Yeast mRNA Poly(A) tail length control can be reconstituted in vitro in the absence of Pab1p-dependent Poly(A) nuclease activity

Regulation of poly(A) tail length during mRNA 3'-end formation requires a specific poly(A)-binding protein in addition to the cleavage/polyadenylation machinery. The mechanism that controls polyadenylation in mammals is well understood and involves the nuclear poly(A)-binding protein PABPN1. In contrast, poly(A) tail length regulation is poorly understood in yeast. Previous studies have suggested that the major cytoplasmic poly(A)-binding protein Pab1p acts as a length control factor in conjunction with the Pab1p-dependent poly(A) nuclease PAN, to regulate poly(A) tail length in an mRNA specific manner. In contrast, we recently showed that Nab2p regulates polyadenylation during de novo synthesis, and its nuclear location is more consistent with a role in 3'-end processing than that of cytoplasmic Pab1p. Here, we investigate whether PAN activity is required for de novo poly(A) tail synthesis. Components required for mRNA 3'-end formation were purified from wild-type and pan mutant cells. In both situations, 3'-end formation could be reconstituted whether Nab2p or Pab1p was used as the poly(A) tail length control factor. However, polyadenylation was more efficient and physiologically more relevant in the presence of Nab2p as opposed to Pab1p. Moreover, cell immunofluorescence studies confirmed that PAN subunits are localized in the cytoplasm which suggests that cytoplasmic Pab1p and PAN may act at a later stage in mRNA metabolism. Based on these findings, we propose that Nab2p is necessary and sufficient to regulate poly(A) tail length during de novo synthesis in yeast.     

Molecular dissection of mRNA poly(A) tail length control in yeast

In eukaryotic cells, newly synthesized mRNAs acquire a poly(A) tail that plays several fundamental roles in export, translation and mRNA decay. In mammals, PABPN1 controls the processivity of polyadenylation and the length of poly(A) tails during de novo synthesis. This regulation is less well-detailed in yeast. We have recently demonstrated that Nab2p is necessary and sufficient for the regulation of polyadenylation and that the Pab1p/PAN complex may act at a later stage in mRNA metabolism. Here, we show that the presence of both Pab1p and Nab2p in reconstituted pre-mRNA 3′-end processing reactions has no stimulating nor inhibitory effect on poly(A) tail regulation. Importantly, the poly(A)-binding proteins are essential to protect the mature mRNA from being subjected to a second round of processing. We have determined which domains of Nab2p are important to control polyadenylation and found that the RGG-box work in conjunction with the two last essential CCCH-type zinc finger domains. Finally, we have tried to delineate the mechanism by which Nab2p performs its regulation function during polyadenylation: it likely forms a complex with poly(A) tails different from a simple linear deposit of proteins as it has been observed with Pab1p.     

Yeast poly(A)-binding protein Pab1 shuttles between the nucleus and the cytoplasm and functions in mRNA export

Pab1 is the major poly(A)-binding protein in yeast. It is a multifunctional protein that mediates many cellular functions associated with the 3'-poly(A)-tail of messenger RNAs. Here, we characterize Pab1 as an export cargo of the protein export factor Xpo1/Crm1. Pab1 is a major Xpo1/Crm1-interacting protein in yeast extracts and binds directly to Xpo1/Crm1 in a RanGTP-dependent manner. Pab1 shuttles rapidly between the nucleus and the cytoplasm and partially accumulates in the nucleus when the function of Xpo1/Crm1 is inhibited. However, Pab1 can also be exported by an alternative pathway, which is dependent on the MEX67-mRNA export pathway. Import of Pab1 is mediated by the import receptor Kap108/Sxm1 through a nuclear localization signal in its fourth RNA-binding domain. Interestingly, inhibition of Pab1's nuclear import causes a kinetic delay in the export of mRNA. Furthermore, the inviability of a pab1 deletion strain is suppressed by a mutation in the 5'-3' exoribonuclease RRP6, a component of the nuclear exosome. Therefore, nuclear Pab1 may be required for efficient mRNA export and may function in the quality control of mRNA in the nucleus.     

The yeast poly(A)-binding protein Pab1p stimulates in vitro poly(A)-dependent and cap-dependent translation by distinct mechanisms.

Translation initiation in extracts from Saccharomyces cerevisiae involves the concerted action of the cap-binding protein eIF4E and the poly(A) tail-binding protein Pab1p. These two proteins bind to translation initiation factor eIF4G and are needed for the translation of capped or polyadenylated mRNA, respectively. Together, these proteins synergistically activate the translation of a capped and polyadenylated mRNA. We have discovered that excess Pab1p also stimulates the translation of capped mRNA in extracts, a phenomenon that we define as trans-activation. Each of the above activities of Pab1p requires its second RNA recognition motif (RRM2). We have found that RRM2 from human PABP cannot substitute functionally for yeast RRM2. Using the differences between human and yeast RRM2 sequences as a guide, we have mutagenized yeast RRM2 and discovered residues that are required for eIF4G binding and poly(A)-dependent translation but not for trans-activation. Similarly, other residues within RRM2 were found to be required for trans-activation but not for eIF4G binding or poly(A)-dependent translation. These data show that Pab1p has at least two biochemically distinct activities in translation extracts.     

