共查询到20条相似文献,搜索用时 109 毫秒
1.
2.
3.
4.
5.
6.
Todd J. Ward Thomas Usgaard Peter Evans 《Applied and environmental microbiology》2010,76(19):6680-6684
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number ).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table NC_003210(Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology. 相似文献
TABLE 1.
Primers used in multiplex amplification for the TMLGT assayAmplicon | Positiona | Gene(s) | Primer | Sequence (5′-3′)b |
---|---|---|---|---|
INLa | 455381-456505 | inlA | inl2-a1 | GTCCTTGATAGTCTACTG |
inl2-a2 | ACCAAATTAGTAATCTAGCAC | |||
INLb | 457726-458752 | inlB | inl-f1d | GAATTRTTTAGYCAAGAATGT |
inlb-r | CTACCGGRACTTTATAGTAYG | |||
LMO | 325116-326096 | lmo0298-lmo0300 | lmo-a1 | AAGGCTTACAAGATGGCT |
lmo1a-1r | AAATAATAYGTGATACCGAC | |||
VGCa | 205366-206622 | plcA, hly | plca-f | CTCATCGTATCRTGTGTACC |
hly-r | TCTGGAAGGTCKTGTAGGTTC | |||
VGCb | 208447-209465 | mpl | ra_mpl-f | GTGGAYAGAACTCATAAAGG |
ra_mpl-r | ACTCCCTCCTYGTGATASGCT | |||
VGCc | 209728-211239 | actA | vgc1a-2f | TTCMATRCCAGCAGAACG |
vgc1a-2r | GCAGACCTAATAGCAATGTTG |
TABLE 2.
TMLGT probes and probe performance dataProbeb | Target (n)c | Probe sequenced | IDe | Sensitivity (%) | Specificity (%) |
---|---|---|---|---|---|
VGCb-21 | Lineage I (506) | AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc | 7.3 | 100 | 100 |
VGCa-94 | Lineage I | CTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc | 51.7 | 100 | 100 |
VGCc-8 | Lineage II (340) | AATCCTTTTACATTCATTACTTACattagctgattcgctttcct | 14.1 | 100 | 100 |
INLb-51 | Lineage II | TCATTTCAATCAATCATCAACAATagcgccaataaagctggc | 21.9 | 100 | 100 |
VGCb-19 | Lineage III (50) | TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca | 31.0 | 100 | 100 |
VGCb-29 | Lineage III | AATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt | 45.1 | 100 | 100 |
LMO-17 | Lineage IV (10) | CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt | 11.8 | 100 | 100 |
VGCa-27 | Lineage IV | CTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac | 58.3 | 100 | 100 |
INLb-84 | Serogroup 4b (213) | TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg | 9.7 | 100 | 100 |
INLb-85 | Serogroup 4b | ATACTACATCATAATCAAACATCActcgtgaacaagctttcc | 5.5 | 100 | 100 |
INLb-16 | Serogroup 1/2b (293) | AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta | 11.7 | 100 | 100 |
INLb-100 | Serogroup 1/2b | CTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat | 13.0 | 100 | 100 |
LMO-42 | Serogroup 1/2a (268) | CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg | 6.6 | 100 | 100 |
VGCb-40 | Serogroup 1/2a | CTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag | 10.4 | 100 | 98.6 |
LMO-9 | Serogroup 1/2c (72) | TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg | 13.5 | 100 | 100 |
VGCb-5 | Serogroup 1/2c | CAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac | 20.8 | 98.6 | 100 |
LMO-10 | ECI (111) | ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag | 19.0 | 100 | 100 |
LMO-28 | ECI | CTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt | 23.7 | 100 | 100 |
VGCc-80 | ECIa (44) | CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc | 10.7 | 100 | 100 |
VGCa-35 | ECIa | CAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt | 9.2 | 100 | 100 |
LMO-12 | ECII (35) | TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt | 3.8 | 100 | 100 |
LMO-30 | ECII | TTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa | 7.5 | 100 | 100 |
VGCc-45 | ECIII (10) | TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc | 21.1 | 100 | 99.4 |
INLa-3 | ECIII | TACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta | 17.0 | 100 | 99.4 |
INLa-1 | INLa control | CTTTAATCTCAATCAATACAAATCagaagtggaagctgggaa | NAa | NA | NA |
INLb-13 | INLb control | CAATAAACTATACTTCTTCACTAAtgcacctaaacctccgac | NA | NA | NA |
LMO-88 | LMO control | TTACTTCACTTTCTATTTACAATCccgtttccttatgccaca | NA | NA | NA |
VGCa-23 | VGCa control | TTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcg | NA | NA | NA |
VGCb-25 | VGCb control | CTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrcca | NA | NA | NA |
VGCc-82 | VGCc control | TACATACACTAATAACATACTCATgactgcatgctagaatctaag | NA | NA | NA |
7.
Camilla L. Nesb? Rajkumari Kumaraswamy Marlena Dlutek W. Ford Doolittle Julia Foght 《Applied and environmental microbiology》2010,76(14):4896-4900
All cultivated Thermotogales are thermophiles or hyperthermophiles. However, optimized 16S rRNA primers successfully amplified Thermotogales sequences from temperate hydrocarbon-impacted sites, mesothermic oil reservoirs, and enrichment cultures incubated at <46°C. We conclude that distinct Thermotogales lineages commonly inhabit low-temperature environments but may be underreported, likely due to “universal” 16S rRNA gene primer bias.Thermotogales, a bacterial group in which all cultivated members are anaerobic thermophiles or hyperthermophiles (5), are rarely detected in anoxic mesothermic environments, yet their presence in corresponding enrichment cultures, bioreactors, and fermentors has been observed using metagenomic methods and 16S rRNA gene amplification (6) (see Table S1 in the supplemental material). The most commonly detected lineage is informally designated here “mesotoga M1” (see Table S1 in the supplemental material). PCR experiments indicated that mesotoga M1 sequences amplified inconsistently using “universal” 16S rRNA gene primers, perhaps explaining their poor detection in DNA isolated from environmental samples (see text and Table S2 in the supplemental material). We therefore designed three 16S rRNA PCR primer sets (Table (Table1)1) targeting mesotoga M1 bacteria and their closest cultivated relative, Kosmotoga olearia. Primer set A was the most successful set, detecting a wider diversity of Thermotogales sequences than set B and being more Thermotogales-specific than primer set C (Table (Table22).
Open in a separate windowaHeterogeneity hot spots identified in reference 1.
Open in a separate windowaSee the supplemental material for site and methodological details. NA, not applicable; ND, not determined.bThe number of OTUs observed at a 0.01 distance cutoff is given for each primer set. The numbers of clones with Thermotogales sequences are in parentheses. —, PCR was attempted but no Thermotogales sequences were obtained or the PCR consistently failed.c+, sequence(s) detected; −, not detected. For more information on the enrichments, see the text and Table S3 in the supplemental material.dFrom April to May 2004, the temperature at the depth where the sample was taken was 12°C (7).eThere were no water samples from DWH and HSAT available for enrichment cultures, and no DNA was available from HWH.fThis reservoir has been treated with biocides; moreover, at this site, the water is filtered before being reinjected into the reservoir.gTemperatures of the oil pool where the water sample was obtained. The HSAT facility receives water from two oil pools, one at 41°C and one at 50°C.hWe screened DNA from samples taken in 2006 and 2008 but detected the same sequences in both, so sequences from the two samples were pooled.iThe mesotoga M1 and Kosmotoga sequences from DWH and DF were >99% similar and were assembled into one sequence in Fig. Fig.11.jThis reservoir has been injected with water from a neighboring oil reservoir.Since the putative mesophilic Thermotogales have been overwhelmingly associated with polluted and hydrocarbon-impacted environments and mesothermic oil reservoirs are the only natural environments where mesotoga M1 sequences previously were detected (see Table S1 in the supplemental material), we selected four oil reservoirs with in situ temperatures of 14°C to 53°C and two temperate, chronically hydrocarbon-impacted sites for analysis (Table (Table2).2). Total community DNA was extracted, the 16S rRNA genes were amplified, cloned, and sequenced as described in the supplemental material. 相似文献
TABLE 1.
Primers targeting mesotoga M1 bacteria constructed and used in this studyPrimer | Sequence (5′ to 3′) | Position in mesotoga 16S rRNA gene | No. of heterogeneity hot spotsa | Potential primer match in other Thermotogales lineages |
---|---|---|---|---|
Primer set A | 1 (helix 17) | |||
NMes16S.286F | CGGCCACAAGGAYACTGAGA | 286 | Perfect match in Kosmotoga olearia. The last 7 or 8 nucleotides at the 3′ end are conserved in other Thermotogales lineages. | |
NMes16S.786R | TGAACATCGTTTAGGGCCAG | 786 | One 5′ mismatch in Kosmotoga olearia and Petrotoga mobilis; 2-4 internal and 5′ mismatches in other lineages | |
Primer set B | None | |||
BaltD.42F | ATCACTGGGCGTAAAGGGAG | 540 | Perfect match in Kosmotoga olearia; one or two 3′ mismatches in most other Thermotogales lineages | |
BaltD.494R | GTGGTCGTTCCTCTTTCAAT | 992 | No match in other Thermotogaleslineages. The primer is located in heterogeneity hot spot helices 33 and 34. This primer also fails to amplify some mesotoga M1 sequences. | |
Primer set C | 9 (all 9 regions) | |||
TSSU-3F | TATGGAGGGTTTGATCCTGG | 3 | Perfect match in Thermotoga spp., Kosmotoga olearia, and Petrotoga mobilis; two or three 5′ mismatches in other Thermotogales lineages; one 5′ mismatch to mesotoga M1 16S rRNA genes | |
Mes16S.R | ACCAACTCGGGTGGCTTGAC | 1390 | One 5′ mismatch in Kosmotoga olearia; 1-3 internal or 5′ mismatches in other Thermotogales lineages |
TABLE 2.
Mesotoga clade sequences detected in environmental samples and enrichment cultures screened in this studyaSite (abbreviation) | Temp in situ(°C) | Waterflooded | Environmental samplesb | Enrichment cultures | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Primer set A | Primer set B | Primer set C | Thermotogalesdetected by primer setc: | Lineage(s) detected | ||||||||
No. of OTUs (no. of clones) | Lineage | No. of OTUs (no. of clones) | Lineage | No. of OTUs (no. of clones) | Lineage | A | B | C | ||||
Sidney Tar Ponds sediment (TAR) | Temperate | NA | 1 (5) | M1 | 1 | M1 | — | — | + | + | + | M1, M2, M5 |
Oil sands settling basin tailings (05mlsb) | ∼12d | NA | — | — | 1 (6) | M1 | — | — | − | + | − | M1 |
Grosmont A produced water (GrosA) | 20 | No | 1 (15) | M1 | 1 (22) | M1 | 2 (14) | M1 | + | + | + | M1 |
Foster Creek produced water (FC) | 14 | No | 1 (21) | M1 | 1 (23) | M1 | 1 (1) | M1 | + | ND | − | M1 |
Oil field D wellhead water (DWH)e,f | 52-53g | Yes | 1 (14) | Kosmotogai | 1 (6) | M1i | 1 (1) | Kosmotogai | NA | NA | NA | NA |
Oil field D FWKO water (DF)f,h | 20-30 | Yes | 1 (45) | Kosmotogai | 1 (17) | M1i | — | — | + | + | − | M1, Kosmotoga, Petrotoga |
Oil field H FWKO water (HF)j | 30-32 | Yes | 7 (59) | M1, M2, M3, M4, Kosmotoga | 1 (29) | M1 | — | — | + | + | − | M1, Petrotoga |
Oil field H satellite water (HSAT)e,j | 41 and 50g | Yes | 1 (8) | M1 | — | — | 2 (16) | Kosmotoga, Thermotoga | NA | NA | NA | NA |
Oil field H wellhead water (HWH)e,j | 41 and 50g | Yes | NA | — | — | NA | NA | NA | + | + | + | M1, Petrotoga |
8.
