The structure and NO binding properties of the nitrophorin‐like heme‐binding protein from Arabidopsis thaliana gene locus At1g79260.1

The protein from Arabidopsis thaliana gene locus At1g79260.1 is comprised of 166‐residues and is of previously unknown function. Initial structural studies by the Center for Eukaryotic Structural Genomics (CESG) suggested that this protein might bind heme, and consequently, the crystal structures of apo and heme‐bound forms were solved to near atomic resolution of 1.32 Å and 1.36 Å, respectively. The rate of hemin loss from the protein was measured to be 3.6 × 10^?5 s^?1, demonstrating that it binds heme specifically and with high affinity. The protein forms a compact 10‐stranded β‐barrel that is structurally similar to the lipocalins and fatty acid binding proteins (FABPs). One group of lipocalins, the nitrophorins (NP), are heme proteins involved in nitric oxide (NO) transport and show both sequence and structural similarity to the protein from At1g79260.1 and two human homologues, all of which contain a proximal histidine capable of coordinating a heme iron. Rapid‐mixing and laser photolysis techniques were used to determine the rate constants for carbon monoxide (CO) binding to the ferrous form of the protein (k′_CO = 0.23 μM^?1 s^?1, k_CO = 0.050 s^?1) and NO binding to the ferric form (k′_NO = 1.2 μM^–1 s^–1, k_NO = 73 s^?1). Based on both structural and functional similarity to the nitrophorins, we have named the protein nitrobindin and hypothesized that it plays a role in NO transport. However, one of the two human homologs of nitrobindin contains a THAP domain, implying a possible role in apoptosis. Proteins 2010. © 2009 Wiley‐Liss, Inc.     

Structure‐kinetic relationship of carbapenem antibacterials permeating through E. coli OmpC porin

The emergence of Gram‐negative “superbugs” exhibiting resistance to known antibacterials poses a major public health concern. Low molecular weight Gram‐negative antibacterials are believed to penetrate the outer bacterial membrane (OM) through porin channels. Therefore, intracellular exposure needed to drive antibacterial target occupancy should depend critically on the translocation rates through these proteins and avoidance of efflux pumps. We used electrophysiology to study the structure‐translocation kinetics relationships of a set of carbapenem antibacterials through purified porin OmpC reconstituted in phospholipid bilayers. We also studied the relative susceptibility of OmpC+ and OmpC‐ E. coli to these compounds as an orthogonal test of translocation. Carbapenems exhibit good efficacy in OmpC‐expressing E. coli cells compared with other known antibacterials. Ertapenem, which contains an additional acidic group compared to other analogs, exhibits the fastest entry into OmpC (k_on ≈ 2 × 10⁴ M^?1 s^?1). Zwitterionic compounds with highly polar groups attached to the penem‐2 ring, including panipenem, imipenem and doripenem exhibit faster k_on (>10⁴ M^?1 s^?1), while meropenem and biapenem with fewer exposed polar groups exhibit slower k_on (～5 × 10³ M^?1 s^?1). Tebipenem pivoxil and razupenem exhibit ～13‐fold slower k_on (～1.5 × 10³ M^?1 s^?1) than ertapenem. Overall, our results suggest that (a) OmpC serves as an important route of entry of these antibacterials into E. coli cells; and (b) that the structure‐kinetic relationships of carbapenem translocation are governed by H‐bond acceptor/donor composition (in accordance with our previous findings that the enthalpic cost of transferring water from the constriction zone to bulk solvent increases in the presence of exposed nonpolar groups). Proteins 2014; 82:2998–3012. © 2014 Wiley Periodicals, Inc.     

