Simple-MSSM: a simple and efficient method for simultaneous multi-site saturation mutagenesis

Objective

To develop a practically simple and robust multi-site saturation mutagenesis (MSSM) method that enables simultaneously recombination of amino acid positions for focused mutant library generation.

Results

A general restriction enzyme-free and ligase-free MSSM method (Simple-MSSM) based on prolonged overlap extension PCR (POE-PCR) and Simple Cloning techniques. As a proof of principle of Simple-MSSM, the gene of eGFP (enhanced green fluorescent protein) was used as a template gene for simultaneous mutagenesis of five codons. Forty-eight randomly selected clones were sequenced. Sequencing revealed that all the 48 clones showed at least one mutant codon (mutation efficiency = 100%), and 46 out of the 48 clones had mutations at all the five codons. The obtained diversities at these five codons are 27, 24, 26, 26 and 22, respectively, which correspond to 84, 75, 81, 81, 69% of the theoretical diversity offered by NNK-degeneration (32 codons; NNK, K = T or G).

Conclusion

The enzyme-free Simple-MSSM method can simultaneously and efficiently saturate five codons within one day, and therefore avoid missing interactions between residues in interacting amino acid networks.

     

The cytochrome oxidase II gene in mitochondria of the sugar-beetBeta vulgaris L.

We have cloned and analyzed the sugar-beet mitochondrial gene for cytochrome oxidase subunit II (coxII). The sugar-beet and its deduced amino acid sequence were compared to its homologouscoxII gene sequences from both monocot and dicot plants. It was found to be highly conserved (89–95%) compared to homologue in other plant species. The 780 bp coding sequence of the sugar beetcoxII gene is interrupted at position 383 by a 1463 bp intron. This intron contains an additional 107 bp sequence that is not found in any of the plantcoxII genes studied thus far. The structure of the intron suggests that a large intron existed in an ancestralcoxII gene before monocots and dicots diverged in evolution. Three CGG codons in the sugar-beetcoxII coding sequence align with conserved tryptophan residues in the homologous gene of other species, suggesting that RNA editing takes place also in sugar-beet mitochondria. In 13 out of 24 codons ofcoxII mRNA that were found to be edited in four other plants, the sugar-beet gene already utilizes the edited codons. This phenomenon may indicate that the mitochondrial genome in sugar-beet is phylogenetically more archaic relative to these plants. An additional sequence of 279 bp that is identical to the first exon ofcoxII was identified in the mtDNA of the sugar-beet. This pseudo-gene is transcribed and its existence in the mitochondrial genome is unexplained.     

A Fundamental Problem with Amino-Acid-Sequence Characters for Phylogenetic Analyses

Protein-coding genes may be analyzed in phylogenetic analyses using nucleotide-sequence characters and/or amino-acid-sequence characters. Although amino-acid-sequence characters "correct" for saturation (parallelism), amino-acid-sequence characters are subject to convergence and ignore phylogenetically informative variation. When all nucleotide-sequence characters have a consistency index of 1, characters coded using the amino acid sequence may have a consistency index of less than 1. The reason for this is that most amino acids are specified by more than one codon. If two different codons that both code for the same amino acid are derived independent of one another in divergent lineages, nucleotide-sequence characters may not be homoplasious when amino-acid-sequence characters may be homoplasious. Not only may amino-acid-sequence characters support groupings that are not supported by nucleotide-sequence characters, they may support contradictory groupings. Because this convergence is a problem of character delimitation, it affects the results of all tree-construction methods (maximum likelihood, neighbor joining, parsimony, etc.). In effect, coding amino-acid-sequence characters instead of nucleotide-sequence characters putatively corrects for saturation and definitely causes a convergence problem. An empirical example from the Mhc locus is given.     

A hotspot for transition mutations in the rIIB gene of bacteriophage T4

Summary We have previously demonstrated that the sequence 5TGGCAA 3 located at codons 32–33 of the rIIB gene of bacteriophage T4 is a hotspot for transition mutations (Nelson et al. 1981). Here I report the properties of the same TGGCAA sequence introduced into the gene at codons 11–12. The sequence is highly mutable in both locations, suggesting that its high mutability is due to features of the TGGCAA itself and is not dependent on the immediate juxtaposition of additional external sequences. Within this sequence, at either location, only the transition at the central G:C pair frequently arises spontaneously or by 2-aminopurine or ethylmethane sulfonate mutagenesis. However, the 3 G:C pair, in addition, is highly mutable after nitrous acid or hydroxylamine treatment. This suggests that, within the TGGCAA sequence, there are two hotspots which are targeted by different mutagens.     

