Rheological study into the ageing process of high methoxyl pectin/sucrose aqueous gels

The ageing process of high methoxyl pectin (HMP)/sucrose gels was followed at different ageing temperatures by small amplitude oscillatory experiments. Dynamic mechanical measurements allowed the characterisation of the point at which the system undergoes the sol/gel transition. The HMP/sucrose system is extremely sensitive to temperature variation during ageing, especially in the lower temperature range. The viscoelastic behaviour through the gel point changes with the ageing temperature, probably due to variations in mobility of the pectin chains, and consequently, in the lifetime of junction zones. Weaker pectin networks are formed under thermal conditions unfavourable to the development of hydrophobic interactions. Gel time and elastic modulus have a complex dependence on temperature, which could be attributed to the different thermal behaviour of the intermolecular interactions that stabilise the nonpermanent cross links of these physical networks.     

Critical helix content in gelatin gels

Aqueous gelatin solutions of different concentrations have been investigated at various quench temperatures by viscosity measurements to determine the gel times and by optical rotation measurements to derive the evolution of the helix content by reference to native collagen. As a result, it appears that the gelation of the different aqueous gelatin solutions tested takes place at a common helix concentration independent of the initial gelatin concentration and quench temperature. Further, for each concentration, the dependence of gel time as a function of quench temperature has revealed the existence of two domains: a higher temperature domain where gel times increase strongly with quench temperature and a lower temperature domain where gel times are short and only slightly dependent on quench temperature.     

A calorimetric study of the triple helix formation: interaction of poly(C) - guanosine - protonated poly(C).]

The triple helix formation of poly(C) - guanosine - poly(C+) was investigated by the help of an LKB scanning micro-calorimeter. The existence of the triple helix could also be shown by recording the melting curves. The ultraviolet absorption at different wave lengths namely 275 nm, 260 nm, and 245 nm was plotted as a function of the temperature. Furthermore formation of the triple helix was shown by plotting the ultraviolet absorption at 245 nm during the increasing addition of guanosine solution to a fixed amount of poly(C) in the solution. Finally the formation of the triple helix was demonstrated by plotting the ultraviolet absorption at 245 nm of a certain mixture of the components while the pH value of the solution was continuously lowered. All these methods show that the monomer interacts with the polymer double helix to form a triple helix. The calorimetric measurements show that the reaction enthalpy is concentration dependent. Above a threshold concentration a rapid increase of the reaction enthalpy is observed. This increase occurs in a very narrow concentration interval. Above this interval a final value of the reaction enthalpy is reached. The amount of the reaction enthalpy for the interaction of guanosine with poly(C) - poly(C+) double helix is 5.5 Kcal (mol base triplet)-1.     

Stereocontrolled Synthesis of an Octasaccharide Part of I-Active Glycolipids

The effects of glycerin and ethylene glycol on the elastic modulus and DSC thermograms of agarose and kappa-carrageenan gels were examined to clarify the relation between structure and properties. The elastic modulus of these gels as a function of the concentration of polyols increased up to a certain concentration and then decreased with increasing concentration of polyols. These polyols shifted the melting temperature of the gel to higher temperatures in kappa-carrageenan gels but to lower temperatures in agarose gels. The temperature dependence of elastic modulus was changed in opposite directions in agarose and kappa-carrageenan gels by the addition of polyols, and this is discussed on the basis of model consisting of junction zones which are connected by Langevin chains. It was suggested that the mean distance between junction zones became shorter in the presence of a small amount of polyols.     

Binding effect of Cu(2+) as a trigger on the sol-to-gel and the coil-to-helix transition processes of polysaccharide, gellan gum

The binding effect of divalent cation Cu(2+) on the gelation process with a coil-helix transition in Cu(2+)/gellan aqueous solutions has been successfully elucidated by EPR, CD, and viscoelasticity measurements. Generally, Na-type gellan gum in aqueous solution can make gel when accompanied by an intrinsic coil-helix formation induced by hydrogen bonding between chains without any additional cations at T(ch)(-)(in) ( approximately 29 degrees C) with cooling temperature. An extrinsic coil-helix transition, induced by additional divalent cations in advance of the intrinsic sol-gel transition of gellan gum, is separately detected by CD measurement. The extrinsic coil-helix transition temperatures T(ch)(-)(ex) (>47 degrees C), which increased with the Cu(2+) concentration added, were nearly identical to the sol-gel transition temperature, T(sg), determined by the viscoelasticity measurement. Judging from the molar ellipticity by CD measurement and quantitative analysis of EPR spectra, it was elucidated that the helix forming process via divalent cations is composed of two steps ascribed to the different origins, i.e., a chemical binding effect via Cu(2+) ions in the initial stage and hydrogen bonds subsequently. Finally, we propose the coil-helix and the sol-gel transition mechanism initiated by the binding effect with the divalent cation, in which the partial chelate formation can cause local formation of helices and junction zones in the vicinity of the chelates at the initial stage of the process and stabilize the helices and the junction zones. On the other hand, the stabilized helices and junction zones can induce further formation and further stabilization of the Cu(2+)-gellan chelates. The mutual stabilization promotes the formation of three-dimensional network structure at the higher temperature than the intrinsic temperature for network formation.     