Determination of the Superoxide Dismutase-Like Activity of Cimetidine-Cu(II) Complexes

Using the direct method of pulse radiolysis to determine the superoxide dismutase like activity of copper(II) cimetidine complexes, it was found that the reaction rate constant with O^?₂, k_cat, was (8.5 ± 0.5) × 10⁸ M^?1s^?1 independent of the cimetidine concentrations present in excess of 50–200 μM over the metal. The results suggest that either the 1:1 ligand to metal complex does not catalyze O^?₂ dismutation at a comparable rate to that of the 2:1 complex, or that the stability constant of the last species is much higher than that determined earlier by Kimura el al.,¹ and only the 2:1 species is present in the solutions. With the indirect methods of cytochrome c and NBT for determining the ability of these complexes to catalyze O^?₂ dismutation, these compounds exhibited a much lower SOD activity. and k_cat was determined to be (5.0 ± 0.3) × 10⁶ and (7.± 0.4) × 10¹ M^?1s^?1. respectively using the two assays.     

The optical biosensor study of the redox partner interaction with the cytochrome P450 2B4-containing monooxygenase system under hydroxylation conditions

The interactions between cytochrome P450 2B4 (d-2B4), NADPH:cytochrome P450 reductase and cytochrome b5 have been investigated in the monomeric reconstituted P450 2B4-containing monooxygenase system in the presence of a substrate (7-pentoxyresorufin) and an electron donor, NADPH. Each partner was immobilized via its amino groups on the carboxymethyldextran biochip surface of the optical biosensor IAsys+. Such mode immobilization was not accompanied by any loss of activities of the immobilized proteins. The formation of binary d-Fp/d-2B4 complexes was registered. The association/dissociation rate constants (k_on/k_off) were (0.013 ± 0.005) × 10⁶ M^?1 s^?1/0.05 ± 0.02 s^?1, and dissociation constant (K_D) was (0.26 ± 0.13) × 10^?6 M. Comparison of k_on, k_off and K_D values for d-Fp/d-2B4 complexes formed under hydroxylation (O-dealkylation) with corresponding constants obtained for the oxidized proteins of (0.10 ± 0.03) × 10⁶ M^?1 s^?1/(0.14 ± 0.06) s^?1, and (0.71 ± 0.37) × 10^?6 M, respectively shows that the decrease in k_on and an insignificant decrease in K_D are associated with the increase of complex lifetime during transition from the oxidized to hydroxylation conditions. Complex formation between d-Fp and d-b5 was not registered in both hydroxylation conditions and in the case of oxidized forms of these proteins. In both cases formation of the ternary d-Fp/d-2B4/d-b5 complexes occurred.     

Kinetics of some electron-transfer reactions in biological photosystems. I. Pulse radiolysis study of spinach ferredoxin reduction by the hydrated electron and CO−2 radical

The reduction of spinach ferredoxin by the CO^?₂ radical and the hydrated electron (e^?_aq) has been studied by pulse radiolysis in the pH range between 5.05 and 9.67. The reduction of oxidized spinach ferredoxin by both CO^?₂ and e^?_aq was found to be essentially quantitative. The CO^?₂ radical reduces spinach ferredoxin by a single second-order process at a rate k₅ = (6.2 ± 0.6) · 10⁷ M^?1 · s^?1. Reduction by e^?_aq follows a biphasic pathway. The first phase obeys second-order kinetics for the reduction of the cluster, k_app = (9.4 ± 0.3) · 10⁹ M^?1 · s^?1. The second phase follows an intramolecular first-order reaction k_B = (8.3 ± 1.7) · 10² s^?1 which is observed as a further reduction of the active site. Spectral changes accompanying the reduction of oxidized spinach ferredoxin in the ultraviolet and visible range are discussed.     

Flow injection chemiluminescence study of acridinium ester stability and kinetics of decomposition

Decomposition of phenyl acridinium-9-carboxylate is monitored using electrogenerated chemiluminescence in a flow system. The formation of the pseudobase from the acridinium ester [AE] is described by rate = k′₁[AE] + k″₁[AE][OH^?]^0.5, where k′₁ = 0.020 ± 0.006 s^?1 and k″₁ = 2.1 ± 0.8 (L/mol)^?0.5 s^?1. Irreversible decomposition of the pseudobase is described by rate = k′₂[AE][OH^?], where k′₂ = 20.1 ± 3.8 (L/mol s). These kinetic equations, plus measurement of variation in emission intensity for constant acridinium ester concentration, are used to predict the resulting emission intensity v. pH behaviour given various contact times (in the 0.25 to 25 s range) for the acridinium ester to be in an alkaline solution prior to initiation of the chemiluminescence reaction.     