The yeast pyruvate kinase gene does not contain a string of non-preferred codons: revised nucleotide sequence

The sequence of the gene encoding pyruvate kinase from Saccharomyces cerevisiae was re-determined because of failures with oligonucleotide-directed mutagenesis experiments involving a region thought to contain a string of five contiguous non-preferred codons. This region was found to be difficult to sequence and was shown to have three extra bases when compared with the published sequence [(1983) J. Biol. Chem. 258, 2193-2201]. The revised sequence demonstrates that the yeast pyruvate kinase gene does not have a cluster of non-preferred codons, and that it therefore is not an example of the class of genes which possibly exhibit translational control by the presence of non-preferred codons.     

Forbidden synonymous substitutions in coding regions

In the evolution of highly conserved genes, a few "synonymous" substitutions at third bases that would not alter the protein sequence are forbidden or very rare, presumably as a result of functional requirements of the gene or the messenger RNA. Another 10% or 20% of codons are significantly less variable by synonymous substitution than are the majority of codons. The changes that occur at the majority of third bases are subject to codon usage restrictions. These usage restrictions control sequence similarities between very distant genes. For example, 70% of third bases are identical in calmodulin genes of man and trypanosome. Third-base similarities of distant genes for conserved proteins are mathematically predicted, on the basis of the G+C composition of third bases. These observations indicate the need for reexamination of methods used to calculate synonymous substitutions.      

Characterization of the ksgA gene of Escherichia coli determining kasugamycin sensitivity

In the plasmid pUC8ksgA7, the coding region of the ksgA gene is preceded by the lac promoter (Plac) and a small open reading frame (ORF). This ORF of 15 codons is composed of nucleotides derived from the lacZ gene, a multiple cloning site and the ksgA gene itself. The reading frame begins with the ATG initiation codon of lacZ and ends a few nucleotides beyond the ATG start codon of ksgA. The ksgA gene is not preceded by a Shine-Dalgarno (SD) signal. Cells transformed with pUC8ksgA7 produce active methylase, the product of the ksgA gene. Introduction of an in-phase TAA stop codon in the small ORF abolishes methylase production in transformed cells. On the plasmid pUC8ksgA5, which contains the entire ksgA region, the promoter of the ksgA gene was found to reside in a 380 base pair Bgl1-Pvu2 restriction fragment, partly overlapping the ksgA gene, by two independent methods. Cloning of this fragment in front of the galK gene in plasmid pKO1 stimulates galactokinase activity in transformants and its insertion into the expression vector pKL203 makes beta-galactosidase synthesis independent of the presence of Plac. The sequence of the Bgl1-Pvu2 fragment was determined and a putative promoter sequence identified. An SD signal could not be distinguished at a proper distance upstream from the ksgA start codon. Instead, an ORF of 13 codons starting with ATG in tandem with an SD signal and ending 4 codons ahead of the ksgA gene was identified. This suggests that translation of the ORF is required for expression of the ksgA gene.(ABSTRACT TRUNCATED AT 250 WORDS)     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

Isolation and sequence of the structural gene for cytochrome c oxidase subunit VI from Saccharomyces cerevisiae

Using synthetic oligodeoxyribonucleic acid probes we have identified and isolated COX6, the structural gene for subunit VI of cytochrome c oxidase from Saccharomyces cerevisiae. The nucleotide sequence of COX6 predicts an amino acid sequence, for the mature subunit VI polypeptide, which is in perfect agreement with that determined previously. The nucleotide sequence of COX6 also predicts that subunit VI is derived from a precursor with a highly basic 40-amino acid NH2-terminal presequence. This precursor has been observed after in vitro translations programmed by yeast poly(A+)RNA. Northern blot analysis of poly(A+) RNA from strain D273-10B reveals that COX6 is homologous to three RNAs of 1800, 900, and 700 bases in length. By means of Southern blot analysis, the cloned gene was shown to be co-linear with yeast chromosomal DNA and to exist in a single copy in the yeast genome. An additional open reading frame, consisting of 82 codons, terminates 22 codons upstream from COX6. It is "in frame" with the COX6 coding region.     