Effects of Polyols and Sugars on the Sol-Gel Transition of Gelatin

The melting temperature of gelatin gel increased with increasing concentrations of polyols and sugars added at any gelatin concentation. The enthalpy of gel melting measured by Eldridge-Ferry plots and calorimetric measurements was decreased by addition of these polyhydric compounds, indicating that the gel stabilization by them is predominantly due to the large decrease in entropy of gel melting. Circular dichroism analysis showed that the helix formation of gelatin molecules was enhanced with increasing concentrations of these additives, but there was no positive correlation between their helix-forming ability and gel-stabilizing ability. The viscosity of gelatin solution was less in these mixed solvents than in water. Based on these results, a possible stabilization mechanism of gelatin gel by polyhydric compounds was discussed, in comparison with that of native collagen, in terms of the thermodynamics of protein-solvent interactions.     

Reexamining the egg-box model in calcium-alginate gels with X-ray diffraction

The structure of the Ca--alginate junction zones was investigated with X-ray scattering on gels prepared with different methods. Fiber diffraction reveals the popular egg-box model may not be the only possible structure for the junction zones. The (001) reflection, which should be extinguished due to 2/1 helical conformation in the egg-box model, was observed. This was further confirmed by the measurements on Ca--alginate gel beads prepared at different pH where large pieces were formed through a relatively slow process, which leads to a higher crystallinity and a more perfect ordering. The results suggest a 3/1 helical conformation is more proper for Ca--alginate gels formed slowly. This does not exclude the possibility for the 2/1 helical conformation in fast gelatinized Ca--alginate in which the 2/1 helix is a metastable form. Comparing the X-ray scattering results of the fresh, dehydrated, and rehydrated gels, a reversible aggregation of junction zones is found during dehydration and rehydration. The different stabilities of initial bonds and bonds formed during drying are speculated to be the contribution of MG block or short G blocks in the junction zones.     

Decreased thermal denaturation temperature of osteogenesis imperfecta mutant collagen is independent of post-translational overmodifications of lysine and hydroxylysine

Fibroblasts from many patients with osteogenesis imperfecta (OI) synthesize and secrete Type I collagen which is both overmodified and exhibits a decreased thermal denaturation temperature. We have examined the relationship between overmodification and decreased melting temperature in several favorable OI mutants by selectively inhibiting lysyl hydroxylase activity with the drug Minoxidil and comparing the melting profiles of the resultant undermodified collagen with untreated control. Minoxidil treatment causes an appreciable decrease in hydroxylysine with compensatory increases in lysine content, and the delayed sodium dodecyl sulfate-polyacrylamide gel electrophoretic mobility of the overmodified collagen chains becomes normal. However, the decreased melting temperature was unchanged from untreated OI control. When unhydroxylated collagen produced by normal control and OI fibroblasts incubated with alpha,alpha'-dipyridyl was examined, mutant OI molecules melted at a lower temperature than control. These data indicate that the decreased thermal denaturation temperature of OI mutant collagen is independent of post-translational overmodification of lysine or hydroxylysine. Presumably, substitutions for glycine in the Gly-X-Y structural motif distort the helix and produce lower melting temperatures by presently unknown mechanisms.     

Steady-state and pulsed NMR studies of gelation in aqueous agarose

Steady-state and pulsed NMR techniques have been used to investigate molecular motion in sols and gels of agarose. In passing through the sol–gel transition, the molecular mobility of water molecules is reduced only by a small amount, whereas motion of the polymer chains is greatly attenuated. The results are discused in terms of the network theory of gelation, with references to the role of water in the process and the nature of the “junction zones” between polymer chains. T₂ and line-width measurements are dominated by exchange broadening. The effects of exchange rate and differences in relaxation time between the exchanging sites are discussed. The temperature hysteresis behavior of agarose gels has been investigated and the effects of “ageing” correlated with changes in nuclear relaxation times. The synergistic increase in gel strength obtained on adding locust bean gum (LBG) to agarose has been investigated. The results indicate that LBG does not form double-helix junctions and may decrease rates of gelation by steric effects. At high agarose concentration, the LBG remains mainly in solution in interstitial water, but at low agarose concentration, it is suggested that the LBG can link gel aggregates together into a self-supporting structure, producing a synergistic increase in gel strength. Comparisons have been made between the nature of the agarose–LBG interaction and agarose–cellulose interactions in biological systems.     

