DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Sequence Recognition of DNA by Protein-Induced Conformational Transitions

The binding of proteins to specific sequences of DNA is an important feature of virtually all DNA transactions. Proteins recognize specific DNA sequences using both direct readout (sensing types and positions of DNA functional groups) and indirect readout (sensing DNA conformation and deformability). Previously we showed that the P22 c2 repressor N-terminal domain (P22R NTD) forces the central non-contacted 5'-ATAT-3' sequence of the DNA operator into the B′ state, a state known to affect DNA hydration, rigidity and bending. Usually the B′ state, with a narrow minor groove and a spine of hydration, is reserved for A-tract DNA (TpA steps disrupt A-tracts). Here, we have co-crystallized P22R NTD with an operator containing a central 5′-ACGT-3′ sequence in the non-contacted region. C·G base pairs have not previously been observed in the B′ state and are thought to prevent it. However, P22R NTD induces a narrow minor groove and a spine of hydration to 5'-ACGT-3'. We observe that C·G base pairs have distinctive destabilizing and disordering effects on the spine of hydration. It appears that the reduced stability of the spine results in a higher energy cost for the B to B′ transition. The differential effect of DNA sequence on the barrier to this transition allows the protein to sense the non-contacted DNA sequence.     

A unified model for the origin of DNA sequence-directed curvature

The fine structure of the DNA double helix and a number of its physical properties depend upon nucleotide sequence. This includes minor groove width, the propensity to undergo the B-form to A-form transition, sequence-directed curvature, and cation localization. Despite the multitude of studies conducted on DNA, it is still difficult to appreciate how these fundamental properties are linked to each other at the level of nucleotide sequence. We demonstrate that several sequence-dependent properties of DNA can be attributed, at least in part, to the sequence-specific localization of cations in the major and minor grooves. We also show that effects of cation localization on DNA structure are easier to understand if we divide all DNA sequences into three principal groups: A-tracts, G-tracts, and generic DNA. The A-tract group of sequences has a peculiar helical structure (i.e., B*-form) with an unusually narrow minor groove and high base-pair propeller twist. Both experimental and theoretical studies have provided evidence that the B*-form helical structure of A-tracts requires cations to be localized in the minor groove. G-tracts, on the other hand, have a propensity to undergo the B-form to A-form transition with increasing ionic strength. This property of G-tracts is directly connected to the observation that cations are preferentially localized in the major groove of G-tract sequences. Generic DNA, which represents the vast majority of DNA sequences, has a more balanced occupation of the major and minor grooves by cations than A-tracts or G-tracts and is thereby stabilized in the canonical B-form helix. Thus, DNA secondary structure can be viewed as a tug of war between the major and minor grooves for cations, with A-tracts and G-tracts each having one groove that dominates the other for cation localization. Finally, the sequence-directed curvature caused by A-tracts and G-tracts can, in both cases, be explained by the cation-dependent mismatch of A-tract and G-tract helical structures with the canonical B-form helix of generic DNA (i.e., a cation-dependent junction model).     

Effect of a neutralized phosphate backbone on the minor groove of B-DNA: molecular dynamics simulation studies

Alternative models have been presented to provide explanations for the sequence-dependent variation of the DNA minor groove width. In a structural model groove narrowing in A-tracts results from direct, short-range interactions among DNA bases. In an electrostatic model, the narrow minor groove of A-tracts is proposed to respond to sequence-dependent localization of water and cations. Molecular dynamics simulations on partially methylphosphonate substituted helical chains of d(TATAGGCCTATA) and d(CGCGAATTCGCG) duplexes have been carried out to help evaluate the effects of neutralizing DNA phosphate groups on the minor groove width. The results show that the time-average minor groove width of the GGCC duplex becomes significantly more narrow on neutralizing the phosphate backbone with methylphosphonates. The minor groove of the AATT sequence is normally narrow and the methylphosphonate substitutions have a smaller but measurable affect on this sequence. These results and models provide a system that can be tested by experiment and they support the hypothesis that the electrostatic environment around the minor groove affects the groove width in a sequence-dependent dynamic and time-average manner.     

