Cloning and analysis of cDNA clones for rat kidney alpha-spectrin

We have isolated a 3922-base pair (bp) cDNA clone for rat nonerythroid alpha-spectrin from a rat kidney lambda gt11 cDNA library. Sequence analysis revealed that this cDNA contains an open reading frame of 3090 bp encoding for the C-terminal 1030 amino acid sequence of rat kidney alpha-spectrin. The 3'-untranslated region (including a 38-bp poly(A+) tail) contains an 832-bp sequence. A single mRNA of about 8 kilobase pairs was detected in rat liver, kidney, brain, heart, intestine, lung, testis, stomach, spleen, and muscle with varying abundances, which is consistent with and further confirms the presence of spectrins in nonerythroid tissues as demonstrated previously by immunoblot analysis. Southern blot analysis suggested that there is a single gene for nonerythroid alpha-spectrin. The derived amino acid sequence contains sequence from the spectrin 106-residue internal repeat 12 to the C terminus of rat kidney alpha-spectrin. Sequence comparison with human and chicken nonerythroid alpha-spectrin showed that nonerythroid alpha-spectrin is well conserved during evolution. The rat kidney alpha-spectrin sequence, when compared to rat brain alpha-spectrin, contains an extra 76-amino-acid sequence at the C terminus. Sequence comparison of all the internal repeats available revealed that the internal repeat 3, 4, 5, 6, 7, and 8 has highest sequence similarity with internal repeat 12, 13, 14, 15, 16, and 17, respectively. Therefore, internal repeats 3-8 and 12-17 are most likely derived from an ancestral gene through gene duplication, suggesting that the spectrin gene is derived from a half-spectrin gene by gene duplication and divergence during evolution.     

Comparison of nonerythroid alpha-spectrin genes reveals strict homology among diverse species.

The spectrins are a family of widely distributed filamentous proteins. In association with actin, spectrins form a supporting and organizing scaffold for cell membranes. Using antibodies specific for human brain alpha-spectrin (alpha-fodrin), we have cloned a rat brain alpha-spectrin cDNA from an expression library. Several closely related human clones were also isolated by hybridization. Comparison of sequences of these and other overlapping nonerythroid and erythroid alpha-spectrin genes demonstrated that the nonerythroid genes are strictly conserved across species, while the mammalian erythroid genes have diverged rapidly. Peptide sequences deduced from these cDNAs revealed that the nonerythroid alpha-spectrin chain, like the erythroid spectrin, is composed of multiple 106-amino-acid repeating units, with the characteristic invariant tryptophan as well as other charged and hydrophobic residues in conserved locations. However, the carboxy-terminal sequence varies markedly from this internal repeat pattern and may represent a specialized functional site. The nonerythroid alpha-spectrin gene was mapped to human chromosome 9, in contrast to the erythroid alpha-spectrin gene, which has previously been assigned to a locus on chromosome 1.     

Generation of diversity in nonerythroid spectrins. Multiple polypeptides are predicted by sequence analysis of cDNAs encompassing the coding region of human nonerythroid alpha-spectrin

Nonerythroid alpha-spectrin (alpha-fodrin) is a major component of the membrane skeleton in diverse cell types. Overlapping cDNAs have been isolated which encompass the coding region of human lung fibroblast nonerythroid alpha-spectrin. The composite sequence of 7,787 nucleotides encodes a polypeptide of 2,472 amino acids (predicted Mr of 283,964). This sequence has 58% amino acid identity with human erythroid alpha-spectrin, which is encoded on a different gene, and 96% amino acid identity with the full-length sequence of chicken brain alpha-spectrin. We previously reported the variable expression in human fibroblast alpha-spectrin of 20 amino acids between repeats 10 and 11 (McMahon, A. P., Giebelhaus, D. H., Champion, J. E., Bailes, J. A., Lacey, S., Carritt, B., Henchman, S. K., and Moon, R. T. (1987) Differentiation 34, 68-78). In this study, we report additional heterogeneity in fibroblast alpha-spectrin near the carboxyl-terminal end. One of the fibroblast cDNAs (clone 3D) has an in-frame deletion of 18 nucleotides within spectrin repeat 21 when compared to an overlapping fibroblast cDNA (clone 7). As this heterogeneity in amino acid sequence occurs near domains of nonerythroid alpha-spectrin suggested to bind calcium or actin, it is possible that fibroblasts express functionally distinct isoforms of nonerythroid alpha-spectrin.     