Initiation of translation by non-AUG codons in human T-cell lymphotropic virus type I mRNA encoding both Rex and Tax regulatory proteins

Human T-cell lymphotropic virus type I (HTLV-I) double-spliced mRNA exhibits two GUG and two CUG codons upstream to, and in frame with, the sequences encoding Rex and Tax regulatory proteins, respectively. To verify whether these GUG and CUG codons could be used as additional initiation codons of translation, two chimeric constructs were built for directing the synthesis of either Rex–CAT or Tax–CAT fusion proteins. In both cases, the CAT reporter sequence was inserted after the Tax AUG codon and in frame with either the Rex or Tax AUG codon. Under transient expression of these constructs, other proteins of higher molecular mass were synthesized in addition to the expected Rex–CAT and Tax–CAT proteins. The potential non-AUG initiation codons were exchanged for either an AUG codon or a non-initiation codon. This allowed us to demonstrate that the two GUG codons in frame with the Rex coding sequence, and only the second CUG in frame with the Tax coding sequence, were used as additional initiation codons. In HTLV-I infected cells, two Rex and one Tax additional proteins were detected that exhibited molecular mass compatible with the use of the two GUG and the second CUG as additional initiation codons of translation. Comparison of the HTLV-I proviral DNA sequence with that of other HTLV-related retroviruses revealed a striking conservation of the three non-AUG initiation codons, strongly suggesting their use for the synthesis of additional Rex and Tax proteins.     

Structure of the gene encoding the exoglucanase of Cellulomonas fimi

In Cellulomonas fimi the cex gene encodes an exoglucanase (Exg) involved in the degradation of cellulose. The gene now has been sequenced as part of a 2.58-kb fragment of C. fimi DNA. The cex coding region of 1452 bp (484 codons) was identified by comparison of the DNA sequence to the N-terminal amino acid (aa) sequence of the Exg purified from C. fimi. The Exg sequence is preceded by a putative signal peptide of 41 aa, a translational initiation codon, and a sequence resembling a ribosome-binding site five nucleotides (nt) before the initiation codon. The nt sequence immediately following the translational stop codon contains four inverted repeats, two of which overlap, and which can be arranged in stable secondary structures. The codon usage in C. fimi appears to be quite different from that of Escherichia coli. A dramatic (98.5%) bias occurs for G or C in the third position for the 35 codons utilized in the cex gene.     

The corrected nucleotide sequences of the TaqI restriction and modification enzymes reveal a thirteen-codon overlap.

The nucleotide sequence of the genes encoding methyltransferase TaqI (M.TaqI) and restriction endonuclease TaqI (R.TaqI) with the recognition sequence, TCGA, were analyzed in clones isolated from independent libraries. The genes, originally reported as 363 and 236 codons long [Slatko et al., Nucleic Acids Res. 15 (1987) 9781-9796] were redetermined as 421 and 263 codons long, respectively. The C terminus of the taqIM gene overlaps the N terminus of the taqIR gene by 13 codons, as observed with the isoschizomeric TthHB8I restriction-modification system [Barany et al., Gene 112 (1992) 13-20]. Removal of the overlapping codons did not interfere with in vivo M.TaqI activity. We postulate the overlap plays a role in regulating taqIR expression.     

Statistical evaluation of the coding capacity of complementary DNA strands

Two independent methods are used to evaluate the protein-coding information content in different classes of DNA sequences. The first method allows to evaluate the statistical relevance of finding unidentified reading frames, longer than 100 codons, on both DNA strands of: a) 117 DNA sequences that code for 142 nuclear proteins; b) 39 stable RNA coding sequences and c) 36 other DNA sequences which include regulatory and as yet unknown function sequences. The finding of 50 reading frames longer than 100 codons (complementary inverted proteins or c.i.p. genes) located on the DNA strand complementary to the protein-coding one is drastically in excess of the number predicted by chance alone. An independent method (testcode) applied to c.i.p. gene sequences, which assigns the probability of coding to a given sequence, predicts that more than 50% of these genes are translated in a functional product. These analyses indicate the existence of a new class of protein-coding genes, located on the DNA sequences complementary to the protein-coding DNA strand.     

Translational regulation of human methionine synthase by upstream open reading frames

Methionine synthase is a key enzyme poised at the intersection of folate and sulfur metabolism and functions to reclaim homocysteine to the methionine cycle. The 5' leader sequence in human MS is 394 nucleotides long and harbors two open reading frames (uORFs). In this study, regulation of the main open reading frame by the uORFs has been elucidated. Both uORFs downregulate translation as demonstrated by mutation of the upstream AUG codons (uAUG) either singly or simultaneously. The uAUGs are capable of recruiting the 40S ribosomal complex as revealed by their ability to drive reporter expression in constructs in which the luciferase is fused to the uORFs. uORF2, which is predicted to encode a 30 amino acid long polypeptide, has a clustering of rare codons encoding arginine and proline. Mutation of a tandemly repeated rare codon for arginine at positions 3 and 4 in uORF2 to either common codons for the same amino acid or common codons for alanine results in complete alleviation of translation inhibition. This suggests a mechanism for ribosome stalling and demonstrates that the cis-effects on translation by uORF2 is dependent on the nucleotide sequence but is apparently independent of the sequence of the encoded peptide. This study reveals complex regulation of the essential housekeeping gene, methionine synthase, by the uORFs in its leader sequence.     