Structural insights into the effect of hydration and ions on A-tract DNA: a molecular dynamics study

DNA structure is known to be sensitive to hydration and ionic environment. To explore the dynamics, hydration, and ion binding features of A-tract sequences, a 7-ns Molecular dynamics (MD) study has been performed on the dodecamer d(CGCAAATTTGCG)(2). The results suggest that the intrusion of Na(+) ion into the minor groove is a rare event and the structure of this dodecamer is not very sensitive to the location of the sodium ions. The prolonged MD simulation successfully leads to the formation of sequence dependent hydration patterns in the minor groove, often called spine of hydration near the A-rich region and ribbon of hydration near the GC regions. Such sequence dependent differences in the hydration patterns have been seen earlier in the high resolution crystal structure of the Drew-Dickerson sequence, but not reported for the medium resolution structures (2.0 approximately 3.0 A). Several water molecules are also seen in the major groove of the MD simulated structure, though they are not highly ordered over the extended MD. The characteristic narrowing of the minor groove in the A-tract region is seen to precede the formation of the spine of hydration. Finally, the occurrence of cross-strand C2-H2.O2 hydrogen bonds in the minor groove of A-tract sequences is confirmed. These are found to occur even before the narrowing of the minor groove, indicating that such interactions are an intrinsic feature of A-tract sequences.     

Binding of an antitumor drug to DNA, Netropsin and C-G-C-G-A-A-T-T-BrC-G-C-G

The antitumor antibiotic netropsin has been co-crystallized with a double-helical B-DNA dodecanucleotide of sequence: C-G-C-G-A-A-T-T-BrC-G-C-G, and the structure of the complex has been solved by X-ray diffraction at a resolution of 2.2 A. The structure has been refined independently by Jack-Levitt and Hendrickson-Konnert least-squares methods, leading to a final residual error of 0.257 by the Jack-Levitt approach (0.211 for two-sigma data) or 0.248 by the Hendrickson-Konnert approach, with no significant difference between refined structures. The netropsin molecule displaces the spine of hydration and fits snugly within the minor groove in the A-A-T-T center. It widens the groove slightly and bends the helix axis back by 8 degrees, but neither unwinds nor elongates the double helix. The drug molecule is held in place by amide NH hydrogen bonds that bridge adenine N-3 and thymine O-2 atoms, exactly as with the spine of hydration. The requirement of A X T base-pairs in the binding site arises because the N-2 amino group of guanine would demand impermissibly close contacts with netropsin. It is proposed that substitution of imidazole for pyrrole in netropsin should create a family of "lexitropsins" capable of reading G X C-containing base sequences.     

Exploring the counterion atmosphere around DNA: what can be learned from molecular dynamics simulations?

The counterion distribution around a DNA dodecamer (5'-CGCGAATTCGCG-3') is analyzed using both standard and novel techniques based on state of the art molecular dynamics simulations. Specifically, we have explored the population of Na(+) in the minor groove of DNA duplex, and whether or not a string of Na(+) can replace the spine of hydration in the narrow AATT minor groove. The results suggest that the insertion of Na(+) in the minor groove is a very rare event, but that when once the ion finds specific sites deep inside the groove it can reside there for very long periods of time. According to our simulation the presence of Na(+) inside the groove does not have a dramatic influence in the structure or dynamics of the duplex DNA. The ability of current MD simulations to obtain equilibrated pictures of the counterion atmosphere around DNA is critically discussed.     

