Primary structures of the 5S ribosomal RNAs of 11 arthropods and applicability of 5S RNA to the study of metazoan evolution

Summary 5S Ribosomal RNA sequences have proven to be useful tools in the study of evolutionary relationships among species. However, in reviewing previously published trees constructed from alignments of metazoan 5S RNAs, we noticed several discrepancies with classical evolutionary views. One such discrepancy concerned the phylum Arthropoda, where a crustacean,Artemia salina, seemed to be evolutionarily very remote from four insects. The cause of this phenomenon was studied by determining the 5S RNA sequences of additional arthropods, viz.Limulus polyphemus, Eurypelma californica, Lasiodora erythrocythara, Areneus diadematus, Daphnia magna, Ligia oceanica, Homarus gammarus, Cancer pagurus, Spirobolus sp.,Locusta migratoria, andTenebrio molitor. A tree was then constructed from a dissimilarity matrix by a clustering method known as weighted pair grouping. Application of a correction for unequal evolutionary rates improved the apparent evolutionary position of the arthropods and of some other metazoan species. However, neither the uncorrected nor the corrected tree permitted a completely acceptable reconstruction of metazoan evolution. We presume that this phenomenon is due to random deviations in the evolutionary rate of 5S RNA.Presented at the FEBS Symposium on Genome Organization and Evolution, held in Crete, Greece, September 1–5, 1986     

The 5S ribosomal RNA sequences of a red algal rhodoplast and a gymnosperm chloroplast. Implications for the evolution of plastids and cyanobacteria

Summary The 5S ribosomal RNA sequences have been determined for the rhodoplast of the red algaPorphyra umbilicalis and the chloroplast of the coniferJuniperus media. The 5S RNA sequence of theVicia faba chloroplast is corrected with respect to a previous report. A survey of the known sequences and secondary structures of 5S RNAs from plastids and cyanobacteria shows a close structural similarity between all 5S RNAs from land plant chloroplasts. The algal plastid 5S RNAs on the other hand show much more structural diversity and have certain structural features in common with bacterial 5S RNAs. A dendrogram constructed from the aligned sequences by a clustering algorithm points to a common ancestor for the present-living cyanobacteria and the land plant plastids. However, the algal plastids branch off at an early stage within the plastid-cyanobacteria cluster, before the divergence between cyanobacteria and land plant chloroplasts. This evolutionary picture points to the occurrence of multiple endosymbiotic events, with the ancestors of the present algal plastids already established as photosynthetic endosymbionts at a time when the ancestors of the present land plant chloroplasts were still free-living cells.     

乌鳢肝5S rRNA的核苷酸序列

应用Peattie,Maxum等化学裂解法,辅以酶解直读法等测定了乌醴(Ophiocephalus argus)肝5S rRNA的核苷酸序列;与已知的虹鳟鱼和纵带泥鳅5S rRNA序列比较,发现它们之间的核苷酸序列具有高度的保守性.利用其一级结构所给出的信息,初步提出二级结构模型.     

Nucleotide sequences ofCyanophora paradoxa cellular and cyanelle-associated 5S ribosomal RNAs: The cyanelle as a potential intermediate in plastid evolution

Summary The 5S ribosomal RNAs from the cell cytoplasm and cyanelle (photosynthetic organelle) ofCyanophora paradoxa have been isolated and sequenced. The cellular and cyanelle 5S rRNAs were 119 and 118 nucleotides in length, respectively. Both RNAs exhibited typical 5S secondary structure, but the primary sequence of the cellular species was clearly eukaryotic in nature, while that of the organellar species was prokaryotelike. The primary sequence of the cyanellar 5S rRNA was most homologous to cyanobacterial 5S sequences, yet possessed secondary-structural features characteristic of higher-plant chloroplast 5S rRNAs. Both sequence comparison and structural analysis indicated an evolutionary position for cyanelle 5S rRNA intermediate between blue-green alga and chloroplast 5S rRNAs.Contribution from the Department of Biochemistry, School of Agriculture and Life Sciences and School of Physical and Mathematical Sciences, North Carolina State University, Raleigh, North Carolina. This is paper no. 10259 of the Journal Series of the North Carolina Agricultural Research Service, Raleigh, North Carolina 27695-7601, USA     