Chris A. Whitehouse Carson Baldwin Rangarajan Sampath Lawrence B. Blyn Rachael Melton Feng Li Thomas A. Hall Vanessa Harpin Heather Matthews Marina Tediashvili Ekaterina Jaiani Tamar Kokashvili Nino Janelidze Christopher Grim Rita R. Colwell Anwar Huq 《Applied and environmental microbiology》2010,76(6):1996-2001
9.
10.
11.
Pamela R. Hall Brian Hjelle Hadya Njus Chunyan Ye Virginie Bondu-Hawkins David C. Brown Kathleen A. Kilpatrick Richard S. Larson 《Journal of virology》2009,83(17):8965-8969
Specific therapy is not available for hantavirus cardiopulmonary syndrome caused by Andes virus (ANDV). Peptides capable of blocking ANDV infection in vitro were identified using antibodies against ANDV surface glycoproteins Gn and Gc to competitively elute a cyclic nonapeptide-bearing phage display library from purified ANDV particles. Phage was examined for ANDV infection inhibition in vitro, and nonapeptides were synthesized based on the most-potent phage sequences. Three peptides showed levels of viral inhibition which were significantly increased by combination treatment with anti-Gn- and anti-Gc-targeting peptides. These peptides will be valuable tools for further development of both peptide and nonpeptide therapeutic agents.Andes virus (ANDV), an NIAID category A agent linked to hantavirus cardiopulmonary syndrome (HCPS), belongs to the family Bunyaviridae and the genus Hantavirus and is carried by Oligoryzomys longicaudatus rodents (11). HCPS is characterized by pulmonary edema caused by capillary leak, with death often resulting from cardiogenic shock (9, 16). ANDV HCPS has a case fatality rate approaching 40%, and ANDV is the only hantavirus demonstrated to be capable of direct person-to-person transmission (15, 21). There is currently no specific therapy available for treatment of ANDV infection and HCPS.Peptide ligands that target a specific protein surface can have broad applications as therapeutics by blocking specific protein-protein interactions, such as preventing viral engagement of host cell receptors and thus preventing infection. Phage display libraries provide a powerful and inexpensive tool to identify such peptides. Here, we used selection of a cyclic nonapeptide-bearing phage library to identify peptides capable of binding the transmembrane surface glycoproteins of ANDV, Gn and Gc, and blocking infection in vitro.To identify peptide sequences capable of recognizing ANDV, we panned a cysteine-constrained cyclic nonapeptide-bearing phage display library (New England Biolabs) against density gradient-purified, UV-treated ANDV strain CHI-7913 (a gift from Hector Galeno, Santiago, Chile) (17, 18). To increase the specificity of the peptides identified, we eluted phage by using monoclonal antibodies (Austral Biologicals) prepared against recombinant fragments of ANDV Gn (residues 1 to 353) or Gc (residues 182 to 491) glycoproteins (antibodies 6B9/F5 and 6C5/D12, respectively). Peptide sequences were determined for phage from iterative rounds of panning, and the ability of phage to inhibit ANDV infection of Vero E6 cells was determined by immunofluorescent assay (IFA) (7). Primary IFA detection antibodies were rabbit polyclonal anti-Sin Nombre hantavirus (SNV) nucleoprotein (N) antibodies which exhibit potent cross-reactivity against other hantavirus N antigens (3). ReoPro, a commercially available Fab fragment which partially blocks infection of hantaviruses in vitro by binding the entry receptor integrin β3 (5), was used as a positive control (80 μg/ml) along with the original antibody used for phage elution (5 μg/ml). As the maximum effectiveness of ReoPro in inhibiting hantavirus entry approaches 80%, we set this as a threshold for maximal expected efficacy for normalization. The most-potent phage identified by elution with the anti-Gn antibody 6B9/F5 bore the peptide CPSNVNNIC and inhibited hantavirus entry by greater than 60% (61%) (Table (Table1).1). From phage eluted with the anti-Gc antibody 6C5/D12, those bearing peptides CPMSQNPTC and CPKLHPGGC also inhibited entry by greater than 60% (66% and 72%, respectively).
Open in a separate windowaStandard deviations of four experiments are shown in parentheses. Peptide-bearing phage were added at 109 phage/μl.bP values for the pairwise amino acid alignment score of each peptide versus that of integrin β3 were determined using an unpaired Student''s t test. P values considered statistically significant are shown in bold.To determine whether the peptide sequences of any of the identified inhibitory phage showed homology to integrin β3, a known entry receptor for pathogenic hantaviruses (6, 7), we used the Gap program to perform a pairwise amino acid alignment of each peptide versus the extracellular portion of integrin β3 and determined P values for the alignments. Of 45 phage eluted with the anti-Gn antibody, 6B9/F5, 27 of the peptide sequences showed homology to integrin β3 (P < 0.05), and 9 were highly significant (P ≤ 0.0005) (Fig. (Fig.1A).1A). Of the latter, CKFPLNAAC and CSQFPPRLC map to the hybrid domain (Fig. (Fig.1B),1B), which is proximal to the plexin-semaphorin-integrin domain (PSI) containing residue D39, shown to be critical for viral entry in vitro (19). Five sequences (CPSSPFNH, CPKHVLKVC, CNANKPKMC, CQSQTRNHC, and CDQRTTRLC) map to the I-like (or βA) domain near the binding site of ReoPro (2). Finally, CLPTDPIQC maps to the epidermal growth factor 4 (EGF-4) domain, and CSTRAENQC aligns to a portion of β3 untraceable in the crystal structure, specifically the linker region between the hybrid domain and EGF-1. Although this represents a disordered portion of the protein (22), the location of this loop proximal to the PSI domain is worth noting, due to the role of the PSI domain in facilitating viral entry (19). Therefore, 60% of phage eluted with the anti-Gn antibody showed some homology to integrin β3, and those with highly significant P values predominantly mapped to or proximal to regions of known interest in viral entry.Open in a separate windowFIG. 1.Inhibitory peptides identified through phage panning against ANDV show homology to integrin β3. (A) Alignment of phage peptide sequences with P values for integrin β3 pairwise alignment of less than 0.05. Residues comprising the signal peptide, transmembrane, and cytoplasmic domains, which were not included during pairwise alignment, are underlined. Residues 461 to 548, which are missing in the crystal structure, are italicized. Residues involved in the ReoPro binding site are highlighted in green (2). Residue D39 of the PSI domain is highlighted in yellow (19). Peptides are shown above the sequence of integrin β3, with antibody 6C5/D12-eluted sequences shown in blue text and sequences eluted with antibody 6B9/F5 shown in red. Peptide sequences with alignment P values of ≤0.0005 are highlighted in yellow. Percent inhibition of the peptide-bearing phage is shown in parentheses. (B) View of integrin αvβ3 (PDB ID 1U8C [23]). αv is shown in blue ribbon diagram, and β3 is shown in salmon-colored surface representation, with specific domains circled. Residues corresponding to the ReoPro binding site are shown in green, as in panel A, and D39 is shown in yellow. Regions corresponding to 6C5/D12-eluted peptides with P values of ≤0.0005 for alignment with integrin β3 (highlighted in panel A) are shown in blue, and those corresponding to 6B9/F5-eluted peptides with P values of ≤0.0005 for alignment with integrin β3 are shown in red. Alignment of peptide PLASTRT (P value of 0.0040) adjacent to D39 of the PSI domain is shown in magenta. Graphics were prepared using Pymol (DeLano Scientific LLC, San Carlos, CA).Of the 41 peptide-bearing phage eluted with the anti-Gc antibody 6C5/D12, 14 showed sequence homology to integrin β3 (P < 0.05), 4 of which had P values of ≤0.0005 (Fig. (Fig.1A).1A). Of the latter, sequence CTTMTRMTC mapped to the base of the I-like domain (Fig. (Fig.1B),1B), while CHGVYALHC and CRDTTPWWC mapped to the EGF-3 domain. Finally, sequence CTPTMHNHC mapped to the linker region untraceable in the crystal structure. Therefore, in contrast to peptide sequences identified by competition with the anti-Gn antibody, sequences identified by competition with the anti-Gc antibody 6C5/D12 appear to be mostly unrelated to integrin β3.As a low level of pathogenic hantavirus infection can be seen in cells lacking integrin β3, such as CHO cells (19), we asked if any of the identified peptide sequences could represent a previously unidentified receptor. We used the Basic Local Alignment Search Tool to search a current database of human protein sequences for potential alternate receptors represented by these peptides. However, none of the alignments identified proteins that are expressed at the cell surface, eliminating them as potential candidates for alternate viral entry receptors. This suggests that the majority of the peptides identified here likely represent novel sequences for binding ANDV surface glycoproteins.To determine whether synthetic peptides would also block infection, we synthesized cyclic peptides based on the 10 most-potent peptide-bearing phage. These peptides, in the context of phage presentation, showed levels of inhibition ranging from 44 to 72% (Table (Table2).2). When tested by IFA at 1 mM, four of the synthetic peptides showed inhibition levels significantly lower than those of the same peptide presented in the context of phage. This is not surprising, as steric factors due to the size of the phage and the multivalent presentation of peptide in the context of phage may both contribute to infection inhibition (8). However, there was no significant difference in inhibition by synthetic peptide versus peptide-bearing phage for six of the sequences, implying that inhibition in the context of phage was due solely to the nature of the peptide itself and not to steric factors or valency considerations contributed by the phage, which contrasts with our previous results, determined by using phage directed against αvβ3 integrin (10).
