Binding of NDGA and morin with phospholipase A2: experimental and computational evidences

The effects of morin and nordihydroguaiaretic acid (NDGA), two plant secondary metabolites, on porcine pancreatic phospholipase A₂ (PLA₂) were investigated by isothermal titration calorimetry (ITC) and in silico docking analyses. The binding energies obtained for NDGA and morin from the ITC studies are ? 6.36 and ? 5.91 kcal mol^? 1, respectively. Similarly, the glide scores obtained for NDGA and morin towards PLA₂ were ? 7.32 and ? 7.23 kcal mol^? 1, respectively. Further the docked complexes were subjected to MD simulation in the presence of explicit water molecules to check the binding stability of the ligands in the active site of PLA₂. The bound ligands make hydrogen bonds with the active site residues of the enzyme and coordinate bonds with catalytically important Ca²⁺ ion. The binding of ligands at the active site of PLA₂ may also contribute to the reported anti-inflammatory properties of NDGA and morin.     

Non-intercalative,Deoxyribose Binding of Boric Acid to Calf Thymus DNA

The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV–Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid–DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K _a) of 9.54?×?10⁴ M^?1. FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.     

Multi-spectroscopic and molecular modelling approach to investigate the interaction of riboflavin with human serum albumin

Riboflavin (RF) plays an important role in various metabolic redox reactions in the form of flavin adenine dinucleotide and flavin mononucleotide. Human serum albumin (HSA) is an important protein involved in the transportation of drugs, hormones, fatty acid and other molecules which determine the biodistribution and physiological fate of these molecules. In this study, we have investigated the interaction of riboflavin RF with HSA under simulative physiological conditions using various biophysical, calorimetric and molecular docking techniques. Results demonstrate the formation of riboflavin–HSA complex with binding constant in the order of 10⁴ M^?1. Fluorescence spectroscopy confirms intermediate strength having a static mode of quenching with stoichiometry of 1:1. Experimental results suggest that the binding site of riboflavin mainly resides in sub-domain IIA of HSA and that ligand interaction increases the α-helical content of HSA. These parameters were further verified by isothermal titration calorimetry ITC which confirms the thermodynamic parameters obtained by fluorescence spectroscopy. Molecular docking was employed to suggest a binding model. Based on thermodynamic, spectroscopic and computational observations it can be concluded that HSA-riboflavin complex is mainly stabilized by various non-covalent forces with binding energy of ?7.2 kcal mol^?1.     

Structural and functional studies on a variant of cystatin purified from brain of Capra hircus

Cystatins, known for their ubiquitous presence in mammalian system are thiol protease inhibitors serving important physiological functions. Here, we present a variant of cystatin isolated from brain of Capra hircus (goat) which is glycosylated but lacks disulphide bonds. Caprine brain cystatin (CBC) was isolated using alkaline treatment, ammonium sulphate fractionation (40–60%) and gel filtration chromatography on Sephacryl S-100HR column with an overall yield of 26.29% and 322-fold purification. The inhibitor gave a molecular mass of ~44 kDa as determined by SDS-PAGE and gel filtration behaviour. The Stokes radius and diffusion coefficient of CBC were 27.14 Å and 8.18 × 10^?7 cm² s^?1, respectively. Kinetic data revealed that CBC inhibited thiol proteases reversibly and competitively, with the highest inhibition towards papain (K_i = 4.10 nM) followed by ficin and bromelain. CBC possessed 34.7% α-helical content as observed by CD spectroscopy. UV, fluorescence, CD and FTIR spectroscopy revealed significant conformational change upon CBC-papain complex formation. Isothermal titration calorimetry (ITC) was used to measure the thermodynamic parameters – ΔH, ΔS, ΔG along with N (binding stoichiometry) for CBC-papain complex formation. Binding stoichiometry (N = .97 ± .07 sites) for the CBC-papain complex indicates that cystatin is surrounded by nearly one papain molecule. Negative ΔH (?5.78 kcal mol^?1) and positive ΔS (11.01 cal mol^?1 deg^?1) values suggest that the interaction between CBC and papain is enthalpically as well as entropically favoured process. The overall negative ΔG (?9.19 kcal mol^?1) value implies a spontaneous CBC-papain interaction.     