The globular domains of type VI collagen are related to the collagen-binding domains of cartilage matrix protein and von Willebrand factor.

Type VI collagen is a transformation-sensitive glycoprotein of the extracellular matrix of fibroblasts. We have isolated and sequenced several overlapping cDNA clones (4153 bp) which encode the entire alpha 2 subunit of chicken type VI collagen. The deduced amino acid sequence predicts that the alpha 2(VI) polypeptide consists of 1015 amino acid residues that are arranged in four domains: a hydrophobic signal peptide of 20 residues, an amino-terminal globular domain of 228 residues, a collagenous segment of 335 residues and a carboxy-terminal globular domain of 432 residues. The collagenous domain contains seven Arg-Gly-Asp tripeptide units, some of which are likely to be used as cell-binding sites. The globular domains contain three homologous repeats with an average length of 180 amino acid residues. These repeats show a striking similarity to the collagen-binding motifs found in von Willebrand factor and cartilage matrix protein. We therefore speculate that the globular domains of the alpha 2(VI) polypeptide may interact with collagenous structures.     

Isolation and sequence determination of cDNA encoding PMP-22 (PAS-II/SR13/Gas-3) of human peripheral myelin.

A full length cDNA of PMP-22 (PAS-II/SR13/Gas-3) of peripheral myelin has been isolated from a cDNA library of human fetus spinal cord. The clone is 1823 base pairs (bp) in length and contains a 480 bp open reading frame encoding a polypeptide of 160 residues. The deduced amino acid sequence is highly homologous to PMP-22 from bovine (PAS-II), rat (SR13) and mouse (Gas-3).     

Characterization of the calmodulin-binding site of nonerythroid alpha-spectrin. Recombinant protein and model peptide studies

An important function of the mammalian nonerythroid alpha-spectrin chain (alpha-fodrin) that distinguishes it from the closely related erythroid isoform is its ability to bind calmodulin. By analysis of a series of deleted recombinant spectrin fusion proteins, we have identified a region in the nonerythroid alpha chain involved in calcium-dependent binding of calmodulin. The region is distinctive in that the sequence is absent from the homologous domain of the erythroid alpha chain and diverges from the normal internal repeat structure observed throughout other spectrins. In order to determine limits of this functional site, a synthetic peptide as small as 24 residues was shown to compete with either recombinant or brain alpha-spectrin in binding to calmodulin. The active peptide, which was derived from a segment between repeats 11 and 12, was composed of the following sequence: Lys-Thr-Ala-Ser-Pro-Trp-Lys-Ser-Ala-Arg-Leu-Met-Val-His-Thr-Val-Ala-Thr-Phe-Asn - Ser-Ile-Lys-Glu. Comparison of this sequence with functional sites in other diverse calcium-dependent calmodulin-binding proteins has revealed a structural motif common to all of these proteins, namely clusters of hydrophobic residues interspersed with basic residues. When folded into alpha-helical conformations, these binding sites are predicted to form amphipathic structures.     

Sequence homologies of diverse length tandem repetitions near ends of vaccinia virus genome suggest unequal crossing over.