Dynamics of molecular organization in agarose sulphate

Nongelling solutions of structurally regular chain segments of agarose sulphate show disorder–order and order–disorder transitions (as monitored by the temperature dependence of optical rotation) that are closely similar to the conformational changes that accompany the sol–gel and gel–sol transitions of the unsegmented polymer. The transition midpoint temperature (T_m) for formation of the ordered structure on cooling is ～25 K lower than T_m for melting. Salt-induced conformational ordering, monitored by polarimetric stopped-flow, occurs on a millisecond time scale, and follows the dynamics expected for the process 2 coil ? helix. The equilibrium constant for helix growth (s) was calculated as a function of temperature from the calorimetric enthalpy change for helix formation (ΔH_cal = ?3.0 ± 0.3 kJ per mole of disaccharide pairs in the ordered state), measured by differential scanning calorimetry. The temperature dependence of the nucleation rate constant (k_nuc), calculated from the observed second-order rate constant (k_obs) by the relationship k_obs = k_nuc(1 ? 1/s) gave the following activation parameters for nucleation of the ordered structure of agarose sulphate (1 mg mL^?1; 0.5M Me₄NCl or KCl): ΔH* = 112 ± 5 kJ mol^?1; ΔS* = 262 ± 20 J mol^?1 K^?1; ΔG*₂₉₈ = 34 ± 6 kJ mol^?1; (k_nuc)₂₉₈ = (7.5 ± 0.5) × 10⁶ dm³ mol^?1 s^?1. The endpoint of the fast relaxation process corresponds to the metastable optical rotation values observed on cooling from the fully disordered form. Subsequent slow relaxation to the true equilibrium values (i.e., coincident with those observed on heating from the fully ordered state) was monitored by conventional optical rotation measurements over several weeks and follows second-order kinetics, with rate constants of (2.25 ± 0.07) × 10^?4 and (3.10 ± 0.10) × 10^?4 dm³ mol^?1 s^?1 at 293.7 and 296.2 K, respectively. This relaxation is attributed to the sequential aggregation processes helix + helix → dimer, helix + dimer → trimer, etc., with depletion of isolated helix driving the much faster coil–helix equilibrium to completion. Light-scattering measurements above and below the temperature range of the conformational transitions indicate an average aggregate size of 2–3 helices.     

Analysis of the kinetics of electron transfer reactions of hemoglobin and myoglobin with inorganic complexes.

The kinetics of methemoglobin reduction by Fe(EDTA)^2? have been studied and found to follow a second order rate law with k = 29.0 $\text{M}$^?1 s^?1 [25°C, μ = 0.2 $\text{M}$, pH 7.0 (phosphate)], $\text{ΔH}{}^3\text{= 5.5 ± 0.7 kcal/mol}$, and $\text{ΔS}{}^2\text{= ?33 ± 2 e.u.}$. The electrostatics-corrected self-exchange rate constant (k₁₁^corr) for hemoglobin based on the Fe(EDTA)^2? cross-reaction is 2.79×10^?3$\text{M}$^?1 s^?1. This rate constant is compared with others reported for a water-soluble iron porphyrin and calculated from published data for the reactions of myoglobin and hemoglobin with Fe(EDTA)^2? and Fe(CDTA)^2?/?. The k₁₁^corr values for these systems range over ten orders of magnitude with heme ? myoglobin > hemoglobin.     