Cytotoxicity and comparative binding mechanism of piperine with human serum albumin and α-1-acid glycoprotein

Human serum albumin (HSA) and α-1-acid glycoprotein (AGP) (acute phase protein) are the plasma proteins in blood system which transports many drugs. To understand the pharmacological importance of piperine molecule, here, we studied the anti-inflammatory activity of piperine on mouse macrophages (RAW 264.7) cell lines, which reveals that piperine caused an increase in inhibition growth of inflammated macrophages. Further, the fluorescence maximum quenching of proteins were observed upon binding of piperine to HSA and AGP through a static quenching mechanism. The binding constants obtained from fluorescence emission were found to be K_piperine?=?5.7 ± .2 × 10⁵ M^?1 and K_piperine = 9.3± .25 × 10⁴ M^?1 which correspond to the free energy of ?7.8 and ?6.71 kcal M^?1at 25 °C for HSA and AGP, respectively. Further, circular dichrosim studies revealed that there is a marginal change in the secondary structural content of HSA due to partial destabilization of HSA–piperine complexes. Consequently, inference drawn from the site-specific markers (phenylbutazone, site I marker) studies to identify the binding site of HSA noticed that piperine binds at site I (IIA), which was further authenticated by molecular docking and molecular dynamic (MD) studies. The binding constants and free energy corresponding to experimental and computational analysis suggest that there are hydrophobic and hydrophilic interactions when piperine binds to HSA. Additionally, the MD studies have showed that HSA–piperine complex reaches equilibration state at around 3 ns, which prove that the HSA–piperine complex is stable in nature.     

Understanding nucleosomal histone and DNA interactions: a biophysical study

Histones are associated with DNA to form nucleosome essential for chromatin structure and major nuclear processes like gene regulation and expression. Histones consist of H1, H2A, H2B and H3, H4 type proteins. In the present study, combined histones from calf thymus were complexed with ct DNA and their binding affinities were measured fluorimetrically. All the five histones were resolved on SDS page and their binding with DNA was visualized. The values of biding affinities varied with pH and salt concentration. Highest affinity (4.0?×?10⁵ M^?1) was recorded at pH 6.5 in 50 mM phosphate buffer and 1.5?×?10⁴ M^?1 in 2 M NaCl at pH 7.0. The CD spectra support the highest binding affinity with maximum conformational changes at pH 7.0. The time-resolved fluorescence data recorded two life times for histone tyrosine residues at 300 nm emission in phosphate buffer pH 6.5. These life times did not show much change upon binding with DNA in buffer as well as in 2 M NaCl. The isothermal calorimetric studies yielded thermodynamic parameters ΔG, ΔH and ΔS as ?1.6?×?10⁵ cal/mol, ?1.13?×?10³ cal/mol and ?3.80 cal/mol/deg, respectively, evidencing a spontaneous exothermic reaction. The dominant binding forces in building the nucleosome are electrostatic interactions.     

Unraveling the stability of plasma proteins upon interaction of synthesized uridine products: biophysical and molecular dynamics approach

Abstract

Most of the drugs binding to human serum albumin (HSA) are transported to various parts of the body. Here, we have studied the molecular interaction between HSA and synthesized uridine derivatives, 1-[(3R, 4S, 5?R)-2-methyl-3, 4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidine-2,4-dion.)(C-MU); [(2R,3R,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-3,4-dihydroxy-4-methyl-tetrahydrofuran-2-yl] methyl methyl phosphochloridate (CM-MU) and [(2R,3S,4R,5R)-5-(2,4-dioxopyrimidin-1-yl)-2-methyl-3,4-dihydroxyoxolan-2-yl] methyl dihydrogen phosphate (P-MU). Cytotoxic studies of these synthesized compounds with mouse macrophages (RAW 246.7) and HeLa cells (human cervical cancer cells) and binding mechanism of these uridine derivatives with HSA were performed. Subsequently, fluorescence quenching was observed upon titration of uridine derivatives with HSA via static mode of quenching, and the binding constants (K_2-C-MU = 4?±?0.03?×?10⁴M^?1, K_5-CM-MU = 1.95?±?0.03?×?10⁴ M^?1 and K_5-P-MU =1.56?±?0.03?×?10⁴ M^?1) were found to be in sync with the computational results. Further, molecular displacement and molecular docking data revealed that all the derivatives are binding in the subdomain IIA and IIB regions of HSA. The protein secondary structure of complexes was determined by circular dichroism, indicating partial unfolding of the protein upon addition of the uridine derivatives. Furthermore, atomic force microscopy data reveal the change in topology upon binding of 2-C-MU, 5-CM-MU and 5-P-MU with HSA, indicating change in the microenvironment around tryptophan region. Additionally, cytotoxicity studies on HeLa and Raw Cell lines suggested that these molecules have significant anti-proliferative and anti-inflammatory properties. Hence, the study may be of help for development of new drugs based on uridine derivatives which may be helpful for combating various potential diseases.

