistance to ampicillin and occur in the cell in multiple copies. Their copy number and stability in the bacterial cell depend on the plasmid and the host strain.Physical maps of these plasmids have been constructed by cleavage with restriction endonucleases HincII, EcoRI, HindIII, BamI and SmaI. The pattern of the cleavage fragments have been compared with the parent plasmid R1drd-19B2 and with a R1 deletion mutant, R1drd-16, which has lost the ampicillin resistance. For Rsc11 and Rsc10 the data indicate, that both plasmids derive from a continuous stretch of the R1drd-19B2 DNA extending from the ampicillin transposon (TnA) to the replication site of the R1 factor. The plasmids Rsc12 and 13 have lost a DNA sequence between TnA and the replication site of R1. They may be formed by translocation of TnA to different autonomously replicating fragments of R1drd-19B2 including the replication origin or by deletion of DNA sequences from Rsc10 and Rsc11.     

Origin and direction phiX174 double- and single-stranded DNA synthesis

The origin and direction of both φX174 double-stranded and single-stranded DNA synthesis has been determined by pulsing replicating viral DNA molecules with [³H]thymidine for periods of less than one round of DNA synthesis and examining distribution of activity in the Haemophilus influenzae restriction endonuclease (Hin) DNA fragments of these molecules. In early RFI and RFII DNA intermediates in double-stranded DNA replication, gradients of label were observed which started in the R3 fragment (cistron A) and increased towards the R4 fragment (cistron H). The origin of synthesis is near the R4/R3 junction of the R3 fragment. Thus, φX174 double-stranded DNA synthesis proceeds clockwise around the genetic map (5′ → 3′), in one direction only and starting in the region of cistron A, a conclusion consistent with the genetic experiments of Baas &; Jansz (1972). Similar experiments with the gapped late RFII DNA molecules that have just completed a round of single-stranded viral DNA synthesis demonstrated that φX174 single-stranded DNA synthesis also has a single origin of replication in the region of cistron A, and that the synthesis moves in the 5′ → 3′ direction, around the genetic map. The gap in both the early and the late RFII DNA molecules also appears to be in the R3 fragment containing cistron A.     

Origin and direction of in vitro replication of Haemophilus ducreyi and Neisseria gonorrhoeae ampicillin resistance plasmids.

The origin of replication of Haemophilus ducreyi and Neisseria gonorrhoeae ampicillin resistance plasmids was located by cloning BamHI restriction fragments into vector plasmid pAT153 and a derivative plasmid, pAT2. Selection was made for plasmid maintenance in a polA mutant. Direction of replication was determined by in vitro replication of plasmid DNA in the presence of radiolabeled deoxynucleotide.     

aadA confers streptomycin resistance in Borrelia burgdorferi

To enhance genetic manipulation of the Lyme disease spirochete Borrelia burgdorferi, we assayed the aadA gene for the ability to confer resistance to the antibiotics spectinomycin and streptomycin. Using the previously described pBSV2 as a backbone, a shuttle vector, termed pKFSS1, which carries the aadA open reading frame fused to the B. burgdorferi flgB promoter was constructed. The hybrid flgB promoter-aadA cassette confers resistance to spectinomycin and streptomycin in both B. burgdorferi and Escherichia coli. pKFSS1 has a replication origin derived from the 9-kb circular plasmid and can be comaintained in B. burgdorferi with extant shuttle vector pCE320, which has a replication origin derived from a 32-kb circular plasmid, or pBSV2, despite the fact that pKFSS1 and pBSV2 have the same replication origin. Our results demonstrate the availability of a new selectable marker and shuttle vector for genetically dissecting B. burgdorferi at the molecular level.     

Activity in vitro of three replication origins of the antibiotic resistance plasmid RSF1040

Replicating molecules of plasmid RSF1040, a deletion mutant of R6K, were synthesized in vitro and analyzed by electron microscopy. Initiation of replication occurs at three unique sites, ori alpha, ori beta, and ori gamma, within a 3900-base pair segment of the R6K genome. These sites are indistinguishable from the origins that are active in vivo. Frequencies of initiation at these three origins, however, are different from those observed in vivo. Replication proceeds unidirectionally in either direction from ori beta and ori gamma and in one direction from ori alpha. The replication terminus of the R6K genome is inactive in the in vitro system.     

A bovine papilloma virus vector with a dominant resistance marker replicates extrachromosomally in mouse and E. coli cells

We describe the construction of a bovine papilloma virus-based vector (pCGBPV9) which contains a dominant selectable marker and replicates autonomously in both mouse and Escherichia coli cells. This vector contains the complete bovine papilloma virus genome, a ColE1 replication origin and a dominant selectable marker conferring resistance to kanamycin in bacteria and G418 in eukaryotic cells. A high number of G418R colonies are obtained after transfer of pCGBPV9 into mouse C127 cells. These G418R colonies contain vector DNA which replicates autonomously at approximately 10-30 copies per cell. The molecules are in most cases unrearranged and can be rescued into E. coli cells by bacterial transformation.     

Insertion of an R1 plasmid into the origin of replication of the E. coli chromosome: random timing of replication of the hybrid chromosome

A 16 bp BgI II fragment was deleted in vitro from the minimal origin of replication of the Escherichia coli chromosome, oriC, and was replaced by a 10 kb R1 miniplasmid, pKN1562, containing the basic R1 replicon and a kanamycin resistance gene. The deletion-insertion was transferred by homologous recombination into the chromosome of a dnaA(ts) strain. P1 transduction separated the origin "mutation" from the dnaA46 allele. Integration of mini-R1 into oriC was verified by Southern blotting and by analysis of the R1 incompatibility phenotype. It was possible to isolate normal R1 miniplasmids from the integrated R1. Chromosome replication was initiated at random times after a short delay. The constructed strains grew 20%-30% slower than the wild type and showed more heterogeneous cell sizes.     