Open in a separate windowaStandard deviations of the results of at least four experiments are shown in parentheses.bMean percent inhibition between phage and synthetic peptide differs significantly (P < 0.05).The three most-potent synthetic peptides were examined for their ability to inhibit ANDV entry in a dose-dependent manner. The concentration of each peptide that produces 50% of its maximum potential inhibitory effect was determined. As shown in Fig. Fig.2A,2A, the 50% inhibitory concentration for each of the peptides was in the range of 10 μM, which from our experience is a reasonable potency for a lead compound to take forward for optimization.Open in a separate windowFIG. 2.Activities of synthetic peptides in inhibition of ANDV infection in vitro. (A) Peptides were examined for their ability to block ANDV infection of Vero E6 cells in a dose-dependent manner by IFA. (B) Peptides were tested in parallel for the ability to block infection of Vero E6 cells by ANDV, SNV, HTNV, and PHV. (C) Peptides were tested, singly or in combination, for the ability to block ANDV infection of Vero E6 cells. For all experiments, controls included media, ReoPro at 80 μg/ml, and monoclonal antibodies 6C5/D12 and 6B9/F5 at 5 μg/ml. All peptides were used at 1 mM. Data points represent n = 2 to 6, with error bars showing the standard errors of the means. Statistical analyses were performed on replicate samples using an unpaired Student''s t test.In order to determine the specificity of the three most-potent synthetic cyclic peptides in blocking ANDV, we examined them for inhibition of ANDV infection versus two other pathogenic hantaviruses, SNV and Hantaan virus (HTNV), or the nonpathogenic hantavirus Prospect Hill virus (PHV). As shown in Fig. Fig.2B,2B, ReoPro, which binds integrin β3, showed inhibition of infection by each of the pathogenic hantavirus strains, known to enter cells via β3, but not the nonpathogenic PHV, which enters via integrin β1 (6, 7). In contrast, peptides selected for the ability to bind ANDV were highly specific inhibitors of ANDV versus SNV, HTNV, or PHV. The specificities of peptides eluted by the anti-Gn monoclonal antibody are not surprising, as they are likely due to global differences in the Gn amino acid sequence. Specifically, sequence homologies between ANDV and SNV, HTNV, and PHV are 61%, 36%, and 51%, respectively, for the region corresponding to the immunogen for antibody 6B9/F5. Although homology between the immunogen for antibody 6C5/D12 and the corresponding Gc region of these viruses is somewhat higher (82% with SNV, 63% with HTNV, and 71% with PHV), the possibility that the monoclonal antibody used here recognizes a three-dimensional epitope lends itself to the high specificity of the peptides.The current model for cellular infection by hantaviruses (14) is as follows. Viral binding of the host cell surface target integrin is followed by receptor-mediated endocytosis and endosome acidification. Lowered pH induces conformational changes in Gn and/or Gc, which facilitate membrane fusion and viral release into the cytosol. As there is currently little information available about whether one glycoprotein is dominant in mediating infection, and as neutralizing epitopes have been found on both Gn and Gc glycoproteins (1, 4, 12, 13, 20), we examined whether combining anti-Gn- and anti-Gc-targeted synthetic peptides would lead to an increased infection blockade compared to those for single treatments. As shown in Fig. Fig.2C,2C, the combination of anti-Gn and anti-Gc peptides CMQSAAAHC and CTVGPTRSC resulted in a significant increase in infection inhibition (P = 0.0207 for CMQSAAAHC, and P = 0.0308 for CTVGPTRSC) compared to that resulting from single treatments. Although the high specificity of the peptides for ANDV makes it unlikely that this combination treatment will lead to more cross-reactivity with other pathogenic hantaviruses, this can be determined only by additional testing. Regardless, these data suggest a unique role for each of these viral proteins in the infection process as well as the benefits of targeting multiple viral epitopes for preventing infection.To our knowledge, the peptides reported here are the first identified that directly target ANDV, and this work further illustrates the power of coupling phage display and selective elution techniques in the identification of novel peptide sequences capable of specific protein-protein interactions from a large, random pool of peptide sequences. These novel peptide inhibitors (R. S. Larson, P. R. Hall, H. Njus, and B. Hjelle, U.S. patent application 61/205,211) provide leads for the development of more-potent peptide or nonpeptide organics for therapeutic use against HCPS. 相似文献
TABLE 1.
Peptide-bearing phage eluted from ANDVPhage | % Inhibition (SD)a | P valueb |
---|---|---|
Phage bearing the following peptides eluted with anti-Gn antibody 6B9/F5 | ||
Group 1 (<30% inhibition) | ||
CDQRTTRLC | 8.45 (15.34) | 0.0002 |
CPHDPNHPC | 9.94 (7.72) | 0.333 |
CQSQTRNHC | 11.76 (13.25) | 0.0001 |
CLQDMRQFC | 13.26 (9.92) | 0.0014 |
CLPTDPIQC | 15.70 (14.05) | 0.0005 |
CPDHPFLRC | 16.65 (15.22) | 0.8523 |
CSTRAENQC | 17.56 (16.50) | 0.0004 |
CPSHLDAFC | 18.98 (20.06) | 0.0017 |
CKTGHMRIC | 20.84 (7.47) | 0.0563 |
CVRTPTHHC | 20.89 (27.07) | 0.1483 |
CSGVINTTC | 21.57 (19.61) | 0.0643 |
CPLASTRTC | 21.65 (5.98) | 0.004 |
CSQFPPRLC | 22.19 (8.26) | 0.0004 |
CLLNKQNAC | 22.34 (7.78) | 0.001 |
CKFPLNAAC | 22.89 (6.15) | 0.0001 |
CSLTPHRSC | 23.63 (16.74) | 0.0563 |
CKPWPMYSC | 23.71 (6.68) | 0.0643 |
CLQHDALNC | 24.01 (7.60) | 1 |
CNANKPKMC | 24.67 (11.67) | 0.0004 |
CPKHVLKVC | 25.30 (28.36) | 0.0003 |
CTPDKKSFC | 26.91 (11.15) | 0.399 |
CHGKAALAC | 27.22 (32.53) | 0.005 |
CNLMGNPHC | 28.08 (21.35) | 0.0011 |
CLKNWFQPC | 28.64 (18.49) | 0.0016 |
CKEYGRQMC | 28.76 (29.33) | 0.0362 |
CQPSDPHLC | 29.44 (31.22) | 0.0183 |
CSHLPPNRC | 29.70 (17.37) | 0.0061 |
Group 2 (30-59% inhibition) | ||
CSPLLRTVC | 33.05 (20.26) | 0.0023 |
CHKGHTWNC | 34.17 (12.50) | 0.0795 |
CINASHAHC | 35.62 (13.03) | 0.3193 |
CWPPSSRTC | 36.75 (26.95) | 0.0006 |
CPSSPFNHC | 37.78 (7.11) | 0.0001 |
CEHLSHAAC | 38.47 (7.60) | 0.0115 |
CQDRKTSQC | 38.74 (9.12) | 0.1802 |
CTDVYRPTC | 38.90 (25.03) | 0.006 |
CGEKSAQLC | 39.11 (27.52) | 0.0013 |
CSAAERLNC | 40.13 (6.33) | 0.0033 |
CFRTLEHLC | 42.07 (5.01) | 0.0608 |
CEKLHTASC | 43.60 (27.92) | 0.1684 |
CSLHSHKGC | 45.11 (49.81) | 0.0864 |
CNSHSPVHC | 45.40 (28.80) | 0.0115 |
CMQSAAAHC | 48.88 (44.40) | 0.5794 |
CPAASHPRC | 51.84 (17.09) | 0.1935 |
CKSLGSSQC | 53.90 (13.34) | 0.0145 |
Group 3 (60-79% inhibition) | ||
CPSNVNNIC | 61.11 (25.41) | 0.1245 |
Negative control | 0 (6.15) | |
6B9/F5 (5 μg/ml) | 26.77 (5.33) | |
ReoPro (80 μg/ml) | 79.86 (4.88) | |
Phage bearing the following peptides eluted with anti-Gc antibody 6C5/D12 | ||
Group 1 (<30% inhibition) | ||
CHPGSSSRC | 1.01 (7.03) | 0.0557 |
CSLSPLGRC | 10.56 (13.62) | 0.7895 |
CTARYTQHC | 12.86 (3.83) | 0.3193 |
CHGVYALHC | 12.91 (7.32) | 0.0003 |
CLQHNEREC | 16.79 (13.72) | 0.0958 |
CHPSTHRYC | 17.23 (14.53) | 0.0011 |
CPGNWWSTC | 19.34(9.91) | 0.1483 |
CGMLNWNRC | 19.48 (19.42) | 0.0777 |
CPHTQFWQC | 20.44 (13.65) | 0.0008 |
CTPTMHNHC | 20.92 (11.68) | 0.0001 |
CDQVAGYSC | 21.79 (23.60) | 0.0063 |
CIPMMTEFC | 24.33 (9.28) | 0.2999 |
CERPYSRLC | 24.38 (9.09) | 0.0041 |
CPSLHTREC | 25.06 (22.78) | 0.1202 |
CSPLQIPYC | 26.30 (34.29) | 0.4673 |
CTTMTRMTC (×2) | 29.27 (8.65) | 0.0001 |
Group 2 (30-59% inhibition) | ||
CNKPFSLPC | 30.09 (5.59) | 0.4384 |
CHNLESGTC | 31.63 (26.67) | 0.751 |
CNSVPPYQC | 31.96 (6.51) | 0.0903 |
CSDSWLPRC | 32.95 (28.54) | 0.259 |
CSAPFTKSC | 33.40 (10.64) | 0.0052 |
CEGLPNIDC | 35.63 (19.90) | 0.0853 |
CTSTHTKTC | 36.28 (13.42) | 0.132 |
CLSIHSSVC | 36.40 (16.44) | 0.8981 |
CPWSTQYAC | 36.81 (32.81) | 0.5725 |
CTGSNLPIC | 36.83 (31.64) | 0.0307 |
CSLAPANTC | 39.73 (4.03) | 0.1664 |
CGLKTNPAC | 39.75 (16.98) | 0.2084 |
CRDTTPWWC | 40.08 (18.52) | 0.0004 |
CHTNASPHC | 40.26 (4.77) | 0.5904 |
CTSMAYHHC | 41.89 (8.61) | 0.259 |
CSLSSPRIC | 42.13 (29.75) | 0.2463 |
CVSLEHQNC | 45.54 (6.55) | 0.5065 |
CRVTQTHTC | 46.55 (8.45) | 0.3676 |
CPTTKSNVC | 49.28 (14.00) | 0.3898 |
CSPGPHRVC | 49.50 (42.60) | 0.0115 |
CKSTSNVYC | 51.20 (4.60) | 0.0611 |
CTVGPTRSC | 57.30 (11.31) | 0.0176 |
Group 3 (60-79% inhibition) | ||
CPMSQNPTC | 65.60 (13.49) | 0.014 |
CPKLHPGGC | 71.88 (27.11) | 0.0059 |
Negative control | 0.26 (4.53) | |
6C5/D12 (5 μg/ml) | 22.62 (8.40) | |
ReoPro (80 μg/ml) | 80.02 (76.64) |
TABLE 2.
Synthetic cyclic peptides inhibit ANDV infectionTarget | Sample | % Inhibition bya:
| |
---|---|---|---|
Peptide-bearing phage | Synthetic peptide | ||
Gn | CMQSAAAHC | 48.88 (44.40) | 59.66 (11.17) |
Gc | CTVGPTRSC | 57.30 (11.31) | 46.47 (7.61) |
Gn | CPSNVNNIC | 61.11 (25.41) | 44.14 (10.74) |
Gn | CEKLHTASC | 43.60 (27.92) | 34.87 (9.26) |
Gc | CPKLHPGGC | 71.88 (27.11) | 30.95 (7.73)b |
Gn | CSLHSHKGC | 45.11 (49.81) | 29.79 (9.34) |
Gc | CPMSQNPTC | 65.60 (13.49) | 18.19 (8.55)b |
Gn | CKSLGSSQC | 53.90 (13.34) | 18.10 (7.55)b |
Gn | CNSHSPVHC | 45.40 (28.80) | 15.52 (10.48) |
Gn | CPAASHPRC | 51.84 (17.09) | 0 (10.72)b |
Integrin β3 | ReoPro | 80.10 (7.72) | |
Gn | 6B9/F5 antibody | 42.72 (6.75) | |
Gc | 6C5/D12 antibody | 31.04 (7.81) |
12.