Communicated by Ramaswamy H. Sarma     

Titanium dioxide nanoparticles preferentially bind in subdomains IB,IIA of HSA and minor groove of DNA

Titanium dioxide nanoparticles (TiO₂-NPs) interaction with human serum albumin (HSA) and DNA was studied by UV–visible spectroscopy, spectrofluorescence, circular dichroism (CD), and transmission electron microscopy (TEM) to analyze the binding parameters and protein corona formation. TEM revealed protein corona formation on TiO₂-NPs surface due to adsorption of HSA. Intrinsic fluorescence quenching data suggested significant binding of TiO₂-NPs (avg. size 14.0 nm) with HSA. The Stern–Volmer constant (K_sv) was determined to be 7.6 × 10² M^?1 (r² = 0.98), whereas the binding constant (K_a) and number of binding sites (n) were assessed to be 5.82 × 10² M^?1 and 0.97, respectively. Synchronous fluorescence revealed an apparent decrease in fluorescence intensity with a red shift of 2 nm at Δλ = 15 nm and Δλ = 60 nm. UV–visible analysis also provided the binding constant values for TiO₂-NPs–HSA and TiO₂-NPs-DNA complexes as 2.8 × 10² M^?1 and 5.4 × 10³ M^?1. The CD data demonstrated loss in α-helicity of HSA and transformation into β-sheet, suggesting structural alterations by TiO₂-NPs. The docking analysis of TiO₂-NPs with HSA revealed its preferential binding with aromatic and non-aromatic amino acids in subdomain IIA and IB hydrophobic cavity of HSA. Also, the TiO₂-NPs docking revealed the selective binding with A-T bases in minor groove of DNA.     

NOVEL CLASS OF DNA BINDING MOTIFS BASED ON BISTETRAHYDROFURAN AND BISFURAN SKELETON WITH LONG ALKYL CHAINS

Small molecules with DNA-binding affinity within the minor groove have become of great interest. In this paper, new DNA binding molecules; diamino-bistetrahydrofuran (bisTHF) and diamino-bisfuran are reported. The bisTHF ligand with RR configuration at the amino groups and C8 alkyl chains (RR8) stabilized GC-rich duplex. In contrast, bisfuran compounds stabilized AT-rich duplex. The binding affinity of RR8 with 12 mer duplex DNA was determined by isothermal titration calorimetry to be 3.3 × 10⁸ M^?1.     

Evolution of 1, 3, 5-trisubstituted bipyrazole scaffold based platinum(II) complexes as a biological active agent

Abstract

Square planar mononuclear platinum(II) complexes having general formula [Pt(Lⁿ)Cl₂], (where, Lⁿ?=?L^1–4) were synthesized with neutral bidentate heterocyclic 1,3,5-trisubstituted bipyrazole based ligands. The synthesized compounds were characterized by physicochemical method such as TGA, molar conductance, micro-elemental analysis and magnetic moment, and spectroscopic method such as, FT-IR, UV–vis, ¹H NMR, ¹³C NMR and mass spectrometry. Biological applications of the compounds were carried out using in vitro brine shrimp lethality bioassay, in vitro antimicrobial study against five different pathogens, and cellular level cytotoxicity against Schizosaccharomyces pombe (S. Pombe) cells. Pt(II) complexes were tested for DNA interaction activities using electronic absorption titration, viscosity measurements study, fluorescence quenching technique and molecular docking assay. Binding constants (K_b) of ligands and complexes were observed in the range of 0.23–1.07?×?10⁵?M^?1 and 0.51–3.13?×?10⁵?M^?1, respectively. Pt(II) complexes (I–IV) display an excellent binding tendency to biomolecule (DNA) and possess comparatively high binding constant (K_b) values than the ligands. The DNA binding study indicate partial intercalative mode of binding in complex-DNA. The gel electrophoresis activity was carried out to examine DNA nuclease property of pUC19 plasmid DNA.     