Nucleotide sequence of cytoplasmic 5S ribosomal RNA fromEuglena gracilis

Summary The nucleotide sequence of cytoplasmic 5S ribosomal RNA fromEuglena gracilis has been determined to be: G- _A ^C -G-U-A-C-G-G-C-C-A-U-A-C-U-A-C-C-G-G-G-A-A-U-A-C-A-C-C-U-G-A-A-C-C-C-G--U-C-G-A-U-U-U-C-A-G-A-A-G-U-U-A-A-G-C-C-G-G-G-U-U-A-G-G-C-C-C-A-G-U-U-A-G-U-A-C-U-G-A-G-U-G-G-G-C-G-A-C-C-A-C-U-U-G-G-G-A-A-C-A-C-U-G-G-G-U-G-C-U-G-U-A-C-G-C-U-Up. This RNA is 119 nucleotides long and the sequence of a probable tRNA-binding site is GAUU (position 41–44 from the 5-terminus), which is the same as that of a trypanosoma species,Crithidia fasci-culata. TheEuglena 5S rRNA has a pseudouridine residue at position 38 and 3-terminus is phosphorylated. The 5S rRNA sequence ofEuglena resembles those of several other protozoa and higher animals rather than plants.On leave from Department of Zoology, Hiroshima University, Hiroshima, Japan     

Partial enzyme digestion studies onescherichia coli,pseudomonas, chlorella,drosophila, HeLa and yeast 5S RNAs support a general class of 5S RNA models

Summary Fox and Woese (1975a) have shown that a model of 5S RNA secondary structure similar to the one originally derived forChlorella 5S RNA can be generalized with relatively minor variations to all sequenced 5S RNA molecules, i.e. that corresponding base paired regions can be formed at approximately the same positions. We present experimental data in favour of this hypothesis and show that the points at which ribonucleases T1, T2 and pancreatic ribonuclease cleave six different 5S RNA molecules under mild conditions (high ionic strength, low temperature, low RNAase concentration) nearly always fall in the proposed single-stranded regions. We conclude that this model is a good approximation to the conformation of 5S RNA in solution.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Structure of 5S rRNA in actinomycetes and relatives and evolution of eubacteria

Summary The primary structure of 5S ribosomal RNA has been determined in five species belonging to the genusMycobacterium and inMicrococcus luteus. The sequences of 5S RNAs from Actinomycetes and relatives point to the existence in this taxon of a bulge on the helix that joins the termini of the molecule. An attempt was made to reconstruct bacterial evolution from a sequence dissimilarity matrix based on 142 eubacterial 5S RNA sequences and corrected for multiple mutation. The algorithm is based on weighted pairwise clustering, and incorporates a correction for divergent mutation rates, as derived by comparison of sequence dissimilarities with an external reference group of eukaryotic 5S RNAs. The resulting tree is compared with the eubacterial phylogeny built on 16S rRNA catalog comparison. The bacteria for which the 5S RNA sequence is known form a number of clusters also discernible in the 16S rRNA phylogeny. However, the branching pattern leading to these clusters shows some notable discrepancies with the aforementioned phylogeny.     

Interrelatedness of 5S RNA sequences investigated by correspondence analysis

Summary Correspondence analysis (a form of multivariate statistics) applied to 74 5S ribosomal RNA sequences indicates that the sequences are interrelated in a systematic, nonrandom fashion. Aligned sequences are represented as vectors in a 5N-dimensional space, where N is the number of base positions in the 5S RNA molecule. Mutually orthogonal directions (called factor axes) along which intersequence variance is greatest are defined in this hyperspace. Projection of the sequences onto planes defined by these factorial directions reveals clustering of species that is suggestive of phylogenetic relationships. For each factorial direction, correspondence analysis points to regions of importance, i.e., those base positions at which the systematic changes occur that define that particular direction. In effect, the technique provides a rapid determination of group-specific signatures. In several instances, similarities between sequences are indicated that have only recently been inferred from visual base-to-base comparisons. These results suggest that correspondence analysis may provide a valuable starting point from which to uncover the patterns of change underlying the evolution of a macromolecule, such as 5S RNA.     