Aurelio Cafaro Stefania Bellino Fausto Titti Maria Teresa Maggiorella Leonardo Sernicola Roger W. Wiseman David Venzon Julie A. Karl David O'Connor Paolo Monini Marjorie Robert-Guroff Barbara Ensoli 《Journal of virology》2010,84(17):8953-8958
The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated (n = 67) or not vaccinated (n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6Pcy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load (P = 0.0280) and CD4 loss (P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID50 (P < 0.0001), and contained acute CD4 loss at 15 MID50 (P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility (P = 0.0199) and resistance (P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion (P = 0.0391) during chronic infection, independently of the challenge dose or haplotype.Advances in typing of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques (14, 20, 26) have provided the opportunity to address the influence of host factors on vaccine studies (13). Retrospective analysis of 22 macaques vaccinated with Tat or a Tat-expressing adenoviral vector revealed that monkeys with the H6 or H3 MHC class IB haplotype were overrepresented among aviremic or controller animals, whereas macaques with the H2 or H5 haplotype clustered in the noncontrollers (12). More recently, the H6 haplotype was reported to correlate with control of chronic infection with simian immunodeficiency virus (SIV) mac251, regardless of vaccination (18).Here, we performed a retrospective analysis of 112 Mauritian cynomolgus macaques, which included the 22 animals studied previously (12), to evaluate the impact of the challenge dose and class IB haplotype on the acquisition and severity of simian/human immunodeficiency virus (SHIV) 89.6Pcy243 infection in 45 control monkeys and 67 monkeys vaccinated with Tat from different protocols (Table (Table11).
Open in a separate windowaAll animals were inoculated with the indicated dose of Tat plasmid DNA (pCV-tat [8], adenovirus-tat [Ad-tat] [27]) or protein, Gag protein, or empty vectors (pCV-0, adenovirus [Ad]) by the indicated route. Doses are in micrograms unless indicated otherwise.bAlum, aluminum phosphate (4); RIBI oil-in-water emulsions containing squalene, bacterial monophosphoryl lipid A, and refined mycobacterial products (4); Iscom, immune-stimulating complex (4); H1D are biocompatible anionic polymeric microparticles used for vaccine delivery (10, 12, 25a).cs.c., subcutaneous; i.m., intramuscular; i.d., intradermal; i.n., intranasal; i.t., intratracheal.dAll animals were inoculated intravenously with the indicated dose of the same SHIV89.6.Pcy243 stock.eAccording to the virological outcome upon challenge, monkeys were grouped as aviremic (A), controllers (C), or viremic (V).fBecause of the short follow-up, controller status could not be determined and all infected monkeys of the ISS-TG protocol were therefore considered viremic.gNA, not applicable. 相似文献
TABLE 1.
Summary of treatment, challenge dose, and outcome of infection in cynomolgus monkeysProtocol code | No. of monkeys | Immunogen (dose)a | Adjuvantb | Schedule of immunization (wk) | Routec | Challenged (MID50) | Virological outcomee | Reference(s) or source | ||
---|---|---|---|---|---|---|---|---|---|---|
A | C | V | ||||||||
ISS-ST | 6 | Tat (10) | Alum or RIBI | 0, 2, 6, 12, 15, 21, 28, 32, 36 | s.c., i.m. | 10 | 4 | 1 | 1 | 4, 17 |
ISS-ST | 1 | Tat (6) | None | 0, 5, 12, 17, 22, 27, 32, 38, 42, 48 | i.d. | 10 | 1 | 0 | 0 | 4, 17 |
ISS-PCV | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben | 0, 2, 6, 11, 15, 21, 28, 32, 36 | i.m. | 10 | 3 | 0 | 0 | 6 |
ISS-ID | 3 | Tat (6) | none | 0, 4, 8, 12, 16, 20, 24, 28, 39, 43, 60 | i.d. | 10 | 1 | 1 | 1 | B. Ensoli, unpublished data |
ISS-TR | 6 | Tat (10) | Alum-Iscom | 0, 2, 6, 11, 16, 21, 28, 32, 36 | s.c., i.d., i.m. | 10 | 4 | 2 | 0 | Ensoli, unpublished |
ISS-TGf | 3 | Tat (10) | Alum | 0, 4, 12, 22 | s.c. | 15 | 0 | 3 | Ensoli, unpublished | |
ISS-TG | 3 | Tatcys22 (10) | Alum | 15 | 0 | 3 | Ensoli, unpublished | |||
ISS-TG | 4 | Tatcys22 (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-TG | 4 | Tat (10) + Gag (60) | Alum | 15 | 0 | 4 | Ensoli, unpublished | |||
ISS-MP | 3 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 38 | s.c., i.m. | 15 | 0 | 2 | 1 | Ensoli, unpublished |
ISS-MP | 3 | Tat (10) | Alum | s.c. | 15 | 0 | 0 | 3 | Ensoli, unpublished | |
ISS-GS | 6 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 36 | s.c., i.m. | 15 | 1 | 3 | 2 | Ensoli, unpublished |
NCI-Ad-tat/Tat | 7 | Ad-tat (5 × 108 PFU), Tat (10) | Alum | 0, 12, 24, 36 | i.n., i.t., s.c. | 15 | 2 | 3 | 2 | Ensoli, unpublished |
NCI-Tat | 9 | Tat (6 and 10) | Alum/Iscom | 0, 2, 6, 11, 15, 21, 28, 32, 36 | s.c., i.d., i.m. | 15 | 2 | 4 | 3 | 12 |
ISS-NPT | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 0 | 0 | 3 | Ensoli, unpublished |
ISS-NPT | 3 | pCV-tatcys22 (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 1 | 1 | 1 | |
Total vaccinated | 67 | 19 | 17 | 31 | ||||||
Naive | 11 | None | None | NAg | NA | 10 or 15 | 1 | 3 | 7 | |
Control | 34 | None, Ad, or pCV-0 | Alum, RIBI, H1D, Iscom or bupivacaine + methylparaben-Iscom | s.c., i.d., i.n., i.t., i.m. | 10, 15, or 20 | 5 | 13 | 16 | ||
Total controls | 45 | 6 | 16 | 23 | ||||||
Total | 112 | 25 | 33 | 54 |
13.
C. P. A. de Haan R. Kivist? M. L. H?nninen 《Applied and environmental microbiology》2010,76(20):6942-6943
Cj0859c variants fspA1 and fspA2 from 669 human, poultry, and bovine Campylobacter jejuni strains were associated with certain hosts and multilocus sequence typing (MLST) types. Among the human and poultry strains, fspA1 was significantly (P < 0.001) more common than fspA2. FspA2 amino acid sequences were the most diverse and were often truncated.Campylobacter jejuni is the leading cause of bacterial gastroenteritis worldwide and responsible for more than 90% of Campylobacter infections (7). Case-control studies have identified consumption or handling of raw and undercooked poultry meat, drinking unpasteurized milk, and swimming in natural water sources as risk factors for acquiring domestic campylobacteriosis in Finland (7, 9). Multilocus sequence typing (MLST) has been employed to study the molecular epidemiology of Campylobacter (4) and can contribute to virulotyping when combined with known virulence factors (5). FspA proteins are small, acidic, flagellum-secreted nonflagellar proteins of C. jejuni that are encoded by Cj0859c, which is expressed by a σ28 promoter (8). Both FspA1 and FspA2 were shown to be immunogenic in mice and protected against disease after challenge with a homologous strain (1). However, FspA1 also protected against illness after challenge with a heterologous strain, whereas FspA2 failed to do the same at a significant level. Neither FspA1 nor FspA2 protected against colonization (1). On the other hand, FspA2 has been shown to induce apoptosis in INT407 cells, a feature not exhibited by FspA1 (8). Therefore, our aim was to study the distributions of fspA1 and fspA2 among MLST types of Finnish human, chicken, and bovine strains.In total, 367 human isolates, 183 chicken isolates, and 119 bovine isolates (n = 669) were included in the analyses (3). PCR primers for Cj0859c were used as described previously (8). Primer pgo6.13 (5′-TTGTTGCAGTTCCAGCATCGGT-3′) was designed to sequence fspA1. Fisher''s exact test or a chi-square test was used to assess the associations between sequence types (STs) and Cj0859c. The SignalP 3.0 server was used for prediction of signal peptides (2).The fspA1 and fspA2 variants were found in 62.6% and 37.4% of the strains, respectively. In 0.3% of the strains, neither isoform was found. Among the human and chicken strains, fspA1 was significantly more common, whereas fspA2 was significantly more frequent among the bovine isolates (Table (Table1).1). Among the MLST clonal complexes (CCs), fspA1 was associated with the ST-22, ST-45, ST-283, and ST-677 CCs and fspA2 was associated with the ST-21, ST-52, ST-61, ST-206, ST-692, and ST-1332 CCs and ST-58, ST-475, and ST-4001. Although strong CC associations of fspA1 and fspA2 were found, the ST-48 complex showed a heterogeneous distribution of fspA1 and fspA2. Most isolates carried fspA2, and ST-475 was associated with fspA2. On the contrary, ST-48 commonly carried fspA1 (Table (Table1).1). In our previous studies, ST-48 was found in human isolates only (6), while ST-475 was found in both human and bovine isolates (3, 6). The strict host associations and striking difference between fspA variants in human ST-48 isolates and human/bovine ST-475 isolates suggest that fspA could be important in host adaptation.
Open in a separate windowaIn 0.3% of the strains, neither isoform was found. NF, not found.bNA, not associated.A total of 28 isolates (representing 6 CCs and 13 STs) were sequenced for fspA1 and compared to reference strains NCTC 11168 and 81-176. All isolates in the ST-22 CC showed the same one-nucleotide (nt) difference with both NCTC 11168 and 81-176 strains, resulting in a Thr→Ala substitution in the predicted protein sequence (represented by isolate FB7437, GenBank accession number ; Fig. HQ104931Fig.1).1). Eight other isolates in different CCs showed a 2-nt difference (isolate 1970, GenBank accession number ; Fig. HQ104932Fig.1)1) compared to strains NCTC 11168 and 81-176, although this did not result in amino acid substitutions. All 28 isolates were predicted to encode a full-length FspA1 protein.Open in a separate windowFIG. 1.Comparison of FspA1 and FspA2 isoforms. FspA1 is represented by 81-176, FB7437, and 1970. FspA2 is represented by C. jejuni strains 76763 to 1960 (GenBank accession numbers ). Scale bar represents amino acid divergence.In total, 62 isolates (representing 7 CCs and 35 STs) were subjected to fspA2 sequence analysis. Although a 100% sequence similarity between different STs was found for isolates in the ST-21, ST-45, ST-48, ST-61, and ST-206 CCs, fspA2 was generally more heterogeneous than fspA1 and we found 13 predicted FspA2 amino acid sequence variants in total (Fig. HQ104933 to HQ104946(Fig.1).1). In several isolates with uncommon and often unassigned (UA) STs, the proteins were truncated (Fig. (Fig.1),1), with most mutations being ST specific. For example, all ST-58 isolates showed a 13-bp deletion (isolate 3074_2; Fig. Fig.1),1), resulting in a premature stop codon. Also, all ST-1332 CC isolates were predicted to have a premature stop codon by the addition of a nucleotide between nt 112 and nt 113 (isolate 1960; Fig. Fig.1),1), a feature shared with two isolates typed as ST-4002 (UA). A T68A substitution in ST-1960 (isolate T-73494) also resulted in a premature stop codon. Interestingly, ST-1959 and ST-4003 (represented by isolate 4129) both lacked one triplet (nt 235 to 237), resulting in a shorter FspA2 protein. SignalP analysis showed the probability of a signal peptide between nt 22 and 23 (ACA-AA [between the underlined nucleotides]). An A24C substitution in two other strains, represented by isolate 76580, of ST-693 and ST-993 could possibly result in a truncated FspA2 protein as well.In conclusion, our results showed that FspA1 and FspA2 showed host and MLST associations. The immunogenic FspA1 seems to be conserved among C. jejuni strains, in contrast to the heterogeneous apoptosis-inducing FspA2, of which many isoforms were truncated. FspA proteins could serve as virulence factors for C. jejuni, although their roles herein are not clear at this time. 相似文献
TABLE 1.
