The basis for camptothecin enhancement of DNA breakage by eukaryotic topoisomerase I.

The eukaryotic topoisomerase I (topo I) is the target of the cytotoxic alkaloid camptothecin (CTT). In vitro, CTT enhances the breakage of DNA by topo I when the reaction is stopped with detergent. Although breakage at some sites is enhanced to a great extent while breakage at others is enhanced only minimally, CTT does not significantly change the breakage specificity of topo I in vitro. It has been suggested that CTT acts by slowing the reclosure step of the nicking-closing reaction. To test this hypothesis, we have measured the rate of reclosure for different break sites in the presence of CTT after adding 0.5 M NaCl to a standard low salt reaction. In support of the hypothesis, we find that topo I-mediated DNA breakage is enhanced the greatest at those sites where closure of the break is the slowest. These results suggest a mechanism for the toxicity of CTT in vivo.     

DNA strand-breaks induced by the topoisomerase I inhibitor camptothecin in unstimulated human white blood cells

Camptothecin (CPT) and actinomicyn-induced strand-breaks, repair and apoptosis in unstimulated human blood cells were studied using the DNA comet assay, and electrophoresis of low molecular weight DNA extracts. On the one hand, incubation of G0 leukocytes for 1 h with CPT induced DNA strand-breaks that were observed using the single cell gel electrophoresis technique. On the other hand, internucleosomal DNA fragments were not observed, suggesting that apoptosis had not occurred. DNA-strand-breaks caused by CPT were repaired 24 h after treatment; the migration of DNA fragments was assessed by a reduction in the number of comets. These data strongly suggest that the unexpected clastogenic effect of this topoisomerase I inhibitor is not due to the collision of the cleavage complex with the replication fork, since replication does not occur in G0. In our opinion, this effect could be due instead to the topoisomerase I enzyme being able to bind DNA in the absence of replication, probably in a way that is not strictly related to the progression of the cell cycle. Thus, CPT does not provoke apoptosis in quiescent leukocytes.     

Human DNA topoisomerase I: quantitative analysis of the effects of camptothecin analogs and the benzophenanthridine alkaloids nitidine and 6-ethoxydihydronitidine on DNA topoisomerase I-induced DNA strand breakage.

Human DNA topoisomerase I (topo I) has been purified from normal placenta and from a recombinant baculovirus expression system. A new radiolabeled plasmid DNA assay has been used to quantitate the activity of the purified enzymes and to compare the ability of several types of topo I-targeted drugs to induce topo I-mediated DNA strand breaks. The 100-kDa recombinant enzyme form isolated from the baculovirus expression system is able to relax 2564 ng of supercoiled M-13 mp19 plasmid per minute per nanogram of enzyme. The addition of camptothecin (1 microM) to the reaction lowers the rate to 1282 ng per minute per nanogram of enzyme. The 100-kDa topo I from human placenta is able to relax 1092 ng of supercoiled plasmid per minute per nanogram of enzyme and the 68-kDa topo I form from placenta is able to relax 2069 ng of supercoiled plasmid per minute per nanogram of enzyme. Camptothecin (1 microM) decreases the relaxation rate of the placental enzymes about 50%. In the presence of several different types of topo I-targeted drugs, both the recombinant and placental enzymes are induced to cleave plasmid DNA. Quantitative DNA cleavage assays with radioactive plasmid DNA and 9-aminocamptothecin, topotecan, SN-38, 10, 11-methylenedioxycamptothecin, 7-ethyl-10, 11-methylenedioxycamptothecin, 7-chloromethyl-10, 11-methylenedioxycamptothecin, nitidine, and 6-ethoxy-5, 6-dihydronitidine indicate that the order of potency in inducing topo I-mediated DNA breakage is methylenedioxycamptothecin analogs > SN-38 > 9-aminocamptothecin > topotecan and camptothecin > nitidine compounds. The order of potency correlates with the half-lives of the topo I-DNA drug complex determined with radiolabeled DNA in 0.45 M NaCl at 30 degrees C. The half-life of the complex formed with 7-chloromethyl-10,11-methylenedioxycamptothecin is greater than 90 min whereas the half-life of the topo I-DNA complex with 6-ethoxy-5, 6-dihydronitidine is less than 15 s. The other drugs tested were found to have drug complex half-lives which fall between these two extremes.     

