The structure of the 5 S ribosomal RNA of a member of the phylum of green non-sulfur bacteria and relatives

The 5 S rRNA sequence was determined for the bacterium Herpetosiphon strain Senghas Wie 2. It is the first 5 S RNA sequence reported for a member of the eubacterial phylum defined by green non-sulfur bacteria. The sequence fits into a consensus secondary structure model for eubacterial 5 S RNA. At four positions, the sequence shows substitutions with respect to strongly conserved nucleotides found in other hitherto examined eubacterial 5 S RNAs.     

Extended secondary structure in 5S rRNAs from a sulphur metabolizing archaebacterium, Thermococcus celer

While this sequence shares a significant homology with the 5S RNAs of other archaebacteria and is consistent with current models for the secondary structure of 5S RNAs, it contains three unusual features. The G + C content (72-74%) is significantly higher than other 5S RNAs; the secondary structure is distinguished by unusually stable and extended helical structures and, most important, there is evidence for sequence heterogeneity in the form of complementary base substitutions and precursor processing. This supports recent evidence (Newmann, H., Gierl, A., Tu, J., Leibrock, J., Staiger, D. and Zillig, W. (1983) Mol. Gen. Genet. 192, 66-72) that, like many of the higher eukaryotes, this group of sulphur-metabolizing bacteria may contain multiple 5S RNA genes.     

Sequences of the 5S rRNAs of the thermo-acidophilic archaebacterium Sulfolobus solfataricus (Caldariella acidophila) and the thermophilic eubacteria Bacillus acidocaldarius and Thermus aquaticus.

We have determined the nucleotide sequences of the 5 S rRNAs of three thermophilic bacteria: the archaebacterium Sulfolobus solfataricus, also named Caldariella acidophila, and the eubacteria Bacillus acidocaldarius and Thermus aquaticus. A 5 S RNA sequence for the latter species had already been published, but it looked suspect on the basis of its alignment with other 5 S RNA sequences and its base-pairing pattern. The corrected sequence aligns much better and fits in the universal five helix secondary structure model, as do the sequences for the two other examined species. The sequence found for Sulfolobus solfataricus is identical to that determined by others for Sulfolobus acidocaldarius. The secondary structure of its 5 S RNA shows a number of exceptional features which distinguish it not only from eubacterial and eukaryotic 5 S RNAs, but also from the limited number of archaebacterial 5 S RNA structures hitherto published. The free energy change of secondary structure formation is large in the three examined 5 S RNAs.     

Structure of 5S rRNA in actinomycetes and relatives and evolution of eubacteria

Summary The primary structure of 5S ribosomal RNA has been determined in five species belonging to the genusMycobacterium and inMicrococcus luteus. The sequences of 5S RNAs from Actinomycetes and relatives point to the existence in this taxon of a bulge on the helix that joins the termini of the molecule. An attempt was made to reconstruct bacterial evolution from a sequence dissimilarity matrix based on 142 eubacterial 5S RNA sequences and corrected for multiple mutation. The algorithm is based on weighted pairwise clustering, and incorporates a correction for divergent mutation rates, as derived by comparison of sequence dissimilarities with an external reference group of eukaryotic 5S RNAs. The resulting tree is compared with the eubacterial phylogeny built on 16S rRNA catalog comparison. The bacteria for which the 5S RNA sequence is known form a number of clusters also discernible in the 16S rRNA phylogeny. However, the branching pattern leading to these clusters shows some notable discrepancies with the aforementioned phylogeny.     

Nucleotide sequence, secondary structure and evolution of the 5S ribosomal RNA from five bacterial species

The nucleotide sequences of the 5S ribosomal RNAs of the bacteria Agrobacterium tumefaciens, Alcaligenes faecalis, Pseudomonas cepacia, Aquaspirillum serpens and Acinetobacter calcoaceticus have been determined. The sequences fit in a generally accepted model for 5S RNA secondary structure. However, a closer comparative examination of these and other bacterial 5S RNA primary structures reveals the potential of additional base pairing and of multiple equilibria between a set of slightly different alternative secondary structures in one area of the molecule. The phylogenetic position of the examined bacteria is derived from a 5S RNA sequence alignment by a clustering method and compared with the position derived on the basis of 16S ribosomal RNA oligonucleotide catalogs.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

Unusual 5 S ribosomal RNAs. An analysis of individual segments can reveal phylogenetic relatedness

Sequence comparisons of 5 S and other ribosomal RNAs by segments can be useful in understanding anomalous primary and secondary structures and in assessing phylogenetic relationships. In a segmented analysis, the 5'-half of the Chlamydomonas reinhardii chloroplast 5 S ribosomal RNA is found to have a very close sequence homology to the green plant chloroplast and cyanobacterial 5 S RNAs; however, the 3'-half has a highly unusual sequence. Further comparisons of homologies between regions of the 5 S RNAs from C. reinhardii and the green plant chloroplasts suggest that genetic rearrangements within the 5 S DNA may have produced the unusual sequence at the 3'-half. Segmented analyses of the C. reinhardii and green plant chloroplast 5 S RNAs suggest a close relationship which is not revealed by overall sequence comparisons.     