Percent distributions of fspA1 and fspA2 variants among 669 human, poultry, and bovine Campylobacter jejuni strains and their associations with hosts, STs, and CCsHost or ST complex/ST (no. of isolates) | % of strains witha: | P valueb | |
---|---|---|---|
fspA1 | fspA2 | ||
Host | |||
All (669) | 64.3 | 35.4 | |
Human (367) | 69.5 | 30.0 | <0.001 |
Poultry (183) | 79.2 | 20.8 | <0.001 |
Bovine (119) | 25.2 | 74.8 | <0.0001 |
ST complex and STs | |||
ST-21 complex (151) | 2.6 | 97.4 | <0.0001 |
ST-50 (76) | NF | 100 | <0.0001 |
ST-53 (19) | NF | 100 | <0.0001 |
ST-451 (9) | NF | 100 | <0.0001 |
ST-883 (11) | NF | 100 | <0.0001 |
ST-22 complex (22) | 100 | NF | <0.0001 |
ST-22 (11) | 100 | NF | <0.01 |
ST-1947 (9) | 100 | NF | 0.03 |
ST-45 complex (268) | 99.3 | 0.7 | <0.0001 |
ST-11 (7) | 100 | NF | NA |
ST-45 (173) | 99.4 | 0.6 | <0.0001 |
ST-137 (22) | 95.5 | 4.5 | 0.001 |
ST-230 (14) | 100 | NF | <0.0001 |
ST-48 complex (18) | 44.4 | 55.6 | NA |
ST-48 (7) | 100 | NF | NA |
ST-475 (8) | NF | 100 | <0.001 |
ST-52 complex (5) | NF | 100 | <0.01 |
ST-52 (4) | NF | 100 | 0.02 |
ST-61 complex (21) | NF | 100 | <0.0001 |
ST-61 (11) | NF | 100 | <0.0001 |
ST-618 (3) | NF | 100 | 0.04 |
ST-206 complex (5) | NF | 100 | <0.01 |
ST-283 complex (24) | 100 | NF | <0.0001 |
ST-267 (23) | 100 | NF | <0.0001 |
ST-677 complex (59) | 100 | NF | <0.0001 |
ST-677 (48) | 100 | NF | <0.0001 |
ST-794 (11) | 100 | NF | <0.001 |
ST-692 complex (3) | NF | 100 | 0.04 |
ST-1034 complex (5) | NF | 80 | NA |
ST-4001 (3) | NF | 100 | 0.04 |
ST-1287 complex/ST-945 (8) | 100 | NF | NA |
ST-1332 complex/ST-1332 (4) | NF | 100 | 0.02 |
Unassigned STs | |||
ST-58 (6) | NF | 100 | <0.01 |
ST-586 (6) | 100 | NF | NA |
14.
Vertebrate genomic assemblies were analyzed for endogenous sequences related to any known viruses with single-stranded DNA genomes. Numerous high-confidence examples related to the Circoviridae and two genera in the family Parvoviridae, the parvoviruses and dependoviruses, were found and were broadly distributed among 31 of the 49 vertebrate species tested. Our analyses indicate that the ages of both virus families may exceed 40 to 50 million years. Shared features of the replication strategies of these viruses may explain the high incidence of the integrations.It has long been appreciated that retroviruses can contribute significantly to the genetic makeup of host organisms. Genes related to certain other viruses with single-stranded RNA genomes, formerly considered to be most unlikely candidates for such contribution, have recently been detected throughout the vertebrate phylogenetic tree (1, 6, 13). Here, we report that viruses with single-stranded DNA (ssDNA) genomes have also contributed to the genetic makeup of many organisms, stretching back as far as the Paleocene period and possibly the late Cretaceous period of evolution.Determining the evolutionary ages of viruses can be problematic, as their mutation rates may be high and their replication may be rapid but also sporadic. To establish a lower age limit for currently circulating ssDNA viruses, we analyzed 49 published vertebrate genomic assemblies for the presence of sequences derived from the NCBI RefSeq database of 2,382 proteins from known viruses in this category, representing a total of 23 classified genera from 7 virus families. Our survey uncovered numerous high-confidence examples of endogenous sequences related to the Circoviridae and to two genera in the family Parvoviridae: the parvoviruses and dependoviruses (Fig. (Fig.11).Open in a separate windowFIG. 1.Phylogenetic tree of vertebrate organisms and history of ssDNA virus integrations. Times of integration of ancestral dependoviruses (yellow icosahedrons), parvoviruses (blue icosahedrons), and circoviruses (triangles) are approximate.The Dependovirus and Parvovirus genomes are typically 4 to 6 kb in length, include 2 major open reading frames (encoding replicase proteins [Rep and NS1, respectively] and capsid proteins [Cap and VP1, respectively]), and have characteristic hairpin structures at both ends (Fig. (Fig.2).2). For replication, these viruses depend on host enzymes that are recruited by the viral replicase proteins to the hairpin regions, where self-primed viral DNA synthesis is initiated (2). Circovirus genomes are typically ∼2-kb circles. DNA of the type species, porcine circovirus 1 (PCV-1), contains a stem-loop structure within the origin of replication (Fig. (Fig.2),2), and the largest open reading frame includes sequences that are homologous to the Parvovirus replicase open reading frame (9, 11). The circoviruses also depend on host enzymes for replication, and DNA synthesis is self-primed from a 3′-OH end formed by endonucleolytic cleavage of the stem-loop structure (4). The frequency of Dependovirus infection is estimated to be as high as 90% within an individual''s lifetime. None of the dependoviruses have been associated with human disease, but related viruses in the family Parvoviridae (e.g., erythrovirus B19 and possibly human bocavirus) are pathogenic for humans, and members of both the Parvoviridae and the Circoviridae can cause a variety of animal diseases (2, 4).Open in a separate windowFIG. 2.Schematics illustrating the structure and organization of Parvoviridae and Circoviridae genomes and origins of several of the longest-integrated ancestral viral sequences found in vertebrates. Integrations were aligned to the Dependovirus adeno-associated virus 2 (AAV2), the Parvovirus minute virus of mice (MVM), and the Circovirus porcine circovirus 1 (PCV-1). The inverted terminal repeat (ITR) sequences in the Dependovirus and Parvovirus genomes are depicted on an expanded scale. A linear representation of the circular genome of PCV-1 is shown with the 10-bp stem-loop structure on an expanded scale. Horizontal lines beneath the maps indicate the lengths of similar sequences that could be identified by BLAST. The numbers indicate the locations of amino acids in the viral proteins where the sequence similarities in the endogenous insertions start and end. The actual ancestral virus-derived integrated sequences may extend beyond the indicated regions.With some ancestral endogenous sequences that we identified, phylogenetic comparisons can be used to estimate age. For example, as a Dependovirus-like sequence is present at the same location in the genomes of mice and rats, the ancestral virus must have existed before their divergence, more than 20 million years ago. Some Circovirus- and Dependovirus-related integrations also predate the split between dog and panda, about 42 million years ago. However, in most other cases, we rely on an indirect method for estimating age (1). As genomic sequences evolve, they accumulate new stop codons and insertion/deletion-induced frameshifts. The rates of these events can be tied directly to the rates of neutral sequence drift and, therefore, the time of evolution. To apply this method, we first performed a BLAST search of vertebrate genomes for all known ssDNA virus proteins (BLAST options, -p tblastn -M BLOSUM62 -e 1e−4). Candidate sequences were then recorded, along with 5 kb of flanking regions, and then again aligned against the database of ssDNA viruses to find the most complete alignment (BLAST options, -t blastx -F F -w 15 -t 1500 -Z 150 -G 13 -E 1 -e 1e−2). Detected alignments were then compared with a neutral model of genome evolution, as described in the supplemental material, and the numbers of stop codons and frameshifts were converted into the expected genomic drift undergone by the sequences. The age of integration was then estimated from the known phylogeny of vertebrates (7, 10). Using these methods, we discovered that as many as 110 ssDNA virus-related sequences have been integrated into the 49 vertebrate genomes considered, during a time period ranging from the present to over 40 to 60 million years ago (Table (Table1;1; see also Tables S1 to S3 in the supplemental material).