DNA strand breakage by wheat germ type 1 topoisomerase

Properties of strand breakage in duplex and single-stranded DNA by the wheat germ type 1 DNA topoisomerase were investigated. Strand breakage in duplex DNA is dependent upon the use of denaturing conditions to inactivate the enzyme and terminate the reaction, whereas breakage of single-stranded DNA occurs under the normal reaction conditions and is not dependent upon denaturation. Breakage generates a free 5' hydroxyl group and enzyme bound to the 3' side of the break, presumably via the 3' phosphate group. The location of sites of breakage with both duplex and single-stranded DNA is not random. In all these respects the wheat germ enzyme closely resembles the rat liver type 1 topoisomerase. A comparison of the locations of the sites of breakage in duplex DNA generated by the topoisomerases from wheat germ and rat liver indicates a number of common sites, although the patterns of breakage are not identical.     

Platinated DNA adducts enhance poisoning of DNA topoisomerase I by camptothecin

Camptothecins constitute a novel class of chemotherapeutics that selectively target DNA topoisomerase I (Top1) by reversibly stabilizing a covalent enzyme-DNA intermediate. This cytotoxic mechanism contrasts with that of platinum drugs, such as cisplatin, which induce inter- and intrastrand DNA adducts. In vitro combination studies using platinum drugs combined with Top1 poisons, such as topotecan, showed a schedule-dependent synergistic activity, with promising results in the clinic. However, whereas the molecular mechanism of these single agents may be relatively well understood, the mode of action of these chemotherapeutic agents in combination necessitates a more complete understanding. Indeed, we recently reported that a functional homologous recombination pathway is required for cisplatin and topotecan synergy yet represses the synergistic toxicity of 1-beta-D-arabinofuranosyl cytidine in combination with topotecan (van Waardenburg, R. C., de Jong, L. A., van Delft, F., van Eijndhoven, M. A., Bohlander, M., Bjornsti, M. A., Brouwer, J., and Schellens, J. H. (2004) Mol. Cancer Ther. 3, 393-402). Here we provide direct evidence for Pt-1,3-d(GTG) poisoning of Top1 in vitro and demonstrate that persistent Pt-DNA adducts correlate with increased covalent Top1-DNA complexes in vivo. This contrasts with a lack of persistent lesions induced by the alkylating agent bis[chloroethyl]nitrosourea, which exhibits only additive activity with topotecan in a range of cell lines. In human IGROV-1 ovarian cancer cells, the synergistic activity of cisplatin with topotecan requires processive DNA polymerization, whereas overexpression of Top1 enhances yeast cell sensitivity to cisplatin. These results indicate that the cytotoxic activity of cisplatin is due, in part, to poisoning of Top1, which is exacerbated in the presence of topotecan.     

Protection of DNA from gamma-radiation induced strand breaks by Epicatechin

Epicatechin (EC), a polyphenolic antioxidant compound found in tea, apples and chocolate offered protection to DNA against ionizing radiation induced damages. Under in vitro conditions of radiation exposure, plasmid pBR322 DNA was protected by EC in a concentration dependent manner. The dose modifying factor for 0.2 mM EC for 50% protection of the plasmid DNA was found to be 6.0. EC when administered to mice 1 h prior to exposure to 4 Gy gamma-radiation protected cellular DNA against radiation-induced strand breaks in peripheral blood leukocytes, as revealed in alkaline comet assay studies. Thus, EC was found to protect DNA from gamma-radiation indiced strand breaks under in vitro as well as in vivo conditions of radiation exposure.     

DNA strand transfer reactions catalyzed by vaccinia topoisomerase I.

Vaccinia virus DNA topoisomerase I forms a 3'-phosphoryl intermediate with duplex DNAs containing the conserved binding/cleavage motif 5'CCCTT decreases. Covalently bound enzyme is capable of transferring the incised DNA strand to a heterologous DNA acceptor containing a 5'OH terminus. Both intramolecular and intermolecular religation reactions are catalyzed. Intramolecular strand transfer occurs to the noncleaved strand of the DNA duplex and results in formation of a hairpin loop. Intermolecular religation to an exogenous DNA strand is favored over hairpin formation and requires the potential for base pairing between the acceptor and the noncleaved strand of the donor complex. As few as 4 potential base pairs are sufficient to support intermolecular transfer. These results in vitro are consistent with the proposal that vaccinia topoisomerase can catalyze sequence-specific strand transfer during genetic recombination in vivo (Shuman, S. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 10104-10108.).     