Structural features promoting dioxygen production by Dechloromonas aromatica chlorite dismutase

Chlorite dismutase (Cld) is a heme enzyme capable of rapidly and selectively decomposing chlorite (ClO₂ ⁻) to Cl⁻ and O₂. The ability of Cld to promote O₂ formation from ClO₂ ⁻ is unusual. Heme enzymes generally utilize ClO₂ ⁻ as an oxidant for reactions such as oxygen atom transfer to, or halogenation of, a second substrate. The X-ray crystal structure of Dechloromonas aromatica Cld co-crystallized with the substrate analogue nitrite (NO₂ ⁻) was determined to investigate features responsible for this novel reactivity. The enzyme active site contains a single b-type heme coordinated by a proximal histidine residue. Structural analysis identified a glutamate residue hydrogen-bonded to the heme proximal histidine that may stabilize reactive heme species. A solvent-exposed arginine residue likely gates substrate entry to a tightly confined distal pocket. On the basis of the proposed mechanism of Cld, initial reaction of ClO₂ ⁻ within the distal pocket generates hypochlorite (ClO⁻) and a compound I intermediate. The sterically restrictive distal pocket probably facilitates the rapid rebound of ClO⁻ with compound I forming the Cl⁻ and O₂ products. Common to other heme enzymes, Cld is inactivated after a finite number of turnovers, potentially via the observed formation of an off-pathway tryptophanyl radical species through electron migration to compound I. Three tryptophan residues of Cld have been identified as candidates for this off-pathway radical. Finally, a juxtaposition of hydrophobic residues between the distal pocket and the enzyme surface suggests O₂ may have a preferential direction for exiting the active site.     

GROWTH AND CARBON CONTENT OF THREE DIFFERENT‐SIZED DIAZOTROPHIC CYANOBACTERIA OBSERVED IN THE SUBTROPICAL NORTH PACIFIC1

To develop tools for modeling diazotrophic growth in the open ocean, we determined the maximum growth rate and carbon content for three diazotrophic cyanobacteria commonly observed at Station ALOHA (A Long‐term Oligotrophic Habitat Assessment) in the subtropical North Pacific: filamentous nonheterocyst‐forming Trichodesmium and unicellular Groups A and B. Growth‐irradiance responses of Trichodesmium erythraeum Ehrenb. strain IMS101 and Crocosphaera watsonii J. Waterbury strain WH8501 were measured in the laboratory. No significant differences were detected between their fitted parameters (±CI) for maximum growth rate (0.51 ± 0.09 vs. 0.49 ± 0.17 d^?1), half‐light saturation (73 ± 29 vs. 66 ± 37 μmol quanta · m^?2 · s^?1), and photoinhibition (0 and 0.00043 ± 0.00087 [μmol quanta · m^?2 · s^?1]^?1). Maximum growth rates and carbon contents of Trichodesmium and Crocosphaera cultures conformed to published allometric relationships, demonstrating that these relationships apply to oceanic diazotrophic microorganisms. This agreement promoted the use of allometric models to approximate unknown parameters of maximum growth rate (0.77 d^?1) and carbon content (480 fg C · μm^?3) for the uncultivated, unicellular Group A cyanobacteria. The size of Group A was characterized from samples from the North Pacific Ocean using fluorescence‐activated cell sorting and real‐time quantitative PCR techniques. Knowledge of growth and carbon content properties of these organisms facilitates the incorporation of different types of cyanobacteria in modeling efforts aimed at assessing the relative importance of filamentous and unicellular diazotrophs to carbon and nitrogen cycling in the open ocean.     

Unprecedented access of phenolic substrates to the heme active site of a catalase: Substrate binding and peroxidase‐like reactivity of Bacillus pumilus catalase monitored by X‐ray crystallography and EPR spectroscopy