Frequency of insertion-deletion,transversion, and transition in the evolution of 5S ribosomal RNA

Summary The problem of choosing an alignment of two or more nucleotide sequences is particularly difficult for nucleic acids, such as 5S ribosomal RNA, which do not code for protein and for which secondary structure is unknown. Given a set of costs for the various types of replacement mutations and for base insertion or deletion, we present a dynamic programming algorithm which finds the optimal (least costly) alignment for a set of N sequences simultaneously, where each sequence is associated with one of the N tips of a given evolutionary tree. Concurrently, protosequences are constructed corresponding to the ancestral nodes of the tree. A version of this algorithm, modified to be computationally feasible, is implemented to align the sequences of 5S RNA from nine organisms. Complete sets of alignments and proto-sequence reconstructions are done for a large number of different con-figurations of mutation costs. Examination of the family of curves of total replacements inferred versus the ratio of transitions/trans-versions inferred, each curve corresponding to a given number of in-sertions-deletions inferred, provides a method for estimating relative costs and relative frequencies for these different types of mutation.     

Identification of RNA molecules which contain 5 S ribosomal RNA and transfer RNA in an RNAase E-RNAase P- double mutant strain of Escherichia coli

In the analysis of DNAase II digestion of chromatin, as described in the preceding paper, interactions between adjacent nucleosomes play an important part. In order to understand the mechanism of DNAase II cleavage we next investigated the role of histone H1 in these interactions and characterized the nucleoprotein particles arising in the course of DNAase II action.H1-free chromatin prepared by three different procedures, using either 0.6 m-NaCl, transfer RNA or an ion-exchange resin, can be cleaved by DNAase II only at the internucleosomal cleavage site leading to 200-bp² digestion patterns regardless of the ionic conditions. When H1 was added back to the three chromatin preparations the 100-bp cleavage pattern could be restored only with material prepared by the resin method at low concentrations of salt. Addition of polylysine instead of H1 has the same effect, but only with material prepared by that method. A direct correlation between extended and condensed states of chromatin as monitored by electron microscopy and DNAase II cleavage in the 200 and 100-bp modes, respectively, could be established.The continuity of the nucleosome chains in DNAase II-digested chromatin is maintained in spite of intranucleosomal cleavage in the terminal section of the core DNA, even in the absence of H1. Addition of 3 m-urea, however, disrupts the nucleosome chains at the intranucleosomal cleavage sites and leads to the formation of novel nucleoprotein particles as seen in sucrose gradient centrifugations. Those sedimenting between mononucleosomes and dinucleosomes contain, almost exclusively, DNA of 300 bp (mouse) or 315 bp (chicken erythrocyte). They can be formed from particles sedimenting in the absence of urea in the dinucleosome region by either a dissociation process or a massive conformational change.On the basis of the results presented here and in the preceding paper a mechanism for DNAase II cleavage of chromatin in the 200-bp and 100-bp modes is proposed and discussed in the context of structural features of chromatin recognized by DNAase II.     

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

Summary The complete nucleotide sequences of 5S ribosomal RNAs fromRhodocyclus gelatinosa, Rhodobacter sphaeroides, andPseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains.Rhodobacter sphaeroides is specifically related toParacoccus denitrificans andRc. gelatinosa is related toPs. cepacia.These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found inP. denitrificans are present also in the 5S RNA ofRb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of our obtaining these new sequences is that we are able to clarify the phylogenetic origins of the plant mitochondrion. In particular, we find a close phylogenetic relationship between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely,Rb. sphaeroides, P. denitrificans, andRhodospirillum rubrum.     

Physical mapping of the 5S ribosomal RNA genes on rice chromosome 11

One 5S ribosomal RNA gene (5S rDNA) locus was localized on chromosome 11 of japonica rice by in situ hybridization. The biotinylated DNA probe used was prepared by direct cloning and direct labeling methods, and the locus was localized to the proximal region of the short arm of chromosome 11 (llpl.l) by imaging methods. The distance between the signal site and the centromere is 4.0 arbitrary units, where the total length of the short arm is 43.3 units. The 5S rDNA locus physically identified and mapped in rice was designated as 5SRrn. The position of the 5S rDNA locus reported here differs from that in indica rice; possible reasons for this difference are discussed. DNA sequences of 5S rDNA are also reported.     

5S and 5.8S ribosomal RNA evolution in the suborder tetrahymenina (Ciliophora: Hymenostomatida)

Summary The nucleotide sequences of the 5S and 5.8S rRNAs of eight strains of tetrahymenine ciliates have been determined. The sequences indicate a clear distinction betweenTetrahymena paravorax and its suggested conspecificT. vorax, but leave the taxonomic distinction betweenT. vorax andT. leucophrys in doubt. The rRNA sequences of sixTetrahymena species and of three other species of the suborder Tetrahymenina have been used to deduce evolutionary schemes in which ancestral rRNA sequences and changes are proposed. These schemes suggest the predominant acceptance of GA and CT transitions in the 5S rDNA during the evolution of the suborder.     