Estimating the "effective number of codons": the Wright way of determining codon homozygosity leads to superior estimates

In 1990, Frank Wright introduced a method for measuring synonymous codon usage bias in a gene by estimation of the "effective number of codons," N(c). Several attempts have been made recently to improve Wright's estimate of N(c), but the methods that work in cases where a gene encodes a protein not containing all amino acids with degenerate codons have not been tested against each other. In this article I derive five new estimators of N(c) and test them together with the two published estimators, using resampling under rigorous testing conditions. Estimation of codon homozygosity, F, turns out to be a key to the estimation of N(c). F can be estimated in two closely related ways, corresponding to sampling with or without replacement, the latter being what Wright used. The N(c) methods that are based on sampling without replacement showed much better accuracy at short gene lengths than those based on sampling with replacement, indicating that Wright's homozygosity method is superior. Surprisingly, the methods based on sampling with replacement displayed a superior correlation with mRNA levels in Escherichia coli.     

Influence of intercodon and base frequencies on codon usage in filarial parasites

Base frequency, codon usage, and intercodon identity were analyzed in five filarial parasite species representing five Onchocercidae genera. Wucheria bancrofti, Brugia malayi, Onchocerca volvulus, Acanthocheilonema viteae, and Dirofilaria immitis gene sequences were downloaded from NCBI, and analysis was performed using locally designed computer programs and other freely available applications. A clear sequence bias was observed among the nematode species examined. At the nucleotide level, AT basepairs were present in gene sequences at higher frequencies than GC. In addition, codons ending in A or T were used proportionately more than those with G or C in the third-codon position. In addition, the amino acids used most often corresponded to codons ending in AT basepairs. Intercodon base proportion was biased in that A was found most often at N4, second only to T in certain specific cases. Since all of these sequence biases were observed in a relatively consistent fashion among all of the organisms studied, we conclude that sequence bias is a genetic characteristic, which is associated with multiple filarial genera.     

Ribosomal frameshifting in the yeast retrotransposon Ty: tRNAs induce slippage on a 7 nucleotide minimal site

Ribosomal frameshifting regulates expression of the TYB gene of yeast Ty retrotransposons. We previously demonstrated that a 14 nucleotide sequence conserved between two families of Ty elements was necessary and sufficient to support ribosomal frameshifting. This work demonstrates that only 7 of these 14 nucleotides are needed for normal levels of frameshifting. Any change to the sequence CUU-AGG-C drastically reduces frameshifting; this suggests that two specific tRNAs, tRNA(UAGLeu) and tRNA(CCUArg), are involved in the event. Our tRNA overproduction data suggest that a leucyl-tRNA, probably tRNA(UAGLeu), an unusual leucine isoacceptor that recognizes all six leucine codons, slips from CUU-Leu onto UUA-Leu (in the +1 reading frame) during a translational pause at the AGG-Arg codon induced by the low availability of tRNA(CCUArg), encoded by a single-copy essential gene. Frameshifting is also directional and reading frame specific. Interestingly, frameshifting is inhibited when the "slip" CUU codon is located three codons downstream, but not four or more codons downstream, of the translational initiation codon.     

Codon catalog usage and the genome hypothesis.

Frequencies for each of the 61 amino acid codons have been determined in every published mRNA sequence of 50 or more codons. The frequencies are shown for each kind of genome and for each individual gene. A surprising consistency of choices exists among genes of the same or similar genomes. Thus each genome, or kind of genome, appears to possess a "system" for choosing between codons. Frameshift genes, however, have widely different choice strategies from normal genes. Our work indicates that the main factors distinguishing between mRNA sequences relate to choices among degenerate bases. These systematic third base choices can therefore be used to establish a new kind of genetic distance, which reflects differences in coding strategy. The choice patterns we find seem compatible with the idea that the genome and not the individual gene is the unit of selection. Each gene in a genome tends to conform to its species' usage of the codon catalog; this is our genome hypothesis.