The 180,000 base pair (bp), covalently closed, linear duplex DNA genome of vaccinia virus contains a 10,000 bp inverted terminal repetition within which are one set of 13 and one set of 18 tandem 70 bp repeating units. A 967 bp segment containing the innermost 70 bp repeat and an adjacent region notable for a scarcity of restriction endonuclease sites has been sequenced. This was facilitated by the cloning of TaqI and partial TaqI fragments in pBR322. We found that the innermost 70 bp repeat overlaps one of two adjacent 125 bp repeats, following which are eight repeats of 54 bp, parts of 54 bp and 70 bp repeats, and four consecutive 6 to 7 bp repeats. The 70, 125, and 54 bp repeating units have extensive sequence homologies and redundancies that suggest evolution by unequal crossing over. Schemes whereby unequal crossovers of 54 bp repeats lead to a recombinant segment 86% homologous to the 125 bp repeat and unequal crossovers of 125 bp repeats lead to a recombinant segment 94% homologous to the 70 bp repeat were considered. This propensity for sequence divergence should provide a useful marker for comparing the relatedness of poxviruses.     

The heterochromatin of grasshoppers from the Caledia captiva species complex. I. Sequence evolution and conservation in a highly repeated DNA family

The restriction enzyme TaqI digests 0.2% of the genomic DNA from the grasshopper Caledia captiva to a family of sequences 168 bp in length (length of consensus sequence). The sequence variation of this "Taq family" of repeat units was examined among four races from C. captiva to assay the pattern of evolution within this highly repeated DNA. The Taq-family repeats are located in C-banded heterochromatin on at least one member of each homologous pair of chromosomes; the locations range from centromeric to telomeric. Thirty-nine cloned repeats isolated from two population 1A individuals along with 11 clones from seven populations taken from three of the races demonstrated sequence variation at 72 positions. Pairwise comparisons of the cloned repeats, both within an individual and between different races, indicate that levels of intraspecific divergence, as measured by reproductive incompatibility, do not correlate with sequence divergence among the 168-bp repeats. A number of subsequences within the repeat remain unchanged among all 50 clones; the longest of these is 18 bp. That the same 18-bp subsequence is present in all clones examined is a finding that departs significantly (P less than 0.01) from what would be expected to occur at random. Two other cloned repeats, from a reproductively isolated race of C. captiva, have sequences that show 56% identity with this 18-bp conserved region. An analysis showed that the frequency of occurrence of an RsaI recognition site within the 168- bp repeat in the entire Taq family agreed with that found in the cloned sequences. These data, along with a partial sequence for the entire Taq family obtained by sequencing uncloned repeats, suggest that the consensus sequence from the cloned copies is representative of this highly repeated family and is not a biased sample resulting from the cloning procedure. The 18-bp conserved sequence is part of a 42-bp sequence that possesses dyad symmetry typical of protein-binding sites. We speculate that this may be significant in the evolution of the Taq family of sequences.      

Primary structure of the brain alpha-spectrin [published erratum appears in J Cell Biol 1989 Mar;108(3):following 1175]

We have determined the nucleotide sequence coding for the chicken brain alpha-spectrin. It is derived both from the cDNA and genomic sequences, comprises the entire coding frame, 5' and 3' untranslated sequences, and terminates in the poly(A)-tail. The deduced amino acid sequence was used to map the domain structure of the protein. The alpha-chain of brain spectrin contains 22 segments of which 20 correspond to the repeat of the human erythrocyte spectrin (Speicher, D. W., and V. T. Marchesi. 1984. Nature (Lond.). 311:177-180.), typically made of 106 residues. These homologous segments probably account for the flexible, rod-like structure of spectrin. Secondary structure prediction suggests predominantly alpha-helical structure for the entire chain. Parts of the primary structure are excluded from the repetitive pattern and they reside in the middle part of the sequence and in its COOH terminus. Search for homology in other proteins showed the presence of the following distinct structures in these nonrepetitive regions: (a) the COOH-terminal part of the molecule that shows homology with alpha-actinin, (b) two typical EF-hand (i.e., Ca2+-binding) structures in this region, (c) a sequence close to the EF-hand that fulfills the criteria for a calmodulin-binding site, and (d) a domain in the middle of the sequence that is homologous to a NH2-terminal segment of several src-tyrosine kinases and to a domain of phospholipase C. These regions are good candidates to carry some established as well as some yet unestablished functions of spectrin. Comparative analysis showed that alpha-spectrin is well conserved across the species boundaries from Xenopus to man, and that the human erythrocyte alpha-spectrin is divergent from the other spectrins.     