Open in a separate windowaSome ambiguity in choosing the most similar virus is possible. We generally used the alignment with the lowest E value in the BLAST results. However, one or two points in the exponent of an E value were sometimes sacrificed to achieve a longer sequence alignment.baa, amino acids.cThese sequences have long insertions compared to the present-day viruses. In all cases tested, these insertions originated from short interspersed elements (SINEs). These insertions were excluded from the counts of stop codons and frameshifts and the estimation of integration age.dChr, chromosome.It is important to recognize that there is an intrinsic limit on how far back in time we can reach to identify ancient endogenous viral sequences. First, the sequences must be identified with confidence by BLAST or similar programs. This requirement places a lower limit on sequence identity at about 20 to 30% of amino acids, or about 75% of nucleotides (nucleotides evolve nearly 2.5 times slower than the amino acid sequence they encode). Second, the related, present-day virus must have evolved at a rate that is not much higher than that of the endogenous sequences. The viruses for which ancestral endogenous sequences were identified in this study exhibit sequence drift similar to that associated with mammalian genomes. Setting this rate at 0.14% per million years of evolution (8), we arrive at 90 million years as the theoretical limit for the oldest sequences that can be identified using our methods. This limit drops to less than 35 million years for endogenous viral sequences in rodents and even lower for sequences related to viruses that evolve faster than mammalian genomes.The most widespread integrations found in our survey are derived from the dependoviruses. These include nearly complete genomes related to adeno-associated virus (AAV) in microbat, wallaby, dolphin, rabbit, mouse, and baboon (Fig. (Fig.2).2). We did not detect inverted terminal repeats in several integrations tested, even though repeats are common in the present-day dependoviruses. This result could be explained by sequence decay or the absence of such structures in the ancestral viruses. However, we do see sequences that resemble degraded hairpin structures to which Dependovirus Rep proteins bind, with an example from microbat integration mlEDLG-1 shown in Fig. Fig.3.3. The second most widespread endogenous sequences are related to the parvoviruses. They are found in 6 of 49 vertebrate species considered, with nearly complete genomes in rat, opossum, wallaby, and guinea pig (Fig. (Fig.22).Open in a separate windowFIG. 3.Hairpin structure of the inverted terminal repeat of adeno-associated virus 2 (left) and a candidate degraded hairpin structure located close to the 5′ end of the mlEDLG-1 integration in microbats (right). Structures and mountain plots were generated using default parameters of the RNAfold program (5), with nucleotide coloring representing base-pairing probabilities: blue is below average, green is average, and red is above average. Mountain plots represent hairpin structures based on minimum free energy (mfe) calculations and partition function (pf) calculations, as well as the centroid structure (5). Height is expressed in numbers of nucleotides; position represents nucleotide.The Dependovirus AAV2 has strong bias for integration into human chromosome 19 during infection, driven by a host sequence that is recognized by the viral Rep protein(s). Rep mediates the formation of a synapse between viral and cellular sequences, and the cellular sequences are nicked to serve as an origin of viral replication (14). The related integrations in mice and rats, located in the same chromosomal locations, might be explained by such a mechanism. However, the extent of endogenous sequence decay and the frequency of stop codons indicate that these integrations occurred some 30 to 35 million years ago, implying that they are derived from a single event in a rodent ancestor rather than two independent integration events at the same location. Similarly, integrations EDLG-1 in dog and panda lie in chromosomal regions that can be readily aligned (based on University of California—Santa Cruz [UCSC] genome assemblies) and show sequence decay consistent with the age of the common ancestor, about 42 million years. Endogenous sequences related to the family Parvoviridae can thus be traced to over 40 million years back in time, and viral proteins related to this family have remained over 40% conserved.Sequences related to circoviruses were detected in five vertebrate species (Table (Table11 and Table S1 in the supplemental material). At least one of these sequences, the endogenous sequence in opossum, likely represents a recent integration. Several integrations in dog, cat, and panda, on the other hand, appear to date from at least 42 million years ago, which is the last time when pandas and dogs shared a common ancestor. We see evidence for this age in data from sequence degradation (Table (Table1),1), phylogenetic analyses of endogenous Circovirus-like genomes (see Fig. S2 in the supplemental material), and genomic synteny where integration ECLG-3 is surrounded by genes MTA3 and ARID5A in both dog and panda and integration ECLG-2 lies 35 to 43 kb downstream of gene UPF3A. In fact, Circovirus integrations may even precede the split between dogs and cats, about 55 million years ago, although the preliminary assembly and short genomic contigs for cats make synteny analysis impossible.The most common Circovirus-related sequences detected in vertebrate genomes are derived from the rep gene. We speculate that, like those of the Parvoviridae, the ancestral Circoviridae sequences might have been copied using a primer sequence in the host DNA that resembled the viral origin and was therefore recognized by the virus Rep protein. Higher incidence of rep gene identifications may represent higher conservation of this gene with time, or alternatively, possession of these sequences may impart some selective advantage to the host species. The largest Circovirus-related integration detected, in the opossum, comprises a short fragment of what may have been the cap gene immediately adjacent to and in the opposite orientation from the rep gene. This organization is similar to that of the present day Circovirus genome in which these genes share a promoter in the hairpin regions but are translated in opposite directions (Fig. (Fig.22).In summary, our results indicate that sequences derived from ancestral members of the families Parvoviridae and Circoviridae were integrated into their host''s genomes over the past 50 million years of evolution. Features of their replication strategies suggest mechanisms by which such integrations may have occurred. It is possible that some of the endogenous viral sequences could offer a selective advantage to the virus or the host. We note that rep open reading frame-derived proteins from some members of these families kill tumor cells selectively (3, 12). The genomic “fossils” we have discovered provide a unique glimpse into virus evolution but can give us only a lower estimate of the actual ages of these families. However, numerous recent integrations suggest that their germ line transfer has been continuing into present times. 相似文献
TABLE 1.
Selected endogenous sequences in vertebrate genomes related to single-stranded DNA virusesVirus group and vertebrate species | Initial genomic search using TBLASTN | Best sequence homology identified using BLASTX | Predicted nucleotide drift (%) | Integration label | Age (million yr) or timing of integration based on sequence aging | |||||
---|---|---|---|---|---|---|---|---|---|---|
Chromosomal or scaffold location | Protein | BLAST E value/% sequence identity | Most similar virusa | Protein | Coordinates | No. of stop codons/frameshifts | ||||
Circoviruses | ||||||||||
Cat | Scaffold_62068 | Rep | 6E−05/37 | Canary circovirus | Rep | 4-283 | 3/7 in 268 aab | 14.2 | fcECLG-1 | 82 |
Scaffold_24038 | Rep | 6E−06/51 | Columbid circovirus | Rep | 44-317 | 4/5 in 231 aac | 15.2 | fcECLG-2 | 87 | |
Dog | Chr5d | Rep | 7E−16/46 | Raven circovirus | Rep | 16-263 | 6/5 in 250 aa | 17.6 | cfECLG-1 | 98 |
Chr22 | Rep | 1E−14/43 | Beak and feather disease virus | Rep | 7-264 | 2/1 in 261 aac | 4.5 | cfECLG-2 | 54 | |
Opossum | Chr3 | Rep | 4E−46/44 | Finch circovirus | Rep | 2-291 | 0/2 in 282 aa | 2.3 | mdECLG | 12 |
Cap | 6-36 | 0/0 in 30 aa | ||||||||
Dependoviruses | ||||||||||
Dog | ChrX | Rep | 6E−05/55 | AAV5 | Rep | 239-445 | 3/4 in 200 aa | 14.0 | cfEDLG-1 | 78 |
Dolphin | GeneScaffold1475 | Rep | 8E−39/39 | Avian AAV DA1 | Rep | 79-486 | 3/4 in 379 aac | 6.6 | ttEDLG-2 | 55 |
Cap | 4E−61/47 | Cap | 1-738 | 4/7 in 678 aac | ||||||
Elephant | Scaffold_4 | Rep | 0/55 | AAV5 | Rep | 3-589 | 0/0 in 579 aa | 0.0 | laEDLG | Recent |
Hyrax | GeneScaffold5020 | Cap | 3E−34/53 | AAV3 | Cap | 485-735 | 0/5 in 256 aa | 7.0 | pcEDLG-1 | 29 |
Scaffold_19252 | Rep | 9E−72/47 | Bovine AAV | Rep | 2-348 | 8/4 in 348 aa | 14.3 | pcEDLG-2 | 60 | |
Megabat | Scaffold_5601 | Rep | 2E−13/31 | AAV2 | Rep | 315-479 | 1/5 in 175 aa | 13.1 | pvEDLG-3 | 76 |
Microbat | GeneScaffold2026 | Rep | 1E−117/50 | AAV2 | Rep | 1-617 | 2/5 in 612 aa | 5.8 | mlEDLG-1 | 27 |
Cap | 9E−33/51 | Cap | 1-731 | 2/9 in 509 aac | ||||||
Scaffold_146492 | Cap | 6E−32/42 | AAV2 | Cap | 479-732 | 0/3 in 252 aa | 4.2 | mlEDLG-2 | 19 | |
Mouse | Chr1 | Rep | 2E−06/34 | AAV2 | Rep | 4-206 | 3/5 in 191 aa | 17.1 | mmEDLG-1 | 39 |
Chr3 | Rep | 2E−24/31 | AAV5 | Rep | 71-478 | 12/7 in 389 aa | 16.5 | mmEDLG-2 | 37 | |
Cap | 2E−22/45 | Cap | 22-724 | 12/10 in 649aac | ||||||
Chr8 | Rep | 1E−08/46 | AAV2 | Rep | 314-473 | 3/3 in 147 aa | 13.8 | mmEDLG-3 | 31 | |
Cap | 1-137 | 1/2 in 114 aa | ||||||||
Panda | Scaffold2359 | Rep | 2E−06/37 | Bovine AAV | Rep | 238-426 | 2/3 in 186 aa | 10.4 | amEDLG-1 | 59 |
Pika | Scaffold_9941 | Rep | 4E−14/28 | AAV5 | Rep | 126-415 | 2/2 in 282 aa | 5.4 | opEDLG | 14 |
Platypus | Chr2 | Rep | 9E−10/35 | Bovine AAV | Rep | 297-437 | 4/3 in 138 aa | 17.1 | oaEDLG-1 | 79 |
Cap | 272-419 | 1/2 in 150 aac | ||||||||
Contig12430 | Rep | 2E−09/47 | Bovine AAV | Rep | 353-450 | 3/1 in 123 aa | 12.0 | oaEDLG-2 | 55 | |
Cap | 2E−05/32 | Cap | 253-367 | 2/1 in 116 aa | ||||||
Rabbit | Chr10 | Rep | 3E−97/39 | AAV2 | Rep | 1-619 | 3/9 in 613 aa | 9.3 | ocEDLG | 43 |
Cap | 5E−50/45 | Cap | 1-723 | 10/9 in 675 aa | ||||||
Rat | Chr13 | Rep | 2E−09/33 | AAV2 | Rep | 4-175 | 2/4 in 177 aa | 13.3 | rnEDLG-1 | 28 |
Chr2 | Rep | 4E−18/40 | AAV5 | Rep | 1-461 | 12/12 in 454 aa | 22.7 | rnEDLG-2 | 51 | |
Chr19 | Rep | 2E−07/33 | AAV5 | Rep | 329-464 | 2/4 in 136 aa | 16.1 | rnEDLG-3 | 35 | |
Cap | 31-133 | 2/1 in 93 aa | ||||||||
Tarsier | Scaffold_178326 | Rep | 4E−14/23 | AAV5 | Rep | 96-465 | 2/3 in 356 aa | 5.3 | tsEDLG | 23 |
Parvoviruses | ||||||||||
Guinea pig | Scaffold_188 | Rep | 3E−24/46 | Porcine parvovirus | Rep | 313-567 | 5/3 in 250 aa | 12.3 | cpEPLG-1 | 40 |
Cap | 1E−16/36 | Cap | 10-689 | 11/12 in 672 aa | ||||||
Scaffold_27 | Rep | 1E−50/39 | Canine parvovirus | Rep | 11-640 | 1/4 in 616 aa | 5.3 | cpEPLG-2 | 17 | |
Cap | 1E−38/39 | Porcine parvovirus | Cap | 3-719 | 2/14 in 700 aa | |||||
Tenrec | Scaffold_260946 | Rep | 2E−20/38 | LuIII virus | Rep | 406-598 | 4/4 in 190 aa | 19.0 | etEPLG-2 | 60 |
Cap | 11-639 | 16/15 in 595 aa | ||||||||
Rat | Chr5 | Rep | 6E−10/56 | Canine parvovirus | Rep | 1-282 | 0/0 in 312 aa | 0.6 | rnEPLG | Recent |
Cap | 0/62 | Cap | 637-667 | 0/2 in 760 aa | ||||||
Rep | 0/63 | 1-751 | ||||||||
Opossum | Chr3 | Rep | 2E−39/33 | LuIII virus | Rep | 7-570 | 11/3 in 502 aa | 10.9 | mdEPLG-2 | 56 |
Cap | 7E−8/33 | Cap | 11-729 | 14/7 in 704 aa | ||||||
Chr6 | Rep | 6E−58/44 | Porcine parvovirus | Rep | 16-563 | 3/7 in 534 aac | 4.6 | mdEPLG-3 | 24 | |
Cap | 6E−60/38 | Cap | 10-715 | 2/5 in 707 aac | ||||||
Wallaby | Scaffold_108040 | Rep | 4E−74/62 | Canine parvovirus | Rep | 341-645 | 0/0 in 287 aa | 1.3 | meEPLG-3 | 7 |
Cap | 8E−37/32 | Cap | 35-738 | 0/4 in 687 aa | ||||||
Scaffold_72496 | Rep | 2E−61/42 | Porcine parvovirus | Rep | 23-567 | 4/3 in 531 aa | 5.7 | meEPLG-6 | 30 | |
Cap | 2E−31/38 | Cap | 10-532 | 6/4 in 514 aa | ||||||
Scaffold_88340 | Rep | 7E−37/55 | Mouse parvovirus 1 | Rep | 344-566 | 0/3 in 223 aa | 6.7 | meEPLG-16 | 36 | |
Cap | 7E−22/33 | Cap | 11-713 | 6/9 in 700 aa |
15.