Role of poly(A) tail length in Alu retrotransposition

Alu are mobile noncoding Short INterspersed Elements (SINEs) present at a million copies in the human genome. Using marked Alu sequences in an ex vivo assay, we previously showed that they are mobilized through diversion of the LINE (Long INterspersed Elements) retrotransposition machinery, with the poly(A) tail of the Alu being required for their mobility. Here we show that other homopolymeric tracts cannot functionally replace the Alu poly(A) tail, and that the Alu transposition rate varies over a two-log range depending on the poly(A) tail length. Variation is according to a sigmoid-shaped curve with a lag observed for tails shorter than 15 nt and a plateau reached for tails longer than 50 nt, consistent with the binding of a limited number of a protein component requiring multiple contacts for a productive interaction with the poly(A) stretch. This analysis indicates that most of the naturally occurring genomic Alu, owing to their pA tail length, should be poor substrates for the LINE machinery, a feature possibly "selected" for the host sake.     

Rrp6p controls mRNA poly(A) tail length and its decoration with poly(A) binding proteins

Poly(A) (pA) tail binding proteins (PABPs) control mRNA polyadenylation, stability, and translation. In a purified system, S. cerevisiae PABPs, Pab1p and Nab2p, are individually sufficient to provide normal pA tail length. However, it is unknown how this occurs in more complex environments. Here we find that the nuclear exosome subunit Rrp6p counteracts the in vitro and in vivo extension of mature pA tails by the noncanonical pA polymerase Trf4p. Moreover, PABP loading onto nascent pA tails is controlled by Rrp6p; while Pab1p is the major PABP, Nab2p only associates in the absence of Rrp6p. This is because Rrp6p can interact with Nab2p and displace it from pA tails, potentially leading to RNA turnover, as evidenced for certain pre-mRNAs. We suggest that a nuclear mRNP surveillance step involves targeting of Rrp6p by Nab2p-bound pA-tailed RNPs and that pre-mRNA abundance is regulated at this level.     

PAN3 encodes a subunit of the Pab1p-dependent poly(A) nuclease in Saccharomyces cerevisiae.

The Pab1p-dependent poly(A) nuclease (PAN) from Saccharomyces cerevisiae copurifies with polypeptides of approximately 127 and 76 kDa. Previously, it was demonstrated that the 127-kDa Pan2 protein is required for PAN activity (R. Boeck, S. Tarun, M. Reiger, J. Deardorff, S. Müller-Auer, and A.B. Sachs, J. Biol. Chem. 271:432-438, 1996). Here we demonstrate that the 76-kDa protein, encoded by the nonessential PAN3 gene, is also required for enzymatic activity. Deletion of PAN3 resulted in the loss of PAN activity in yeast extracts, and immunodepletion of Pan3p from purified PAN fractions abolished enzymatic activity. We show by coimmunoprecipitation and directed two-hybrid studies that the Pan2 and Pan3 proteins physically interact. In addition, we demonstrate that a deletion of PAN2, PAN3, or both resulted in similar increases in mRNA poly(A) tail lengths in vivo. These data strongly suggest that both Pan2p and Pan3p are required subunits of the PAN enzyme and that PAN functions in vivo to shorten mRNA poly(A) tails.     

Messenger RNA stability in Saccharomyces cerevisiae: the influence of translation and poly(A) tail length.

A comparison between the half-lives of 10 specific yeast mRNAs and their distribution within polysomes (fractionated on sucrose density gradients) was used to test the relationship between mRNA translation and degradation in the eukaryote Saccharomyces cerevisiae. Although the mRNAs vary in their distribution across the same polysome gradients, there is no obvious correlation between the stability of an mRNA and the number of ribosomes it carries in vivo. This suggests that ribosomal protection against nucleolytic attack is not a major factor in determining the stability of an mRNA in yeast. The relative lengths of the poly(A) tails of 9 yeast mRNAs were analysed using thermal elution from poly(U)-Sepharose. No dramatic differences in poly(A) tail length were observed amongst the mRNAs which could account for their wide ranging half-lives. Minor differences were consistent with shortening of the poly(A) tail as an mRNA ages.     

An essential cytoplasmic function for the nuclear poly(A) binding protein, PABP2, in poly(A) tail length control and early development in Drosophila

Translational control of maternal mRNA through regulation of poly(A) tail length is crucial during early development. The nuclear poly(A) binding protein, PABP2, was identified biochemically from its role in nuclear polyadenylation. Here, we analyze the in vivo function of PABP2 in Drosophila. PABP2 is required in vivo for polyadenylation, and Pabp2 function, including poly(A) polymerase stimulation, is essential for viability. We also demonstrate an unanticipated cytoplasmic function for PABP2 during early development. In contrast to its role in nuclear polyadenylation, cytoplasmic PABP2 acts to shorten the poly(A) tails of specific mRNAs. PABP2, together with the deadenylase CCR4, regulates the poly(A) tails of oskar and cyclin B mRNAs, both of which are also controlled by cytoplasmic polyadenylation. Both Cyclin B protein levels and embryonic development depend upon this regulation. These results identify a regulator of maternal mRNA poly(A) tail length and highlight the importance of this mode of translational control.     