Heme‐containing catalases and catalase‐peroxidases catalyze the dismutation of hydrogen peroxide as their predominant catalytic activity, but in addition, individual enzymes support low levels of peroxidase and oxidase activities, produce superoxide, and activate isoniazid as an antitubercular drug. The recent report of a heme enzyme with catalase, peroxidase and penicillin oxidase activities in Bacillus pumilus and its categorization as an unusual catalase‐peroxidase led us to investigate the enzyme for comparison with other catalase‐peroxidases, catalases, and peroxidases. Characterization revealed a typical homotetrameric catalase with one pentacoordinated heme b per subunit (Tyr340 being the axial ligand), albeit in two orientations, and a very fast catalatic turnover rate (k_cat = 339,000 s^?1). In addition, the enzyme supported a much slower (k_cat = 20 s^?1) peroxidatic activity utilizing substrates as diverse as ABTS and polyphenols, but no oxidase activity. Two binding sites, one in the main access channel and the other on the protein surface, accommodating pyrogallol, catechol, resorcinol, guaiacol, hydroquinone, and 2‐chlorophenol were identified in crystal structures at 1.65–1.95 Å. A third site, in the heme distal side, accommodating only pyrogallol and catechol, interacting with the heme iron and the catalytic His and Arg residues, was also identified. This site was confirmed in solution by EPR spectroscopy characterization, which also showed that the phenolic oxygen was not directly coordinated to the heme iron (no low‐spin conversion of the Fe^III high‐spin EPR signal upon substrate binding). This is the first demonstration of phenolic substrates directly accessing the heme distal side of a catalase. Proteins 2015; 83:853–866. © 2015 Wiley Periodicals, Inc.     

Reaction of cythchrome c with one-electron redox reagents. I. Reduction of ferricytochrome c by the hydrated electron produced by pulse radiolysis

Pulse radiolysis-kinetic spectrometry has been used to investigate the reaction of hydrated electrons with ferricytochrome c in dilute aqueous solution at pH 6.5–7.0. Time resolutions from 2·10^?7 to 1 s were employed. Transient spectra from 320 to 580 nm were characterized with a wavelength resolution of ±0.5 nm. 1 In neutral salt-free solution, k(ferricytochrome c+e^?_aq)=(6.0±0.9)·10¹⁰ M^?1·s^?1 and k(ferricytochrome c+H)=(1.2±0.2)·10¹⁰ M^?1·s^?1. The reaction of ferricytochrome c with hydrated electrons is sensitive to ionic strength; in 0.1 M NaClO₄, k(ferricytochrome c+e^?_aq)=(2.4±0.4)·10¹⁰ M^?1·s^?1. In contrast, k(ferricytochrome c+H) is insensitive to ionic strength. Time resolution of three spectral stages has been accomplished. The primary spectrum is the first observable spectrum detectable after irradiation and is formed in a second-order process. Its rate of formation is indisting-uishable from the rate of disappearance of the electron spectrum. The secondary spectrum is generated in a true first order intramolecular process, k(p→s)=(1.2±0.1)·10⁵ s^?1. The tertiary spectrum is also generated in a true first-order process, k(s→t)=(1.3±0.2)·10² s^?1. The specific rates of both transformations are independent of the wavelength of measurement. The tertiary spectrum, observable 50 ms after initial reaction and remaining unchanged thereafter for at least 1 s, shows that relaxed ferrocytochrome c is the only detectable product. This product is not autoxidizable, as expected for native reduced enzyme. It is more probable that the intramolecular changes responsible for the p→s and s→t spectral transformations involve the influence of conformational relaxation of ferrocytochrome c upon electronic energy states then that they are intramolecular transmission of reducing equivalents from primary sites of electron attachment.     

Astaxanthin diferulate as a bifunctional antioxidant

Abstract

Astaxanthin when esterified with ferulic acid is better singlet oxygen quencher with k₂ = (1.58 ± 0.1) 10¹⁰ L mol^{? 1}s^{? 1} in ethanol at 25°C compared with astaxanthin with k₂ = (1.12 ± 0.01) 10⁹ L mol^{? 1}s^{? 1}. The ferulate moiety in the astaxanthin diester is a better radical scavenger than free ferulic acid as seen from the rate constant of scavenging of 1-hydroxyethyl radicals in ethanol at 25°C with a second-order rate constant of (1.68 ± 0.1) 10⁸ L mol^{? 1}s^{? 1} compared with (1.60 ± 0.03) 10⁷ L mol^{? 1}s^{? 1} for the astaxanthin:ferulic acid mixture, 1:2 equivalents. The mutual enhancement of antioxidant activity for the newly synthetized astaxanthin diferulate becoming a bifunctional antioxidant is rationalized according to a two-dimensional classification plot for electron donation and electron acceptance capability.     