Microbial identification by immunohybridization assay of artificial RNA labels

Ribosomal RNA (rRNA) and engineered stable artificial RNAs (aRNAs) are frequently used to monitor bacteria in complex ecosystems. In this work, we describe a solid-phase immunocapture hybridization assay that can be used with low molecular weight RNA targets. A biotinylated DNA probe is efficiently hybridized in solution with the target RNA, and the DNA-RNA hybrids are captured on streptavidin-coated plates and quantified using a DNA-RNA heteroduplex-specific antibody conjugated to alkaline phosphatase. The assay was shown to be specific for both 5S rRNA and low molecular weight (LMW) artificial RNAs and highly sensitive, allowing detection of as little as 5.2 ng (0.15 pmol) in the case of 5S rRNA. Target RNAs were readily detected even in the presence of excess nontarget RNA. Detection using DNA probes as small as 17 bases targeting a repetitive artificial RNA sequence in an engineered RNA was more efficient than the detection of a unique sequence.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

Summary The complete nucleotide sequences of 5S ribosomal RNAs fromRhodocyclus gelatinosa, Rhodobacter sphaeroides, andPseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains.Rhodobacter sphaeroides is specifically related toParacoccus denitrificans andRc. gelatinosa is related toPs. cepacia.These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found inP. denitrificans are present also in the 5S RNA ofRb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of our obtaining these new sequences is that we are able to clarify the phylogenetic origins of the plant mitochondrion. In particular, we find a close phylogenetic relationship between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely,Rb. sphaeroides, P. denitrificans, andRhodospirillum rubrum.     

Sequence and conformation of 5 S RNA from Chlorella cytoplasmic ribosomes: comparison with other 5 S RNA molecules

The sequence of Chlorella cytoplasmic 5 S RNA has been determined by fingerprinting techniques. Partial digests were fractionated by a two-dimensional acrylamide gel electrophoretic technique, which indicates whether specific fragments are paired in the molecule. In this way, the four main base-paired regions of the molecule were located. The sequence of Chlorella cytoplasmic 5 S RNA is related to, but different from, that of other eukaryotic 5 S RNAs: it shows approximately 60% homology with vertebrate 5 S RNA and 40% homology with yeast 5 S RNA. In some respects the conformation of the molecule in solution is quite different from that of other sequenced 5 S RNAs: in particular, the highly accessible region found around position 40 in all other 5 S RNAs (prokaryotic and eukaryotic) does not exist in this molecule.     

Ribosomal RNA genes of Trypanosoma brucei: mapping the regions specifying the six small ribosomal RNAs

There are six small ribosomal RNAs in trypanosome ribosomes. sRNA3 and sRNA5 of Trypanosoma brucei brucei have been partially sequenced. Sequence homologies indicate that sRNA3 is 5.8S RNA and sRNA5 is 5S RNA of T. b. brucei. The regions specifying these two, and the remaining four small RNAs, have been identified within clones of rRNA genes and in the genome. Five of the small RNAs, 1, 2, 3, 4 and 6, hybridise exclusively within the major rRNA gene repeat. A map of the regions specifying these small RNAs is presented. sRNA3 (5.8S RNA) hybridises to a region corresponding to the transcribed spacer of other eukaryotes. sRNA1 hybridises to a region between sequences specifying the two large subunit RNA molecules of 2.3 kb and 1.8 kb. Sequences specifying sRNAs 2 and 4 are present near the sequence specifying sRNA1, while sRNA6 appears to be specified 3' to the sequence specifying the 1.8-kb RNA sequence. In addition regions of secondary hybridisation for small RNAs 2, 3, 4 and 6 have also been identified. Though sRNA5 (5S RNA) hybridises within the major rRNA repeat, a separate 5S RNA gene repeat with unit size of 760 bp is also present. It is 10 to 20 times more abundant than the major rRNA gene repeat.     