Dual requirement for yeast hnRNP Nab2p in mRNA poly(A) tail length control and nuclear export

Recent studies of mRNA export factors have provided additional evidence for a mechanistic link between mRNA 3'-end formation and nuclear export. Here, we identify Nab2p as a nuclear poly(A)-binding protein required for both poly(A) tail length control and nuclear export of mRNA. Loss of NAB2 expression leads to hyperadenylation and nuclear accumulation of poly(A)(+) RNA but, in contrast to mRNA export mutants, these defects can be uncoupled in a nab2 mutant strain. Previous studies have implicated the cytoplasmic poly(A) tail-binding protein Pab1p in poly(A) tail length control during polyadenylation. Although cells are viable in the absence of NAB2 expression when PAB1 is overexpressed, Pab1p fails to resolve the nab2Delta hyperadenylation defect even when Pab1p is tagged with a nuclear localization sequence and targeted to the nucleus. These results indicate that Nab2p is essential for poly(A) tail length control in vivo, and we demonstrate that Nab2p activates polyadenylation, while inhibiting hyperadenylation, in the absence of Pab1p in vitro. We propose that Nab2p provides an important link between the termination of mRNA polyadenylation and nuclear export.     

U2AF modulates poly(A) length control by the poly(A)-limiting element

The poly(A)-limiting element (PLE) restricts the length of the poly(A) tail to <20 nt when present in the terminal exon of a pre-mRNA. We previously identified a 65 kDa protein that could be cross-linked to a functional PLE, but not to an inactive mutant element. This binding was competed by poly(U) and poly(C), but not poly(A) or poly(G). Selectivity for the pyrimidine-rich portion of the PLE was demonstrated by RNase footprinting of the binding activity in total nuclear extract. A 65 kDa protein that selectively cross-linked to the functional PLE was purified by conventional chromatography and identified as the large subunit of U2 snRNP auxiliary factor (U2AF). Overexpression of U2AF65 in cells transfected with a PLE-containing reporter construct resulted in the appearance of a population of mRNAs with heterogeneous poly(A) tails. However, this effect was lost following deletion of the C-terminal RNA recognition motifs (RRMs). A C-->G mutation following the AG dinucleotide in the PLE resulted in mRNA with poly(A) ranging from 25-50 nt. This reverted to a discrete, <20 nt poly(A) tail in cells expressing U2AF65. Our results suggest that U2AF modulates the function of the PLE, perhaps by facilitating the binding of another protein to the element.     

Characterization of deadenylation in trypanosome extracts and its inhibition by poly(A)-binding protein Pab1p

The stability of mRNAs is an important point in the regulation of gene expression in eukaryotes. The mRNA turnover pathways have been identified in yeast and mammals. However, mRNA turnover pathways in trypanosomes have not been widely studied. Deadenylation is the first step in the major mRNA turnover pathways of yeast and mammals. To better understand mRNA degradation processes in these organisms, we have developed an in vitro mRNA turnover system that is functional for deadenylation. In this system, addition of poly(A) homopolymer activates the deadenylation of poly(A) tails. The trypanosomal deadenylase activity is a 3'-->5' exonuclease specific for adenylate residues, generates 5'-AMP as a product, is magnesium dependent, and is inhibited by neomycin B sulfate. These characteristics suggest similarity with other eukaryotic deadenylases. Furthermore, this activity is cap independent, indicating a potential difference between the trypanosomal activity and PARN, but suggesting similarity to Ccr4p/Pop2p activities. Extracts immunodepleted of Pab1p required the addition of poly(A) competition to activate deadenylation. Trypanosomal Pab1p functions as an inhibitor of the activity under in vitro conditions. Pab1p appears to be one of several mRNA stability proteins in trypanosomal extracts.     

The nuclear poly(A) binding protein, PABP2, forms an oligomeric particle covering the length of the poly(A) tail

The mammalian nuclear poly(A) binding protein, PABP2, controls the length of the newly synthesized poly(A) tail on messenger RNAs. To gain a better understanding of the mechanism of length control, we have investigated the structure of the PABP2.poly(A) complex. Electron microscopy and scanning force microscopy studies reveal that PABP2, when bound to poly(A), forms both linear filaments and discrete-sized, compact, oligomeric particles. The maximum diameter of the filament is 7 nm; the maximum diameter of the particle is 21(+/-2) nm. Maximum particle size is realized when the PABP2. poly(A) complex is formed with poly(A) molecules 200-300 nt long, which corresponds to the average length of the newly synthesized poly(A) tail in vitro and in vivo. The equilibrium between filaments and particles is highly sensitive to ionic strength; filaments are favored at low ionic strength, while particles predominate at moderate to high ionic strength. Nitrocellulose filter binding and gel mobility shift assays indicate that the PABP2.poly(A) particle formed on A(300) is not significantly more stable than complexes formed with smaller species of poly(A). These results are discussed in the context of the proposed functions for PABP2.     

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.