16.
17.
Taiki Futagami Yuki Morono Takeshi Terada Anna H. Kaksonen Fumio Inagaki 《Applied and environmental microbiology》2009,75(21):6905-6909
Halogenated organic compounds serve as terminal electron acceptors for anaerobic respiration in a diverse range of microorganisms. Here, we report on the widespread distribution and diversity of reductive dehalogenase homologous (rdhA) genes in marine subsurface sediments. A total of 32 putative rdhA phylotypes were detected in sediments from the southeast Pacific off Peru, the eastern equatorial Pacific, the Juan de Fuca Ridge flank off Oregon, and the northwest Pacific off Japan, collected at a maximum depth of 358 m below the seafloor. In addition, significant dehalogenation activity involving 2,4,6-tribromophenol and trichloroethene was observed in sediment slurry from the Nankai Trough Forearc Basin. These results suggest that dehalorespiration is an important energy-yielding pathway in the subseafloor microbial ecosystem.Scientific ocean drilling explorations have revealed that marine subsurface sediments harbor remarkable numbers of microbial cells that account for approximately 1/10 to 1/3 of all living biota on Earth (20, 25, 33). Thermodynamic calculations of pore-water chemistry suggest that subseafloor microbial activities are generally supported by nutrient and energy supplies from the seawater and/or underlying basaltic aquifers (6, 7). Although sulfate, nitrate, Fe(III), Mn(IV), and bicarbonate are known to be potential electron acceptors for anaerobic microbial respiration in marine subsurface sediments (5), the incidence of both the dissimilatory dehalorespiration pathway and microbial activity in halogenated organic substrates remains largely unknown.Previous molecular ecological studies using 16S rRNA gene sequences demonstrated that Chloroflexi is one of the most frequently detected phyla in subseafloor sediments of the Pacific Ocean margins (12-14). Some of the sequences within the Chloroflexi are closely related to sequences in the genus Dehalococcoides, which contains obligatory dehalorespiring bacteria that employ halogenated organic compounds as terminal electron acceptors (21, 29). The frequent detection of Dehalococcoides-related 16S rRNA genes from these environments implies the occurrence of dissimilatory dehalorespiration in marine subsurface sediments.In this study, we detected and phylogenetically analyzed the reductive dehalogenase homologous (rdhA) genes, key functional genes for dehalorespiration pathways, from frozen sediment core samples obtained by Ocean Drilling Program (ODP) Leg 201 (Peru margin and eastern equatorial Pacific) (7, 14); Integrated Ocean Drilling Program (IODP) Expedition 301 (Juan de Fuca Ridge flank) (8, 24); Chikyu Shakedown Expedition CK06-06 (Northwest Pacific off Japan) (20, 23); and IODP Expedition 315 (Nankai Trough Forearc Basin off Japan) (Table (Table1).1). DNA was extracted using an ISOIL bead-beating kit (Nippon Gene, Japan) and purified using a MagExtractor DNA fragment purification kit (Toyobo, Japan) according to the manufacturer''s instructions. To increase concentration, DNA was amplified by multiple displacement amplification using the phi29 polymerase supplied with a GenomiPhi kit (GE Healthcare, United Kingdom) (20). Putative rdhA genes were amplified by PCR using Ex Taq polymerase (TaKaRa, Japan) with degenerate primers RRF2 and B1R (17), dehaloF3, dehaloF4, dehaloF5, dehaloR2, dehaloR3, and dehaloR4 (32), and ceRD2S, ceRD2L, and RD7 (26) and the PCR conditions described in those studies. Amplicons of the approximate target size were gel purified and cloned into the pCR2.1 vector (Invitrogen, Japan). Sequence similarity was analyzed using FastGroupII web-based software (34), and sequences with a 95% identity were tentatively assigned to the same phylotype. Amino acid sequences were aligned by ClustalW (31), including known and putative reductive dehalogenase sequences in the genome of Dehalococcoides ethenogenes strain 195 (28), as well as several functionally characterized reductive dehalogenases from other species.
Open in a separate windowa−, PCR product of expected size not amplified; +, PCR product of expected size weakly amplified; ++, PCR product of expected size amplified and confirmed by sequencing analysis.Putative rdhA genes were successfully detected by primer set RRF2-B1R in samples from the eastern equatorial Pacific (ODP site 1226, 3.2 and 46.7 m below the seafloor [mbsf]), the Peru margin (ODP site 1227, 0.3, 16.6, and 75.1 mbsf, and ODP site 1230, 0.3 mbsf), the Juan de Fuca Ridge flank (IODP site 1301, 2.5 mbsf), offshore from the Shimokita Peninsula of Japan (CK06-06 site C9001, 1.0, 13.5, 78.5, 191.5, 216.8, and 358.6 mbsf), and the Nankai Trough Forearc Basin off the Kii Peninsula of Japan (IODP site C0002, 1.9, 9.2, 20.2, and 66.6 mbsf) (Table (Table1).1). No amplification was observed in samples from several deep horizons at sites 1227, 1230, 1301, C9001, and C0002 (Table (Table1).1). A total of 92 clones of subseafloor putative rdhA genes were sequenced and classified into 32 phylotypes (Fig. (Fig.1).1). Phylogenetic analysis revealed that all of the detected putative rdhA sequences were related to those of Dehalococcoides.Open in a separate windowFIG. 1.Phylogenetic tree based on the deduced amino acid sequences of rdhA genes, including sequences from marine subsurface sediments. Putative rdhA sequences from marine subsurface sediments (rdhA clones 1 to 32) are marked in red, while those of the Dehalococcoides genome are marked in blue. Clonal frequencies and sequence accession numbers are indicated in parentheses. Bootstrap values from 50% to 84% and 85% to 100% are indicated by open and solid circles at the branches, respectively. Asterisks indicate the following functionally characterized rdhA genes: pceA and prdA, tetrachloroethene reductive dehalogenase; tceA, trichloroethene reductive dehalogenase; vcrA and bvcA, vinyl chloride reductive dehalogenase; dcaA, 1,2-dichloroethane reductive dehalogenase; cprA, chlorophenol reductive dehalogenase; and cbrA, chlorobenzene reductive dehalogenase. The tree was constructed by a neighbor-joining (NJ) method based on an alignment of almost-complete rdhA amino acid sequences with pairwise gap deletion on MEGA version 4.0 software (30). The resulting tree was displayed using Interactive Tree Of Life (19). The scale bar represents 0.1 substitutions per amino acid position.In the alignment of the subseafloor rdhA sequences, we observed two Fe-S cluster-binding motifs as a conserved structure of previously reported reductive dehalogenases (29). The sequences were amplified with primer RRF2 containing the N-terminal twin arginine translocation (Tat) signal sequence and primer B1R containing the rdhB genes encoding a putative dehalogenase membrane anchor protein (17). Thus, the dehalogenases of subseafloor bacteria have a structural framework similar to that of known dehalogenases from terrestrial Dehalococcoides species. However, BLASTP analysis showed that similarities among subseafloor rdhA sequences and previously reported dehalogenase sequences were generally low, ranging from 33.06% to 64.27%. Some sequences were affiliated, with relatively high bootstrap values, with subseafloor rdhA clusters I and II, which are clearly distinct from the rdhA sequences of Dehalococcoides and other known species (Fig. (Fig.1).1). In addition, we were unable to detect subseafloor rdhA genes using other primer sets targeting cprA- and pceA-like genes (26, 32). These results indicate that most subseafloor rdhA genes are distinct from those reported from terrestrial environments, a trend that corroborates the results of a metagenomic survey of subseafloor microbial communities at the Peruvian site (3). However, it is worth noting that the RRF2 and B1R primers used in this study are based on the rdhA sequences present in Dehalococcoides (17) and that sequence retrieval is probably biased by primer mismatch. It is thus likely that there are still unexplored functional genes related to the dehalorespiration pathways in marine subsurface sediments.An interesting finding of the functional gene survey is that the subseafloor rdhA homologues are preferentially detected in shallow sediments. At site C9001 off Japan, the sedimentation ratio is considerably higher than at other sites (54 to 95 cm per 1,000 years) (unpublished data), and rdhA genes were successfully detected in horizons as deep as 358 mbsf (Table (Table1).1). The rdhA genes were also detected in sediments from the open ocean at site 1226, which contained very low concentrations (<0.2%) of organic matter (7). This may be because halogenated compounds are derived not only from terrestrial environments but also from the seawater overlying the sediments. In addition, a diverse range of marine organisms, such as phytoplankton, mollusks, algae, polychaetes, jellyfish, and sponges, are known to produce halogenated organic compounds (11). For example, the amount of brominated organic compounds in the ocean has been estimated at 1 to 2 million tons per year (10). Since these halogenated compounds are generally recalcitrant or not metabolizable by aerobic microorganisms in the seawater column (15), they are effectively buried in marine subsurface sediments. In fact, debromination of brominated phenols in marine, estuarine, or intertidal strait sediments has been reported (4, 9, 16, 22), and a brominated phenol-dehalogenating microbial community has been observed in the marine sponge Aplysina aerophoba, which produces bromophenolic metabolites (1).We also observed reductive dehalogenation activity in subseafloor sediment slurry from site C0002 in the Nankai Trough (Fig. (Fig.2;2; also see the supplemental material). The slurry sample was prepared by mixing sediment samples from 1.9, 4.7, 9.2, 13.4, 20.2, 30.0, 66.6, and 155.4 mbsf. During the initial incubation with 2,4,6-tribromophenol (2,4,6-TBP) for 179 days, 2,4,6-TBP was completely converted to phenol. We then supplemented the same incubation slurry with 2,4,6-TBP and once again observed dehalogenation activity (Fig. (Fig.2A).2A). During the incubation, 2,4-dibromophenol and 4-bromophenol were produced as intermediates (Fig. (Fig.2C),2C), suggesting that ortho debromination occurred in preference to para debromination, as observed previously in marine sponge habitats (1). The maximum phenol production rate during the second incubation was calculated to be 0.094 μM per 1 cm3 of sediment per day (Fig. (Fig.2A2A).Open in a separate windowFIG. 2.Dehalogenation activities of subseafloor microbes. (A) Debromination of 2,4,6-TBP in a subseafloor sediment slurry from site C0002 in the Nankai Trough Forearc Basin. Arrow indicates the timing of 2,4,6-TBP supplementation. (B) Dechlorination of TCE in the same slurry sample. Sterilized control sediment slurries did not exhibit phenol and/or cis-DCE production (data not shown). (C) Potential debromination pathway of 2,4,6-TBP (solid arrows) and (D) potential dechlorination pathway of TCE (solid arrows) observed. The pathways indicated by dashed arrows were not observed in this experiment.Using the same sediment slurry sample, we also observed dehalogenation activity of trichloroethene (TCE), a substantial pollutant in the natural environment. During an incubation lasting more than 200 days, TCE was almost entirely converted to cis-dichloroethene (cis-DCE) (Fig. (Fig.2B).2B). The subsequent dechlorination step of cis-DCE, which is presumably from cis-DCE to monochloroethene, was not observed during the incubation. The rate of cis-DCE production was calculated as 0.045 μM per 1 cm3 of sediment per day.In conclusion, the observed molecular and activity data suggest that metabolically active dehalorespiring microbes are well represented in marine subsurface sediments and that these microbes may be widely distributed in Pacific Ocean margin sediments. Given the relatively high in vitro activity rates, we expect that subseafloor dehalorespiring microbes play important ecological roles in the biogeochemical cycles of chlorine, iodine, and bromine, as well as in halogenated carbon substrates. The distribution of in situ activity rates, chemical and geophysical constraints, metabolic characteristics of the individual dehalorespiring phylotypes, and genetic and enzymatic mechanisms of the microbes remain to be clarified. Nevertheless, the findings of this study provide new evidence of microbial functioning in the subseafloor ecosystem. 相似文献
TABLE 1.