Peroxidase-like activities of iron(III)—Porphyrins: kinetics of the reduction of a peroxidatically active derivative of deuteroferriheme by anilines

The kinetics of the reduction by aniline and a series of substituted anilines of a peroxidatically active intermediate, formed by oxidation of deuteroferriheme with hydrogen peroxide, have been studied by stopped-flow spectrophotometry. The reaction with aniline was first order with respect to [intermediate] and showed first-order saturation kinetics with respect to [aniline]. The second-order rate constant was 2.0 ± 0.2 × 10⁵ M^?1 sec^?1 at 25°C (independent of pH in the range 6.60–9.68) compared with the value of 2.4 × 10⁵ M^?1 sec^?1 for the reaction of aniline with horseradish peroxidase Compound I. The effect of aniline substituents upon reactivity towards the heme intermediate closely paralled those reported for reaction with the enzymic intermediate. Anilines bearing electron-donating substituents reacted more rapidly and those bearing electron-withdrawing substituents more slowly than the unsubstituted amine. The rate constants for the heme intermediate reactions (k_dfh)found to be related to those for the enzymic reactions (k_hrp) by the equation:log k_DFH= 0.65log k_HRP+ 1.96 with a correlation coefficient of 0. 98.     

Free radicals and singlet oxygen scavengers: Reaction of a peroxy-radical with β-carotene,diphenyl furan and 1,4-diazobicyclo(2,2,2)-octane

The ‘singlet oxygen scavengers’. 1,4-diazobicyclo(2,2,2)-octane (DABCO), diphenyl furan and β-carotene react rapidly with the organic peroxyradical CCl₃O₂^?. The absolute reaction rate constants k = 1.2 ± 0.2 × 10⁷, 6 ± 2 × 10⁷ at 1.5 ± 0.2 × 10⁹ M^?1s^?1 respectively have been determined by pulse radiolysis. Comparison with other data suggest that other free radicals are also likely to react with these compounds; in the case of the hydroxyl radical and DABCO k = 1.25 × 10⁹ M^?1s^?1 has been determined.     

Substrate specificity characterization for eight putative nudix hydrolases. Evaluation of criteria for substrate identification within the Nudix family

The nearly 50,000 known Nudix proteins have a diverse array of functions, of which the most extensively studied is the catalyzed hydrolysis of aberrant nucleotide triphosphates. The functions of 171 Nudix proteins have been characterized to some degree, although physiological relevance of the assayed activities has not always been conclusively demonstrated. We investigated substrate specificity for eight structurally characterized Nudix proteins, whose functions were unknown. These proteins were screened for hydrolase activity against a 74‐compound library of known Nudix enzyme substrates. We found substrates for four enzymes with k_cat/K_m values >10,000 M^?1 s^?1: Q92EH0_LISIN of Listeria innocua serovar 6a against ADP‐ribose, Q5LBB1_BACFN of Bacillus fragilis against 5‐Me‐CTP, and Q0TTC5_CLOP1 and Q0TS82_CLOP1 of Clostridium perfringens against 8‐oxo‐dATP and 3'‐dGTP, respectively. To ascertain whether these identified substrates were physiologically relevant, we surveyed all reported Nudix hydrolytic activities against NTPs. Twenty‐two Nudix enzymes are reported to have activity against canonical NTPs. With a single exception, we find that the reported k_cat/K_m values exhibited against these canonical substrates are well under 10⁵ M^?1 s^?1. By contrast, several Nudix enzymes show much larger k_cat/K_m values (in the range of 10⁵ to >10⁷ M^?1 s^?1) against noncanonical NTPs. We therefore conclude that hydrolytic activities exhibited by these enzymes against canonical NTPs are not likely their physiological function, but rather the result of unavoidable collateral damage occasioned by the enzymes' inability to distinguish completely between similar substrate structures. Proteins 2016; 84:1810–1822. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.     