Structure of the hydration shells of oligo(dA-dT).oligo(dA-dT) and oligo(dA).oligo(dT) tracts in B-type conformation on the basis of Monte Carlo calculations

Monte Carlo simulations [(N, V, T)-ensemble] were performed for the hydration shell of poly(dA-dT).poly(dA-dT) in canonical B form and for the hydration shell of poly(dA).poly(dT) in canonical B conformation and in a conformation with narrow minor groove, highly inclined bases, but with a nearly zero-inclined base pair plane (B' conformation). We introduced helical periodic boundary conditions with a rather small unit cell and a limited number of water molecules to reduce the dimensionality of the configuration space. The coordinates of local maxima of water density and the properties of one- and two-membered water bridges between polar groups of the DNA were obtained. The AT-alternating duplex hydration mirrors the dyad symmetry of polar group distribution. At the dApdT step, a water bridge between the two carbonyl oxygens O2 of thymines is formed as in the central base-pair step of Dickerson's dodecamer. In the major groove, 5-membered water chains along the tetranucleotide pattern d(TATA).d(TATA) are observed. The hydration geometry of poly(dA).poly(dT) in canonical B conformation is distinguished by autonomous primary hydration of the base-pair edges in both grooves. When this polymer adopts a conformation with highly inclined bases and narrow minor groove, the water density distribution in the minor groove is in excellent agreement with Dickerson's spine model. One local maximum per base pair of the first layer is located near the dyad axis between adjacent base pairs, and one local maximum per base pair in the second shell lies near the dyad axis of the base pair itself. The water bridge between the two strands formed within the first layer was observed with high probability. But the water molecules of the second layer do not have a statistically favored orientation necessary for bridging first layer waters. In the major groove, the hydration geometry of the (A.T) base-pair edge resembles the main features of the AT-pair hydration derived from other sequences for the canonical B form. The preference of the B' conformation for oligo(dA).oligo(dT) tracts may express the tendency to common hydration of base-pair edges of successive base pairs in the grooves of B-type DNA. The mean potential energy of hydration of canonical B-DNA was estimated to be -60 to -80 kJ/mole nucleotides in dependence on the (G.C) contents. Because of the small system size, this estimation is preliminary.     

Uranyl photoprobing of nonbent A/T- and bent A-tracts. A difference of flexibility?

In this study, we have systematically compared the uranyl photocleavage of a range of bent A-tracts and nonbent TA-tracts as well as interrupted A-tracts. We demonstrate that uranyl photocleavage of A-tracts and TA-tracts is almost identical, indicating a very similar minor groove conformation. Furthermore, a 10 base pair A-tract is divided into two independent tracts by an intervening TA or GC step. Uranyl probing also clearly distinguishes the bent A4T4 and the nonbent T4A4 sequences as adopting different structures, and our interpretation of the data is consistent with a structure for the bent A4T4 sequence that resembles a continuous A-tract, whereas the nonbent T4A4 sequences are closer to two independent and opposite A-tracts that cancel each other in terms of macroscopic bending. Finally, we also note that even single TA and TAT steps are highly sensitive to uranyl photocleavage and propose that in addition to average minor groove width, uranyl also senses DNA helix flexibility/deformability. Thus, the structural difference of TA-tracts and A-tracts may to a large extent reflect a difference in flexibility, and DNA curvature may consequently require a rigid narrow minor groove conformation that creates distinct A-tract-B-DNA junctions as the predominant cause of the bending.     

An investigation of the ionic and solvation patterns of dsDNG versus dsDNA by use of molecular dynamics simulations

Molecular dynamics has been employed to analyze the counterion and water atmospheres around the deoxynucleic guanidine (DNG) duplex G(12)-C(12). These features are compared to those of DNA G(12)-C(12). The chloride counterions of cationic DNG demonstrate fewer penetrations and only fleeting residence times in the minor groove, as opposed to the multi-nanosecond visits seen by sodium ions in DNA minor grooves. The 10 ns simulations also show the differences in hydration patterns between the DNG and DNA duplexes.     

Hydration of the RNA duplex r(CGCAAAUUUGCG)2 determined by NMR.