Small RNA sequences are readily stabilized by inclusion in a carrier rRNA

This laboratory previously showed that an RNA derived from 5S ribosomal RNA could be used as a carrier to harbor a nucleic acid "tag" for monitoring genetically engineered or naturally occurring bacteria. The prototype system expressed a specific tagged RNA that was stable and accumulated to high levels. For such a system to be useful there should, however, be little limitation on the sequence composition and length of the insert. To test these limitations, a collection of insertion sequences were created and introduced into the artificial 5S rRNA cassette. This library consisted of random 13- and 50-base oligonucleotides that were inserted into the carrier RNA. We report here that essentially all of the insert-containing RNAs are stable and accumulate to detectable levels. Tagged RNAs were produced by both plasmid-borne and chromosomally integrated expression systems in E. coli and several Pseudomonas strains without obvious effect on the host cell. It is anticipated that in addition to its intended use in environmental monitoring, this system can be used for in vivo selection of useful artificial RNAs. Because the carrier lends stability to the RNAs, the system may also be useful in RNA production.     

Phylogeny of the 5S ribosomal RNA from Synechococcus lividus II: the cyanobacterial/chloroplast 5S RNAs form a common structural class

The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacterium Synechococcus lividus II has been determined. The sequence is (sequence in text) This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA of S. lividus II has 27 base differences compared with the 5S RNA of the related strain S. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs from S. lividus II, S. lividus III, and spinach chloroplasts are identical, but differ considerably from that of Escherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA of E. coli and these cyanobacterial and chloroplast 5S RNAs.     

Recent developments in methods for RNA sequencing using in vitro 32P-labeling

A variety of approaches that utilize in vitro 32P-labeling of RNA and of oligonucleotides in the sequence analysis of RNAs are described. These include 1) methods for 5'- and 3'- end labeling of RNAs; 2) end labeling and sequencing of oligonucleotides present in complete T1 RNase or pancreatic RNase digests of RNA; 3) use of random endonucleases, such as nuclease P1, for terminal sequence analysis of end labeled RNAs; and 4) use of base specific enzymes or chemical reagents in the sequence analysis of end-labeled RNAs. Also described is an approach to RNA sequencing, applied so far to tRNAs, which is based on partial and random alkaline cleavage of an RNA to generate a series of overlapping oligonucleotide fragments, all containing the original 3'-end of the RNA. Analysis of the 5'- end group of each of these oligonucleotides (following 5'-end labeling with 32P) provides the sequence of most of the tRNA. The above methods have been used to derive the sequences of several tRNAs, the ribosomal 5S and 5 x 8S RNAs, a viroid RNA, and large segments of both prokaryotic and eukaryotic ribosomal and messenger RNAs.     

Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

A common conformational feature in several prokaryotic and eukaryotic 5 S RNAs: a highly exposed, single-stranded loop around position 40

Psendomonas fluorescens, yeast and HeLa cells ³²P-labelled 5 S RNAs were submitted to partial hydrolysis with T₁, T₂ or pancreatic ribonucleases; the fragments were separated by two-dimensional acrylamide gel electrophoresis. First splits (obtained when only one cleavage takes place in the molecule) were found to occur essentially around position 40 in the sequence, as already demonstrated for Escherichia coli 5 S RNA. The existence in prokaryotic and eukaryotic 5 S RNAs of this very accessible region is thus proved. Eukaryotic 5 S RNAs also display a very accessible region around position 90 of the sequence.     

Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli.

4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli.     

Sequence analysis and in vitro maturation of five precursor 5S RNAs from Bacillus Q.

Bacillus Q, which is closely related to B. subtilis, contains at least six different precursors of 5S rRNA. The complete nucleotide sequences of four of these precursors, as well as the major part of the sequence of a fifth one, have been determined. They all contain the same 5'-terminal non-conserved segment which is to a large degree homologous with the corresponding segment of the B. subtilis p5S RNAs (Sogin, M.L., Pace, N.R., Rosenberg, M., Weissman, S.M. (1976) J. Biol. Chem. 251, 3480-3488). On the other hand the 3'-terminal non-conserved sequences of the various Bacillus Q precursors show considerable differences both in length and in nucleotide sequence, while there is also little or no homology with the 3'-terminal non-conserved sequence of the B. subtilis precursors. Bacillus Q p5S RNAs do not possess tetranucleotide repeats around the sites which are cleaved during maturation, as does B. subtilis p5S RNA. Like in B. subtilis, however, the cleavage sites are contained within a double-helical region of the precursor molecules. Crude RNAse M5 isolated from various Bacillus strains can maturate the Bacillus Q p5S RNAs with high efficiency. Despite considerable differences in primary structure between the precursors from the various strains, each RNAs M5 preparation can maturate all these precursors with about the same efficiency.