Disproportionation of pentaammineruthenium(III)–nucleoside complexes leads to two-electron oxidation of nucleosides without involving oxygen molecules

Pentaammineruthenium(III) complexes of deoxyinosine (dIno) and xanthosine (Xao) ([Ru^III(NH₃)₅(L)], L?is?dIno, Xao) in basic solution were studied by UV?Cvis spectroscopy, liquid chromatography/electrospray ionization mass spectrometry, and high-performance liquid chromatography. Both Ru^III complexes disproportionate to Ru^II and Ru^IV. Disproportionation followed the rate law d[Ru^II]/dt?=?(k _o?+?k ₁[OH^?])[Ru^III]. k _o and k ₁ of disproportionation at 25?°C were 2.1 (±0.1)?×?10^?3?s^?1 and 21.4?±?3.2?M^?1 s^?1, respectively, for [Ru^III(NH₃)₅(dIno)], and 3.5 (±0.7)?×?10^?4?s^?1 and 59.7?±?3.6?M^?1?s^?1, respectively, for [Ru^III(NH₃)₅(Xao)]. The [Ru^III(NH₃)₅(Xao)] complex disproportionates at a faster rate than [Ru^III(NH₃)₅(dIno)] owing to the stronger electron-withdrawing effect of exocyclic oxygen in Xao. The activation parameters ??H ^? and ??S ^? for k ₁ of [Ru^III(NH₃)₅(dIno)] were 80.2?±?15.2?kJ?mol^?1 and 47.6?±?9.8?J?K^?1 mol^?1, respectively, indicating that the disproportionation of Ru^III to Ru^II and Ru^IV is favored owing to the positive entropy of activation. The final products of both complexes in basic solution under Ar were compared with those under O₂. Under both conditions [Ru(NH₃)₅(8-oxo-L)] was produced, but via different mechanisms. In both aerobic and anaerobic conditions, the deprotonation of highly positively polarized C8-H of Ru-L by OH^? initiates a two-electron redox reaction. For the next step, we propose a one-step two-electron redox reaction between L and Ru^IV under anaerobic conditions, which differentiates from Clarke??s mechanism of two consecutive one-electron redox reactions between L, Ru^III, and O₂.     

Evaluation of the Antioxidant Actions of Ferulic Acid and Catechins

We have evaluated the abilities of ferulic acid, (±) catechin, (+) catechin and (-) epicatechin to scavenge the reactive oxygen species hydroxyl radical (OH±), hypochlorous acid (HOCl) and peroxyl radicals (RO₂).

Ferulic acid tested at concentrations up to 5 mM inhibited the peroxidation of phospholipid liposomes. Both (±) and (+) catechin and (-) epicatechin were much more effective. All the compounds tested reacted with trichloromethyl peroxyl radical (CCl₃O₂) with rate constants > 1 × 10⁶M^?1s^?1.

A mixture of FeCl₃-EDTA, hydrogen peroxide (H₂O₂) and ascorbic acid at pH 7.4, has often been used to generate hydroxyl radicals (OH.) which are detected by their ability to cause damage to the sugar deoxyribose. Ferulic acid, (+) and (±) catechin and (-) epicatechin inhibited deoxyribose damage by reacting with OH. with rate constants of 4.5 × 10⁹M^?1s^?1, 3.65 × 10⁹M^?1s^?1, 2.36 × 10⁹M^?1s^?1 and 2.84 × 10⁹M^?1s^?1 respectively. (-) Epicatechin, ferulic acid and the (+) and (±) catechins exerted pro-oxidant action, accelerating damage to DNA in the presence of a bleomycin-iron complex. On a molar basis, ferulic acid was less effective in causing damage to DNA compared with the catechins.

A mixture of hypoxanthine and xanthine oxidase generates O₂ which reduces cytochrome c to ferrocytochrome c. (+) Catechin and (-) epicatechin inhibited the reduction of cytochrome c in a concentration dependent manner. Ferulic acid and (±) catechin had only weak effects.

All the compounds tested were able to scavenge hypochlorous acid at a rate sufficient to protect alpha-1-antiproteinase against inactivation. Our results show that catechins and ferulic acid possess antioxidant properties. This may become important given the current search for “natural” replacements for synthetic antioxidant food additives.     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com