Sequence-dependent effect of camptothecin on human topoisomerase I DNA cleavage

We have studied the effect of the antitumor drug, camptothecin, on the interaction of human topoisomerase I with DNA at the sequence level. At a low molar ratio of enzyme to DNA, cleavage is prominent and unique, located at a previously described hexadecameric recognition sequence, while a number of strong additional cleavage sites appear in the presence of the drug. Camptothecin stimulates cleavage at the recognition sequence less than twofold, whereas cleavage at the additional sites is stimulated up to 200-fold. Camptothecin greatly enhances the stability of the cleavable complexes formed at the additional sites, whereas the complex formed at the hexadecameric sequence is only marginally affected. Cleavage was eliminated at certain sites in the presence of camptothecin. Taken together these observations demonstrate that at least three types of potential eukaryotic topoisomerase I cleavage sites can be distinguished by the use of camptothecin. Comparison of the sequences at the additional cleavage sites in the presence of camptothecin reveals that the most frequently cleaved dinucleotide is TG with no consensus for the flanking nucleotides.     

Induction of chromosomal aberrations and SCE by camptothecin, an inhibitor of mammalian topoisomerase I

The induction of chromosomal aberrations and sister-chromatid exchanges (SCE) was studied in human lymphocyte cultures treated with camptothecin (CM), an inhibitor of mammalian topoisomerase I. While no chromosome-type aberrations were found in G1-treated cells, instead there was a dose-dependent induction of chromatid-type aberrations. These types of chromosomal alteration were not induced during the treatment itself but during the S phase, as CM is not efficiently removed with the normal washing procedure after treatment.     

Effects of theophylline on chromosomal breakage and sister-chromatid exchange

Frequencies of both sister-chromatid exchange (SCE) and chromosomal breakage (CB) were studied in the lymphocytes of normal individuals (10 and 7 individuals respectively). The cells were exposed in vitro to 3 different concentrations of theophylline (1, 10 and 100 micrograms/ml). A significant concentration effect of the drug was demonstrated for both SCEs and CB. Utilizing a Dunnett's test for individual comparisons, the 10 and 100 micrograms/ml concentrations both demonstrated a significant elevation of SCEs and CB compared to the untreated control cultures. This study suggests that in vitro concentrations of theophylline equal to or greater than 10 micrograms/ml, corresponding to serum levels attained during therapy, increase the frequency of SCEs and chromosome breakage in human lymphocytes.     

DNA sequence selectivity of human topoisomerase I‐mediated DNA cleavage induced by camptothecin

In probing the mechanism of inhibition of hypoxia inducible factor (HIF-1) by campothecins, we investigated the ability of human topoisomerase I to bind and cleave HIF-1 response element (HRE), which contains the known camptothecin-mediated topoisomerase I cleavage site 5′-TG. We observed that the selection of 5′-TG by human topoisomerase I and topotecan depends to a large extent on the specific flanking sequences, and that the presence of a G at the −2 position (where cleavage occurs between −1 and +1) prevents the HRE site from being a preferred site for such cleavage. Furthermore, the presence of −2 T/A can induce the cleavage at a less preferred TC or TA site. However, in the absence of a more preferred site, the HRE site is shown to be cleaved by human topoisomerase I in the presence of topotecan. Thus, it is implied that the −2 base has a significant influence on the selection of the camptothecin-mediated Topo I cleavage site, which can overcome the preference for +1G. While the cleavage site recognition has been known to be based on the concerted effect of several bases spanning the cleavage site, such a determining effect of an individual base has not been previously recognized. A possible base-specific interaction between DNA and topoisomerase I may be responsible for this sequence selectivity.     

Apoptosis of unstimulated human lymphocytes and DNA strand breaks induced by the topoisomerase II inhibitor etoposide (VP-16)

Etoposide (VP-16)-induced DNA strand breaks and repair and apoptosis of unstimulated human lymphocytes have been studied using DNA comet assay, electrophoresis of low-molecular-weight DNA extracts, and fluorescence microscopy. Incubation of unstimulated human lymphocytes with VP-16 (50-200 microg/ml) for 3 or 24 h induced apoptosis. This conclusion is supported by results of morphological studies, evaluation of the proportion of hypodiploidy and internucleosomal degradation of DNA in lymphocytes. Etoposide-induced formation of DNA strand breaks preceded the appearance of these conventional apoptotic manifestations. The number of single-strand breaks depended on VP-16 concentration, and 2-3 h after its removal from the incubation medium they were repaired. The hydroxyl group at the C-4; position of the etoposide dimethoxyphenol ring may be responsible for the formation of single-strand breaks. Double-strand breaks were unrepaired 20 h after the change of the incubation medium. The number of double-strand breaks and a proportion of apoptotic cells did not exhibit any dependence on VP-16 concentration and/or duration of cell exposure to this agent. We suggest that the cytotoxic effect of VP-16 on unstimulated lymphocytes is mediated by a topoisomerase II isoform, topoisomerase II-beta, which is localized in the nucleolus and is not related to the cell cycle.     