Biological evaluation of a cytotoxic 2-substituted benzimidazole copper(II) complex: DNA damage,antiproliferation and apoptotic induction activity in human cervical cancer cells

Exploring novel chemotherapeutic agents is a great challenge in cancer medicine. To that end, 2-substituted benzimidazole copper(II) complex, [Cu(BMA)Cl₂]·(CH₃OH) (1) [BMA = N,N′-bis(benzimidazol-2-yl-methyl)amine], was synthesized and its cytotoxicity was characterized. The interaction between complex 1 and calf thymus DNA was detected by spectroscopy methods. The binding constant (K _b = 1.24 × 10⁴ M^?1) and the apparent binding constant (K _app = 6.67 × 10⁶ M^?1) of 1 indicated its moderate DNA affinity. Complex 1 induced single strand breaks of pUC19 plasmid DNA in the presence of H₂O₂ through an oxidative pathway. Cytotoxicity studies proved that complex 1 could inhibit the proliferation of human cervical carcinoma cell line HeLa in both time- and dose-dependent manners. The results of nuclei staining by Hoechst 33342 and alkaline single-cell gel electrophoresis proved that complex 1 caused cellular DNA damage in HeLa cells. Furthermore, treatment of HeLa cells with 1 resulted in S-phase arrest, loss of mitochondrial potential, and up-regulation of caspase-3 and -9 in HeLa cells, suggesting that complex 1 was capable of inducing apoptosis in cancer cells through the intrinsic mitochondrial pathway.     

Equilibrium studies on neutral red-DNA binding.

Spectrophotometric binding studies were undertaken on the interaction of neutral red with native and heat-denatured, sonicated, calf thymus DNA in a 0.2M ionic strength buffer containing Tris–sodium acetate–potassium chloride at 25°C. The pK_A of neutral red was found to be 6.81. At pH 5 the binding of protonated neutral red was complicated even at low concentration ratios of dye to DNA. In the pH range 7.5–8.5 the tight binding process could be studied and it was found that both protonated and free base species of neutral red significantly bind with DNA having association constants (in terms of polynucleotide phosphate) of 5.99 × 10³ M^?1 and 0.136 × 10³ M^?1, respectively, for native DNA and 7.48 × 10³ M^?1 and 0.938 × 10³ M^?1, respectively, for denatured DNA. The pK_A value of the neutral red–DNA complexes were 8.46 for native DNA and 7.72 for denatured DNA. These results are discussed in terms of possible binding mechanisms.     

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 10⁵ M^?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 10⁵ M^?1, and that of BER was (0.98 ± 0.03) × 10⁵ M^?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.     

Binding of anti-cardiovascular drug to serum albumin: an insight in the light of spectroscopic and computational approaches

Isoprenaline hydrochloride is a potential cardiovascular drug helps in the smooth functioning of the heart muscles. So, we have performed the binding study of ISO with BSA. This study was investigated by UV absorption, fluorescence, synchronous fluorescence, circular dichroism, etc. The analysis of intrinsic fluorescence data showed the low binding affinity of ISO. The binding constant K_b was 2.8 × 103 M-1 and binding stoichiometry (n) was approximately one and the Gibb’s free energy change at 310 K was determined to be -8.69 kcal mol^?1. Negative Gibb’s free energy change shows the spontaneity of the BSA and ISO interaction. We have found ISO-induced alternation in the UV absorption, synchronous fluorescence and CD spectra in the absence and presence of the quencher indicates the complex formation. In synchronous fluorescence, red shift was obtained because of the complex formation of BSA and ISO. The distance (r) between the BSA (donor) and ISO (acceptor) was 2.89 nm, determined by FRET. DLS measurements interpreted complex formation due to the reduction in hydrodynamic radii of the protein in the presence of the drug. The binding site of ISO was found to be nearer to Trp 134 with the help of molecular docking and the ΔG° was found to be –10.2 kcal mol^?1. The esterase activity result suggests that ISO acts as competitive inhibitor. Thus, this study would help to determine the binding capacity of the drug to the protein which may indicate the efficiency of diffusion of ISO into the blood for the treatment of heart diseases.     