Sample locations and results of PCR amplification of rdhASampling site (expedition name) | Location | Water depth (m) | Core section | Sediment depth (mbsf) | rdh amplification resulta |
---|---|---|---|---|---|
1226 (ODP Leg 201) | Eastern equatorial Pacific | 3,297 | 1-3 | 3.2 | ++ |
6-3 | 46.7 | ++ | |||
1227 (ODP Leg 201) | Southeast Pacific off Peru | 427 | 1-1 | 0.3 | + |
3-2 | 16.6 | + | |||
5D-5 | 42.0 | − | |||
9-3 | 75.1 | + | |||
1230 (ODP Leg 201) | Southeast Pacific off Peru | 5,086 | 1-1 | 0.3 | ++ |
10-3 | 73.8 | − | |||
27-3 | 209.3 | − | |||
1301 (IODP Expedition 301) | Northeast Pacific Juan de Fuca Ridge flank off Oregon | 2,656 | 1-2 | 2.5 | + |
6-6 | 51.2 | − | |||
11-1 | 90.8 | − | |||
1D-2 | 132.5 | − | |||
C9001 (JAMSTEC Chikyu Shakedown Expedition CK06-06) | Northwest Pacific off Japan | 1,180 | 1-1 | 1.0 | ++ |
2-5 | 13.5 | ++ | |||
9-4 | 78.5 | + | |||
21-4 | 191.5 | + | |||
24-4 | 216.8 | ++ | |||
25-6 | 228.9 | − | |||
38-7 | 346.3 | − | |||
40-3 | 358.6 | + | |||
C0002 (IODP Expedition 315) | Nankai Trough Forearc Basin off Japan | 1,937 | 1-3 | 1.9 | + |
1-6 | 4.7 | − | |||
2-4 | 9.2 | + | |||
2-8 | 13.4 | − | |||
3-5 | 20.2 | + | |||
4-5 | 30.0 | − | |||
8-3 | 66.6 | + | |||
16-4 | 155.4 | − |
18.
19.
Dione B. Rolim Marcos F. G. Rocha Raimunda S. N. Brilhante Rossana A. Cordeiro Natanael P. Leit?o-Junior Timothy J. J. Inglis José J. C. Sidrim 《Applied and environmental microbiology》2009,75(4):1215-1218
Melioidosis has been considered an emerging disease in Brazil since the first cases were reported to occur in the northeast region. This study investigated two municipalities in Ceará state where melioidosis cases have been confirmed to occur. Burkholderia pseudomallei was isolated in 26 (4.3%) of 600 samples in the dry and rainy seasons.Melioidosis is an endemic disease in Southeast Asia and northern Australia (2, 4) and also occurs sporadically in other parts of the world (3, 7). Human melioidosis was reported to occur in Brazil only in 2003, when a family outbreak afflicted four sisters in the rural part of the municipality of Tejuçuoca, Ceará state (14). After this episode, there was one reported case of melioidosis in 2004 in the rural area of Banabuiú, Ceará (14). And in 2005, a case of melioidosis associated with near drowning after a car accident was confirmed to occur in Aracoiaba, Ceará (11).The goal of this study was to investigate the Tejuçuoca and Banabuiú municipalities, where human cases of melioidosis have been confirmed to occur, and to gain a better understanding of the ecology of Burkholderia pseudomallei in this region.We chose as central points of the study the residences and surrounding areas of the melioidosis patients in the rural areas of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50′W) (Fig. (Fig.1).1). There are two well-defined seasons in each of these locations: one rainy (running from January to May) and one dry (from June to December). A total of 600 samples were collected at five sites in Tejuçuoca (T1, T2, T3, T4, and T5) and five in Banabuiú (B1, B2, B3, B4, and B5), distributed as follows (Fig. (Fig.2):2): backyards (B1 and T1), places shaded by trees (B2 and T2), water courses (B3 and T3), wet places (B4 and T4), and stock breeding areas (B5 and T5).Open in a separate windowFIG. 1.Municipalities of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50″W).Open in a separate windowFIG. 2.Soil sampling sites in Banabuiú and Tejuçuoca.Once a month for 12 months (a complete dry/rainy cycle), five samples were gathered at five different depths: at the surface and at 10, 20, 30 and 40 cm (Table (Table1).1). The samples were gathered according to the method used by Inglis et al. (9). Additionally, the sample processing and B. pseudomallei identification were carried out as previously reported (1, 8, 9).
Open in a separate windowaSites designated with B are in Banabuiú, and sites designated with T are in Tejuçuoca. See the text for details.The data on weather and soil composition were obtained from specialized government institutions, such as FUNCEME, IPECE, and EMBRAPA. The average annual temperature in both municipalities is between 26 and 28°C. In 2007, the annual rainfall in Tejuçuoca was 496.8 mm, and that in Banabuiú was 766.8 mm. There are a range of soil types in both Tejuçuoca and Banabuiú: noncalcic brown, sodic planossolic, red-yellow podzolic, and litholic. In Banabuiú, there are also alluvial and cambisol soils. The characteristic vegetation in both municipalities is caatinga (scrublands).There were isolates of B. pseudomallei in 26 (4.3%) of the 600 samples collected. The bacterium was isolated at a rate (3%) similar to that previously reported (9). The bacterium isolation occurred in both the dry (53.8%) and the rainy (46.2%) seasons. Tejuçuoca represented 76.9% (20/26) of the strains isolated. Four sites in Tejuçuoca (T1, T3, T4, and T5) and three in Banabuiú (B1, B2, and B4) presented isolates of the bacterium (Table (Table1).1). The isolation of the B. pseudomallei strains varied from the surface down to 40 cm. However, 17 of the 26 positive samples (65.3%) were found at depths between 20 and 40 cm (Table (Table1).1). Only two isolates were found at the surface during the dry season.A study in Vietnam (13) and one in Australia (9) reported the presence of B. pseudomallei near the houses of melioidosis patients. In our study, the same thing happened. Site T3 (15/26; 57.6%) was located 290 m from the patient''s house, as reported by the Rolim group (14).B. pseudomallei was isolated from a sheep paddock in Australia, where animals sought shelter below mango and fig trees (17). In our study, the bacterium was isolated at site T5, a goat corral alongside the house where the outbreak occurred in Tejuçuoca. Four sites in places shaded by trees yielded positive samples (30.7%) in both Tejuçuoca (palm trees) and Banabuiú (mango trees). Additionally, B. pseudomallei was isolated on three occasions from a cornfield (site 4B) located alongside the house of the melioidosis patient in Banabuiú.In the main areas of endemicity, the disease is more prevalent in the rainy season (4, 5, 16). The outbreak in Tejuçuoca was related to rainfall (14). Besides the association of cases of the disease with rainfall itself, the isolation of B. pseudomallei in soil and water was also demonstrated during the dry season (12, 15). An Australian study isolated strains from soil and water during the dry and rainy seasons (17). A Thai study also reported B. pseudomallei in the dry season (18). In our study, the isolation of B. pseudomallei took place either at the end of the wet season or in the dry months. Fourteen of the positive samples (53.8%) were collected during the dry season, albeit near a river or reservoir (sites T3 and B4).Physical, biological, and chemical soil features appear to influence the survival of B. pseudomallei (6, 10). In the present study, the soil was classified as litholic with sandy or clayey textures. It is susceptible to erosion, and when there is a lack of water, it is subject to salinization. During the dry season, the clay layer becomes dried, cracked, and very hard. During the rainy season, it becomes soggy and sticky. The isolation of B. pseudomallei in the dry season is possibly related to the capacity for adaptation of this soil, since the extreme conditions of lithosols do not prevent the bacterial growth and survival.It has been shown that B. pseudomallei is more often isolated at depths between 25 and 45 cm (17). In our study, 65.3% of the positive samples were taken at depths between 20 and 40 cm. Moreover, of these 17 samples, 10 (58.8%) were collected during the dry months. Also, unlike in other regions, two positive samples were taken from the surface in the period without rainfall.The rainfall in Tejuçuoca and Banabuiú is generally low, and temperatures do not vary significantly during the year. Therefore, the isolation of B. pseudomallei in these places occurs outside the rainfall, temperature, and moisture conditions observed in other regions of endemicity. Our data thus suggest that peculiar environmental features, such as soil composition, might favor the multiplication of B. pseudomallei in northeast Brazil. 相似文献
TABLE 1.
Distribution of samples with isolates by site and soil depthSitesa and depth (cm) | No. of B. pseudomallei isolates in samples from:
| ||
---|---|---|---|
Banabuiú (n = 300) | Tejuçuoca (n = 300) | Total (n = 600) | |
B1/T1 | 3 | ||
Surface | 2 | ||
10 | |||
20 | 1 | ||
30 | |||
40 | |||
B2/T2 | 1 | ||
Surface | 1 | ||
10 | |||
20 | |||
30 | |||
40 | |||
B3/T3 | 15 | ||
Surface | 2 | ||
10 | 2 | ||
20 | 4 | ||
30 | 3 | ||
40 | 4 | ||
B4/T4 | 5 | ||
Surface | |||
10 | 1 | ||
20 | 1 | ||
30 | 1 | 1 | |
40 | 1 | ||
B5/T5 | 2 | ||
Surface | |||
10 | |||
20 | |||
30 | 2 | ||
40 | |||
Total | 6 | 20 | 26 |