Cloning and characterization of EcoRI and HindIII restriction endonuclease-generated fragments of antibiotic resistance plasmids R6-5 and R6

Summary DNA fragments generated by the EcoRI or HindIII endonucleases from the low copy number antibiotic resistance plasmids R6 and R6-5 were separately cloned using the high copy number ColEl or pML21 plasmid vectors and the insertional inactivation procedure. The hybrid plasmids that were obtained were used to determine the location of the EcoRI and HindIII cleavage sites on the parent plasmid genomes by means of electron microscope heteroduplex analysis and agarose gel electrophoresis. Ultracentrifugation of the cloned fragments in caesium chloride gradients localized the high buoyant density regions of R6-5 to fragments that carry the genes for resistance to streptomycin-spectinomycin, sulfonamide, and mercury and a low buoyant density region to fragments that carry the tetracycline resistance determinant. Functional analysis of hybrid plasmids localized a number of plasmid properties such as resistances to antibiotics and mercury and several replication functions to specific regions of the R6-5 genome. Precise localisation of the genes for resistance to chloramphenicol, kanamycin, fusidic acid and tetracycline was possible due to the presence of identified restriction endonuclease cleavage sites within these determinants.Only one region competent for autonomous replication was identified on the R6-5 plasmid genome and this was localized to EcoRI fragment 2 and HindIII fragment 1. However, two additional regions of replication activity designated RepB and RepC, themselves incapable of autonomous replication but capable of supporting replication of a linked ColE1 plasmid in polA^– bacteria, were also identified.     

pUB2380: characterization of a ColD-like resistance plasmid

A detailed analysis of the mobilizable, ColE1-like resistance plasmid, pUB2380, is reported. The 8.5-kb genome encodes six (possibly seven) major functions: (1) a ColD-like origin of replication, oriV, with associated replication functions, RNAI and RNAII; (2) a set of active mobilization functions highly homologous to that of ColE1, including the origin of transfer, oriT; (3) a ColE1-like multimer resolution site (cer); (4) a kanamycin-resistance determinant, aph, encoding an aminoglycoside-3'-phosphotransferase type 1; (5) an insertion sequence, IS1294; and (6) two genes, probably cotranscribed, of unknown function(s). The GC content of the various parts of the genome indicates that the plasmid is a hybrid structure assembled from DNA from at least three different sources, of which the replication region, the mobilization functions, and the resistance gene are likely to have originated in the enterobacteriaceae.     

Plasmid replication functions

Summary Replicating DNA molecules of the mini R6-5 plasmid, pKTO71, were purified by equilibrium centrifugation in two successive ethidium bromide-caesium chloride gradients, converted to linear forms by cleavage with either HindIII or BglII restriction endonuclease, and examined in the electron microscope. Determination of the replication fork positions in 65 replicating molecules demonstrated that replication is initiated at a unique location on the plasmid and that it proceeds uni-directionally from this site. The direction of replication is such that the origin-proximal BglII cleavage site is replicated late or, in the case of the parent R6-5 plasmid, is such that the R-determinant region of the molecule is replicated early. The origin of replication, located by these experiments at R6-5 coordinate 98.6 kb, is clearly distinct from that of the R6-5 incompatibility determinant which has been shown to be located on an adjacent PstI-generated DNA fragment whose termini have R6-5 coordinates 96.8 and 97.9 kb. This result indicates that the incompatibility function is not an origin DNA sequence.     

A new IncQ plasmid R89S: Properties and genetic organization

The new small (8.18 kb) streptomycin-resistant multicopy plasmid R89S of the Q group incompatibility is described. In contrast to other IncQ plasmids, replication of R89S is dependent on DNA polymerase 1 and proceeds in the absence of de novo protein synthesis. According to our data up to now, the host spectrum of the plasmid R89S is limited to Enterobacteriaceae. A genetic map of the plasmid R89S has been prepared through the construction of deletion and insertion derivatives. Phenotypic analysis of these derivatives has identified the location of genes encoding resistance to streptomycin, and the region essential for mobilization of R89S. The origin of vegetative replication has been located within a 0.7-kb fragment. Another region highly homologous to oriV of the plasmid RSF1010, but not functioning as an origin of replication, was localized. Two regions involved in the expression of incompatibility have also been identified. The data from the restriction analyses, DNA-DNA hybridization, and genetic experiments enable us to assume that the plasmid R89S is a naturally occurring recombinant between part of an IncQ plasmid and another narrow host range replicon of unknown incompatibility group.     

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.     

Probing the activation of the replicative origin of broad host-range plasmid R1162 with Tus, the E.coli anti-helicase protein.

The E.coli Tus protein is an anti-helicase involved in the termination of chromosome replication. The binding site for this protein, ter, was cloned into derivatives of the broad host-range plasmid R1162. The ter site caused the orientation-specific termination of plasmid replication fork movement in cell extracts containing Tus. Plasmids were constructed so that two sites for initiation of R1162 replication flanked the iteron-containing domain of the origin. In these plasmids, the site next to the AT-rich region within the iteron-containing domain was more active. In addition, when ter was placed between the more active site and the iterons, initiation of replication from this site was specifically inhibited. The data support a model for entry of the essential, plasmid-encoded helicase at one side of the direct repeats, and for its movement primarily in one direction away from these repeats to activate the initiation sites for DNA replication.