The melting behavior of a DNA junction structure: a calorimetric and spectroscopic study

We present an investigation of the helix–coil transition in a stable branched oligomer of DNA, known as an immobile DNA junction. This junction is composed of four 16-mer strands, which yield four double-helical arms, each containing 8 nucleotide pairs. Properties of the individual arms of this complex are modeled by four octameric duplexes. We have performed experiments using calorimetry, uv absorbance, and CD spectroscopy to characterize the melting transitions of the junction and each arm. By comparing our spectroscopic and calorimetric results on the junction and its component arms, we are able to conclude the following: (1) The calorimetric transition enthalpy for the overall junction complex is equal to the sum of the calorimetric transition enthalpies of the four constituent duplex arms. (2) The optical and the calorimetric measurements yield qualitatively similar, but not identical thermodynamic data. (3) The melting temperature of the junction is less dependent on concentration than the melting temperatures of the individual arms. We attribute this observation to the tetrameric nature of the junction. (4) The ratio of the calorimetric transition enthalpy of the junction and its corresponding van't Hoff value is close to unity. (5) The CD spectrum of the junction is equal quantitatively to the sum of the B-like CD spectra of the four constituent duplex arms.     

Hinging of rabbit myosin rod

The question of hinging in myosin rod from rabbit skeletal muscle has been reexamined. Elastic light scattering and optical rotation have been used to measure the radius of gyration and fraction helix, respectively, as a function of temperature for myosin rod, light meromyosin (LMM), and long subfragment 2 (long S-2). The radius of gyration vs temperature profile of myosin rod is shifted with respect to the optical rotation melting curve by about -5 degrees C. Similar studies on both LMM and long S-2 show virtually superimposable profiles. To correlate changes in the secondary structure with the overall conformation, plots of radius of gyration vs fraction helix are presented for each myosin subfragment. Myosin rod exhibits a marked decrease in the radius of gyration from 43 nm to approximately 35 nm, while the fraction helix remains at nearly 100%. LMM and long S-2 did not show this behavior. Rather, a decrease in the radius of gyration of these fragments occurred with comparable changes in fraction helix. These results are interpreted in terms of hinging of the myosin rod within the LMM/S-2 junction.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

The effect of free fatty acids on the thermotropic phase transition of dimyristoyl glycerophosphocholine

The effect of free fatty acids on the phase transition characteristics and fluidity of bilayers of dimyristoyl glycerophosphocholine were studied by pyrene eximer fluorescence and differential scanning calorimetry. High melting saturated fatty acids with chain lengths of 12–18 carbon atoms raise the phase transition temperature and enhance the ability of pyrene to form clusters in the gel state while not affecting the fluidity of the membrane in the liquid crystal state. Low melting unsaturated fatty acids lower the phase transition temperature and decrease the ability of pyrene to form clusters in the gel state while not affecting the fluidity of the membrane in the liquid crystal state. The effects of the very long chain fatty acids, arachidic (C 20) and behenic (C 22) appear to be similar to those of cholesterol in that they cause a broadening of the phase transition with a lowering of the transition enthalpy but have little effect on the temperature at which the phase transition occurs.     

DNA binding proteins from Tetrahymena thermophila

We have used DNA-cellulose chromatography to isolate single-strand binding proteins from Tetrahymena thermophila. Three major proteins which bind to denatured DNA-cellulose were obtained. The predominant protein has a molecular weight of 20 000 in sodium dodecyl sulfate - polyacrylamide gel electrophoresis and possesses many of the properties of the helix destabilizing proteins isolated from prokaryotic and eukaryotic sources. The protein facilitates denaturation of the synthetic copolymer poly[d(A-T).d(A-T)], depressing the melting temperature by nearly 40 degrees C. It also permits the renaturation of poly[d(A-T)].d(A-T)] in high salt concentration. Two other binding proteins have molecular weight of 25 000 and 23 000 in sodium dodecyl sulfate - polyacrylamide gel electrophoresis. The protein with a molecular weight of 25 000 is probably the "M protein" previously isolated from Tetrahymena thermophila which has been shown to stimulate Tetrahymena DNA polymerase. These two proteins failed to show helix destabilizing, DNA dependent ATPase, or deoxyribonuclease activities. These three proteins are abundant in the cell with approximately 1.0 x 10(6) to 10.0 x 10(6) molecules of each protein monomer per cell. One molecule of each protein monomer binds to 7 to 10 nucleotides as detected by a nitrocellulose filter binding assay. Peptide mapping of the three proteins suggests that they are all distinct. We have also found that the binding proteins can interact with Tetrahymena DNA polymerase and some other proteins to form an enzyme complex, a putative replication complex.     