Tnat1 and Tnat2 from Arabidopsis thaliana: novel transposable elements with tandem repeat sequences.

A computer-aided homology search of databases found that the nucleotide sequences flanking ATLN44, a non-LTR retrotransposon (LINE) from Arabidopsis thaliana, are repeated in the A. thaliana genome. These sequences are homologous to flanking sequences of 664 bp with terminal inverted repeat sequences of about 70 bp. The 664-bp sequence and most of the 14 homologues identified were flanked by direct repeat sequences of 9 bp. These findings indicate that the repeated sequence, named Tnat1, is a transposable element that duplicates a 9-bp sequence at the target site on transposition and that ATLN44 is inserted in one Tnat1 member. Interestingly, all of the Tnat1 members had tandem repeats comprised of several units of a 60-bp sequence, the number of repeats differing among Tnat1 members. Of the Tnat1 members identified, one was inserted into another sequence repeated in the A. thaliana genome: that sequence is about 770 bp long and has terminal inverted repeat sequences of about 110 bp. The sequence is flanked by direct repeats of a 9-bp sequence, indicating that it is another transposable element, named Tnat2, from A. thaliana. Moreover, Tnat2 members had a tandem repeat about 240 bp long. Tnat1 and Tnat2 with tandem repeats in their internal regions show no homology to each other or to any of the elements identified previously; therefore they appear to be novel transposable elements.     

Isolation and sequence determination of cDNA encoding P2 protein of human peripheral myelin.

A full length cDNA of P2 protein of peripheral myelin has been isolated from a cDNA library of human fetus spinal cord. The clone is 2150 base pairs (bp) in length and contains a 393 bp open reading frame encoding a polypeptide of 131 residues. The deduced amino acid sequence is highly homologous to P2 protein from other species.     

From the spectrin gene to the assembly of the membrane skeleton

The complete nucleotide sequence coding for the chicken brain alpha-spectrin was determined. It comprises the entire coding frame, 5'- and 3'-untranslated sequences terminating in a poly(A)-tail. The deduced amino acid sequence shows that the alpha-chain contains 22 segments, 20 of which correspond to the typical 106 residue repeat of the human erythrocyte spectrin. Some segments non-homologous to the repeat structure reside in the middle and COOH-terminal regions. Sequence comparisons with other proteins show that these segments evidently harbour some structural and functional features such as: homology to alpha-actinin and dystrophin, two typical EF-hand structures (calcium-binding) and a putative calmodulin-binding site in the COOH-terminus and a sequence homologous to various src-tyrosine kinases and to phospholipase C in the middle of the molecule. Comparison of our sequence with other partial alpha-spectrin sequences shows that alpha-spectrin is well conserved in different species and that the human erythrocyte alpha-spectrin is divergent.     

Isolation and sequence determination of cDNA encoding the major structural protein of human peripheral myelin.

A full length cDNA of the major structural protein of peripheral myelin (P0 protein) has been isolated from a cDNA library of human fetus spinal cord. The clone is 1948 base pairs (bp) in length and contains a 744 bp open reading frame encoding a polypeptide of 248 residues including 29 signal peptide. The deduced amino acid sequence is highly homologous to P0 protein from other species.     

Nucleotide sequence of a cDNA for the alpha subunit of human mitochondrial ATP synthase.