Dead-end evolution of the Cnidaria as deduced from 5S ribosomal RNA sequences

Using nucleotide sequences of 5S ribosomal RNAs from 2 hydrozoan jellyfishes, 3 scyphozoan jellyfishes and 2 sea anemones, a phylogenetic tree of Cnidaria has been constructed to elucidate the evolutionary relationships of radial and bilateral symmetries. The 3 classes of Cnidaria examined herein belong to one branch, which does not include other metazoan phyla such as the Platyhelminthes. The Hydrozoa (having radial symmetry without septa) and the Scyphozoa (having radial symmetry with septa) are more closely related to each other than to the Anthozoa (having bilateral symmetry with septa). In classical taxonomy, multicellular animals are considered to have evolved through organisms with radial symmetry (e.g., Cnidaria) to bilateral symmetry. Our results, however, indicate that the emergence of the Bilateria was earlier than that of the Radiata, suggesting (in opposition to Haeckel's view) that the radial symmetry of Cnidaria is an evolutionary dead end.     

Comparison of the structure of ribosomal 5S RNA from E. coli and from rat liver using X-ray scattering and dynamic light scattering

The structures of eukaryotic ribosomal 5S RNA from rat liver and of prokaryotic 5S RNA from E. coli (A-conformer) have been investigated by scattering methods. For both molecules, a molar mass of 44,500±4,000 was determined from small angle X-ray scattering as well as from dynamic light scattering. The shape parameters of the two rRNAs, volume V _c, surface O _c, radius of gyration R _s, maximum dimension of the molecule L, thickness D, and cross section radius of gyration R _sq, agree within the experimental error limits. The mean values are V _c=57±3 nm³, O _c=165±10 nm², R _s=3.37±0.05 nm, L=10.8±0.7 nm, D=1.57±0.07 nm, R _sa=0.92±0.01 nm.Identical structures for the E. coli 5S rRNA and the rat liver 5S rRNA at a resolution of 1 nm can be deduced from this agreement and from the comparison of experimental X-ray scattering curves and of experimental electron distance distribution function. The flat shape model derived for prokaryotic and eukaryotic 5S rRNA shows a compact region and two protruding arms. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. Combining the shape information obtained from X-ray scattering with the information about the frictional behaviour of the molecules, deduced from the diffusion coefficients D _20,w ⁰ =(5.9±0.2)·10^-7 cm²s^-1 and (6.2±0.2)·10^-7 cm²s^-1 for rat liver 5S rRNA and E. coli 5S rRNA, respectively, a solvation shell of about 0.3 nm thickness around both molecules is determined. This structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest that all 5S rRNAs may indeed have conserved essentially the same type of folding of their polynucleotide strands during evolution, despite having very different sequences.     

The adenosine wedge: A new structural motif in ribosomal RNA

Here, we present a new recurrent RNA arrangement, the so-called adenosine wedge (A-wedge), which is found in three places of the ribosomal RNA in both ribosomal subunits. The arrangement has a hierarchical structure, consisting of elements previously described as recurrent motifs, namely, the along-groove packing motif, the A-minor and the hook-turn. Within the A-wedge, these elements are involved in different types of cause–effect relationships, providing together for the particular tertiary structure of the motif.     

Tandem 5S ribosomal RNA genes and the spacer region sequences of three Japanese Laminaria species

The organization of 5S ribosomal RNA genes (rDNA) was examined for threeJapanese Laminaria species, L. japonica, L.religiosa and L. ochotensis. The linkage of 5SrDNA with the 18S-5.8S-25S rDNAs unit known in the brown algaScytosiphon lomentaria could not be detected inLaminaria. Instead, the tandem repeats of 5S rDNA were notassociated with the 18S-5.8S-25S rDNAs unit. The nucleotide sequence of 5S rDNAwas completely identical among these three species and its length was 118bp. However, a difference of nucleotide arrangement was detectedinthe spacer region of the tandemly repeated 5S rDNAs. Several nucleotideinsertion / deletions and substitutions were confirmed between differentindividuals of L. japonica, which were collected from notonly disjunct localities, but also the same locality. The lengths of the spacerregion of L. japonica, L. religiosaand L. ochotensis were 247–252 bp, 232bp and 252 bp, respectively.