Design,synthesis, MTT assay,DNA interaction studies of platinum(II) complexes

The square planar Pt(II) complexes of the type [Pt(Lⁿ)(Cl₂)] (where Lⁿ = L^1?3 = thiophene-2-carboxamide derivatives and L^4?6 = thiophene-2-carbothioamide derivatives) have been synthesized and characterized by physicochemical and various spectroscopic studies. MIC method was employed to inference the antibacterial potency of complexes in reference to free ligands and metal salt. Characteristic binding constant (K_b) and binding mode of complexes with calf thymus DNA (CT-DNA) were determined using absorption titration (0.76–1.61 × 10⁵ M^?1), hydrodynamic chain length assay and fluorescence quenching analysis, deducing the partial intercalative mode of binding. Molecular docking calculation displayed free energy of binding in the range of –260.06 to –219.63 kJmol^?1. The nuclease profile of complexes towards pUC19 DNA shows that the complexes cleave DNA more efficiently compared to their respective metal salt. Cytotoxicity profile of the complexes on the brine shrimp shows that all the complex exhibit noteworthy cytotoxic activity with LC₅₀ values ranging from 7.87 to 15.94 μg/mL. The complexes have been evaluated for cell proliferation potential in human colon carcinoma cells (HCT 116) and IC₅₀ value of complexes by MTT assay (IC₅₀ = 125–1000 μg/mL).     

Recognition of a Flipped Base in a Hairpinloop DNA by a Small Peptide

Two tiny hairpin DNAs, CORE (dAGGCTTCGGCCT) and AP2 (dAGGCTXCGGCCT; X: abasic nucleotide), fold into almost the same tetraloop hairpin structure with one exception, that is, the sixth thymine (T6) of CORE is exposed to the solvent water (Kawakami, J. et al., Chem. Lett. 2001, 258–259). In the present study, we selected small peptides that bind to CORE or AP2 from a combinatorial pentapeptide library with 2.5 × 10⁶ variants. On the basis of the structural information, the selected peptide sequences should indicate the essential qualifications for recognition of the hairpin loop DNA with and without a flipped base. In the selected DNA binding peptides, aromatic amino acids such as histidine for CORE and glutamine/aspartic acid for AP2 were found to be abundant amino acids. This amino acid preference suggests that CORE-binding peptides use π–π stacking to recognize the target while hydrogen bonding is dominant for AP2-binding peptides. To investigate the binding properties of the selected peptide to the target, surface plasmon resonance was used. The binding constant of the interaction between CORE and a CORE-binding peptide (HWHHE) was about 1.1 × 10⁶ M^?1 at 25°C and the resulting binding free energy change at 25°C (ΔG°₂₅) was ?8.2 kcal mol^?1. The binding of the peptide to AP2 was also analyzed and the resulting binding constant and ΔG°₂₅ were about 4.2 × 10⁴ M^?1 and ?6.3 kcal mol^?1, respectively. The difference in the binding free energy changes (ΔΔG°₂₅) of 1.9 kcal mol^?1 was comparable to the values reported in other systems and was considered a consequence of the loss of π–π stacking. Moreover, the stabilization effect by stacking affected the dissociation step as well as the association step. Our results suggest that the existence of an aromatic ring (T6 base) produces new dominant interactions between peptides and nucleic acids, although hydrogen bonding is the preferable mode of interaction in the absence of the flipping base. These findings regarding CORE and AP2 recognition are expected to give useful information in the design of novel artificial DNA binding peptides.