Camptothecin, a specific inhibitor of type I DNA topoisomerase, induces DNA breakage at replication forks.

The structure of replicating simian virus 40 minichromosomes, extracted from camptothecin-treated infected cells, was investigated by biochemical and electron microscopic methods. We found that camptothecin frequently induced breaks at replication forks close to the replicative growth points. Replication branches were disrupted at about equal frequencies at the leading and the lagging strand sides of the fork. Since camptothecin is known to be a specific inhibitor of type I DNA topoisomerase, we suggest that this enzyme is acting very near the replication forks. This conclusion was supported by experiments with aphidicolin, a drug that blocks replicative fork movement, but did not prevent the camptothecin-induced breakage of replication forks. The drug teniposide, an inhibitor of type II DNA topoisomerase, had only minor effects on the structure of these replicative intermediates.     

Mechanism of DNA strand breakage induced by photosensitized tetracycline-Cu(II) complex

Tetracyclines (TCs) in combination with Cu(II) ions exhibited significant DNA damaging potential vis a vis tetracyclines per se. Interaction of tetracyclines with DNA resulted in alkylation at N-7 and N-3 positions of adenine and guanine bases, and caused destabilization of DNA secondary structure. Significant release of acid-soluble nucleotides from tetracycline-modified DNA upon incubation with S(1) nuclease ascertained the formation of single stranded regions in the DNA. Also, the treatment of tetracycline-modified DNA with 0.1 and 0.5M NaOH resulted in 62 and 76% hydrolysis compared to untreated control. Comparative alkaline hydrolysis of DNA modified with tetracycline derivatives showed differential DNA damaging ability in the order as DOTC > DMTC > TC > OTC > CTC. Addition of Cu(II) invariably augmented the extent of tetracycline-induced DNA damage. The alkaline unwinding assay clearly demonstrated the formation of approximately six strand breaks per unit DNA at 1:10 DNA nucleotide/TC molar ratio in the presence of 0.1mM Cu(II) ions. At a similar Cu(II) concentration, a progressive transformation of covalently closed circular (CCC) (form-I) plasmid pBR322 DNA to forms-II and -III was noticed with increasing tetracycline concentrations. The results obtained with the free-radical quenchers viz. mannitol, thiourea, sodium benzoate and superoxide dismutase (SOD) suggested the involvement of reactive oxygen species in the DNA strand breakage. It is concluded that the tetracycline-Cu(II)-induced DNA damage occurs due to (i) significant binding of tetracycline and Cu(II) with DNA, (ii) methyl group transfer from tetracycline to the putative sites on nitrogenous bases, and (iii) metal ion catalyzed free-radical generation in close vicinity of DNA backbone upon tetracycline photosensitization. Albeit, the DNA alkylation and strand cleavage are repairable lesions, but any defect in the critical repair pathway may augment the damage accumulation and mutagenesis.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Telomeric DNA damage by topoisomerase I. A possible mechanism for cell killing by camptothecin

Topoisomerase I adjusts torsional stress in the genome by breaking and resealing one strand of the helix through a transient covalent coupling between enzyme and DNA. Camptothecin, a specific topoisomerase I poison, traps this covalent intermediate, thereby damaging the genome. Here we examined the activity of topoisomerase I at telomeric repeats to determine whether telomere structures are targets for DNA damage. We show that topoisomerase I is catalytically active in cleaving the G-rich telomeric strand in vitro in the presence of camptothecin but not in cleaving the C-rich strand. The topoisomerase I cleavage site is 5'-TT (downward arrow) AGGG-3' (cleavage site marked by the downward arrow). We also show that endogenous topoisomerase I can access telomeric DNA in vivo and form camptothecin-dependent covalent complexes. Therefore, each telomeric repeat represents a potential topoisomerase I cleavage site in vivo. Because telomere structures are comprised of a large number of repeats, telomeres in fact represent a high concentration of nested topoisomerase I sites. Therefore, more telomeric DNA damage by camptothecin could occur in cells with longer telomeres when cells possess equivalent levels of topoisomerase I. The evidence presented here suggests that DNA damage at telomeric repeats by topoisomerase I is a prominent feature of cell killing by camptothecin and triggers camptothecin-induced apoptosis.