A full length cDNA clone of the alpha subunit of mitochondrial ATP synthase (EC 3.6.1.34) has been isolated from a cDNA library prepared from LX-1 human tumor cells in the lambda-Zap vector. The clone is 1883 base pairs (bp) in length and contains a 1659 bp open reading frame encoding a polypeptide of 553 residues. The deduced amino acid sequence is highly homologous to ATP synthase from several other species.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

Molecular characterization of a family of tandemly repeated DNA sequences,TR-1, in heterochromatic knobs of maize and its relatives

Two families of tandem repeats, 180-bp and TR-1, have been found in the knobs of maize. In this study, we isolated 59 clones belonging to the TR-1 family from maize and teosinte. Southern hybridization and sequence analysis revealed that members of this family are composed of three basic sequences, A (67 bp); B (184 bp) or its variants B' (184 bp), 2/3B (115 bp), 2/3B' (115 bp); and C (108 bp), which are arranged in various combinations to produce repeat units that are multiples of approximately 180 bp. The molecular structure of TR-1 elements suggests that: (1) the B component may evolve from the 180-bp knob repeat as a result of mutations during evolution; (2) B' may originate from B through lateral amplification accompanied by base-pair changes; (3) C plus A may be a single sequence that is added to B and B', probably via nonhomologous recombination; and (4) 69 bp at the 3' end of B or B', and the entire sequence of C can be removed from the elements by an unknown mechanism. Sequence comparisons showed partial homologies between TR-1 elements and two centromeric sequences (B repeats) of the supernumerary B chromosome. This result, together with the finding of other investigators that the B repeat is also fragmentarily homologous to the 180-bp repeat, suggests that the B repeat is derived from knob repeats in A chromosomes, which subsequently become structurally modified. Fluorescence in situ hybridization localized the B repeat to the B centromere and the 180-bp and TR-1 repeats to the proximal heterochromatin knob on the B chromosome.     

The organisation,nucleotide sequence,and chromosomal distribution of a satellite DNA from Allium cepa

We have investigated the organisation, nucleotide sequence, and chromosomal distribution of a tandemly repeated, satellite DNA from Allium cepa (Liliaceae). The satellite, which constitutes about 4% of the A. cepa genome, may be resolved from main-band DNA in antibiotic-CsCl density gradients, and has a repeat length of about 375 base pairs (bp). A cloned member of the repeat family hybridises exclusively to chromosome telomeres and has a non-random distribution in interphase nuclei. We present the nucleotide sequences of three repeats, which differ at a large number of positions. In addition to arrays made up of 375-bp repeats, homologous sequences are found in units with a greater repeat length. This divergence between repeats reflects the heterogeneity of the satellite determined using other criteria. Possible constraints on the interchromosomal exchange of repeated sequences are discussed.     

The spectrin super-family

The review is focused on recent data on the primary sequences of erythroid and non-erythroid spectrins. As in other fields, the techniques of molecular genetics have allowed great advances in our knowledge of the structure and the genetic story of these molecules. Comparison of alpha-chains sequences of the non-erythroid (fodrin) and erythroid spectrin demonstrated that the fodrin alpha-genes are strictly conserved across species, while the mammalian spectrin genes have diverged rapidly. Spectrin and fodrin alpha-chains are largely composed of homologous 106-amino-acid repeat units. Spectrin alpha-chain is lacking a 37 amino-acid sequence which bears the calmodulin-binding site of the fodrin alpha-chain. The highest degree of homology between the spectrin alpha-chain and the fodrin alpha-chain lies in a central atypical segment unrelated to the canonical repeat sequence. This region is closely related to the N-terminal segment of several src-tyrosine kinases and to a domain of phospholipase C. Like the spectrin alpha-chain, the major central part of the spectrin beta-chain is made up of repeat units of 106 amino-acids. The N-terminal domain of the beta-chain, and especially the actin binding site, is the region of greatest homology among members of the spectrin super-family, including Drosophila spectrin beta-chain, dystrophin and alpha-actinin. The C-terminal extremity of the erythroid beta-chain is also of great interest, since tissue-specific differential processing of 3'beta-spectrin gene pre-mRNA generates a beta spectrin-isoform with a unique C-terminus in human skeletal muscle.