Nmr studies of mixtures of poly-L-lysine hydrobromide with water

¹H, ²H, ¹³C, and ⁸¹Br nmr measurements of mixtures of poly-L -lysine hydrobromide with water have been carried out over a range of temperatures and water contents. When n (number of molecules of water per residue) ～13 at room temperature, a transition occurs from a gel to a liquid phase. The liquid phase contains polymer molecules that are flexible, but contain more intramolecular structure than the same molecules in trifluoracetic acid solution. The gel phase contains junction zones of hexagonally packed α-helices, linked by flexible regions of polypeptide chain. The α-helical residues impart to their associated water molecules a slight anisotropy of motion, which is dectable by ²H nmr. These residues bind up to about seven molecules of water each; the other six required to complete the gel–liquid transition space out the polymer molecules, allowing increased segmental motion of the residues in the flexible regions. This increased motion reduces the energy of the flexible regions and thus increases the proportion of residues in them (increasing the temperature has the same effect); the transition occurs when insufficient residues remain in the α-helical junction zones.     

Calorimetric and chiroptical evidence of aggregate-driven helix formation in carrageenan systems

Thermally induced, order-disorder transitions of iota- and kappa-carrageenan have been monitored by optical rotation and differential-scanning calorimetry in various ionic environments. Conformational ordering in kappa-carrageenan is observed only in the presence of cations that have been shown previously to promote helix-helix aggregation, and shows marked hysteresis between heating and cooling. Iota-carrageenan, by contrast, shows an order-disorder transition in the non-aggregating, tetramethylammonium salt form, at substantially lower temperature than for kappa-carrageenan, and without hysteresis. In the presence of potassium ions, which are known to promote aggregation, iota-carrageenan shows two distinct thermal-transitions, one without hysteresis at the same temperature as observed under non-aggregating conditions, and one with significant hysteresis close to the temperature of the kappa-carrageenan transition. We interpret these transitions as helix-to-coil and aggregated helix-to-coil, respectively. This interpretation is supported by measurements of the enthalpy changes of the transitions; ΔH values show a systematic increase with increasing aggregation and hysteresis. We conclude that the double helix of iota-carrageenan can exist as a stable entity in isolation, but may be further stabilised by aggregation, whereas the kappa-carrageenan helix is stable only when aggregated.     

Structural characteristics and rheological properties of partially hydrolyzed oat β-glucan: the effects of molecular weight and hydrolysis method

Partial hydrolysates of (1→3)(1→4)-β- -glucan from oats were produced by three hydrolysis methods: acid, cellulase or lichenase. The molecular weights ranged from 31 000 to 237 000 g/mol. Six percent solutions of small molecular weight β-glucans formed elastic gels after 4 days at 4 °C whereas larger molecular weight β-glucans remained viscous liquids after 7 days. The melting temperature of the gels increased as they aged and the peak heat flow temperature, measured by differential scanning calorimetry, was 62±2 °C. Partial hydrolysates produced with cellulase, which was shown to preferentially cleave regions of the molecule with longer contiguous β-(1→4)-linked -glucopyranosyl units, tended to produce more elastic gels with stronger junction zones than partial hydrolysates produced with lichenase which cleaves the β-(1→4) glycosidic 3-o-substituted glucose links. This suggests that β-(1→3)-linked cellotriose sections of the polymer are probably the segments which form the junction zones in the gel network rather than cellulose-like segments.     

Thermal stability of myosin rod from various species

The radius of gyration and fraction helix as a function of temperature have been determined for myosin rod from four different species: rabbit, frog, scallop, and antarctic fish. Measurements from sodium dodecyl sulfate gel electrophoresis indicate that all particles have the same molecular weight (approximately 130K). All fragments are nearly 100% alpha-helical at low temperatures (0-5 degrees C). The melting profiles for each are qualitatively similar in shape, but their midpoints are shifted along the temperature axis in the following order: antarctic fish (Tm = 33 degrees C), scallop (Tm = 39 degrees C), frog (Tm = 45 degrees C), and rabbit (Tm = 49 degrees C). Corresponding radius of gyration vs temperature profiles for each species are shifted to lower temperatures (approximately 5-8 degrees C) with respect to the optical rotation melting curves. From plots of radius of gyration vs fraction helix, we find a marked drop in the radius of gyration (from 43 to approximately 34 nm) with less than a 5% decrease in fraction helix for rabbit, frog, and antarctic fish rods, whereas the radius of gyration of scallop rod never exceeds 34 nm. Results indicate hinging of the myosin rod of each species. The thermal stabilities of the myosin rods shift in parallel with the working temperature of their respective muscles.