The so-called spine of hydration in the minor groove of AnTn tracts in DNA is thought to stabilise the structure, and kinetically bound water detected in the minor groove of such DNA species by NMR has been attributed to a narrow minor groove [Liepinsh, E., Leupin, W. and Otting, G. (1994) Nucleic Acids Res. 22, 2249-2254]. We report here an NMR study of hydration of an RNA dodecamer which has a wide, shallow minor groove. Complete assignments of exchangeable protons, and a large number of non-exchangeable protons in r(CGCAAAUUUGCG)2 have been obtained. In addition, ribose C2'-OH resonances have been detected, which are probably involved in hydrogen bonds. Hydration at different sites in the dodecamer has been measured using ROESY and NOESY experiments at 11.75 and 14.1 T. Base protons in both the major and minor grooves are in contact with water, with effective correlation times for the interaction of approximately 0.5 ns, indicating weak hydration, in contrast to the hydration of adenine C2H in the homologous DNA sequence. NOEs to H1' in the minor groove are consistent with hydration water present that is not observed in the analogous DNA sequence. Hydration kinetics in nucleic acids may be determined by chemical factors such as hydrogen-bonding more than by simple conformational factors such as groove width.     

Increased temperature and 2-methyl-2,4-pentanediol change the DNA structure of both curved and uncurved adenine/thymine-rich sequences

DNA curvature is affected by elevated temperature and dehydrating agents such as 2-methyl-2,4-pentanediol (MPD) (used in crystallization). This effect of MPD has been ascribed to a specific distortion of the structure of adenine tracts (A-tracts), probably through a deformation of the characteristic narrow minor groove. Uranyl photoprobing indicates that a narrowed minor groove is present in all A/T regions containing four or more A/T base pairs. Consequently, this technique may be employed to study conformational changes in other A/T-rich sequences than pure A-tracts. In this study we use uranyl photoprobing to demonstrate that the effect of elevated temperature and MPD is analogous on both "normal" and curve-inducing A/T-rich sequences. The results therefore indicate that under these conditions the minor groove is widened in all A/T sequences and not only in pure A-tracts as previously suggested. Thus, the rather subtle structural difference of AT regions and A-tracts in nonbent DNA versus A-tracts in bent DNA may be quantitative rather than qualitative; i.e., the structure is more persistent and/or rigid in bent DNA.     

On the competition between water,sodium ions,and spermine in binding to DNA: a molecular dynamics computer simulation study

The interaction of DNA with the polyamine spermine(4+) (Spm(4+)), sodium ions, and water molecules has been studied using molecular dynamics computer simulations in a system modeling a DNA crystal. The simulation model consisted of three B-DNA decamers in a periodic hexagonal cell, containing 1200 water molecules, 8 Spm(4+), 32 Na(+), and 4 Cl(-) ions. The present paper gives a more detailed account of a recently published report of this system and compares results on this mixed Spm(4+)/Na(+)-cation system with an molecular dynamics simulation carried out for the same DNA decamer under similar conditions with only sodium counterions (Korolev et al., J. Mol. Biol. 308:907). The presence of Spm(4+) makes significant influence on the DNA hydration and on the interaction of the sodium ions with DNA. Spermine pushes water molecules out of the minor groove, whereas Na(+) attracts and organizes water around DNA. The major binding site of the Spm(4+) amino groups and the Na(+) ions is the phosphate group of DNA. The flexible polyamine spermine displays a high presence in the minor groove but does not form long-lived and structurally defined complexes. Sodium ions compete with Spm(4+) for binding to the DNA bases in the minor groove. Sodium ions also have several strong binding sites in the major groove. The ability of water molecules, Spm(4+), and Na(+) to modulate the local structure of the DNA double helix is discussed.     

Molecular dynamics simulations of DNA in solutions with different counter-ions

Molecular dynamics simulations of the [d(ATGCAGTCAG]2 fragment of DNA, in water and in the presence of three different counter-ions (Li+, Na+ and Cs+) are reported. Three-dimensional hydration structure and ion distribution have been calculated using spatial distribution functions for a detailed picture of local concentrations of ions and water molecules around DNA. According to the simulations, Cs+ ions bind directly to the bases in the minor groove, Na+ ions bind prevailing to the bases in the minor groove through one water molecule, whereas Li+ ions bind directly to the phosphate oxygens. The different behavior of the counter-ions is explained by specific hydration structures around the DNA and the ions. It is proposed how the observed differences in the ion binding to DNA may explain different conformational behavior of DNA. Calculated self-diffusion coefficients for the ions agree well with the available NMR data.     

Hydration of B-DNA: comparison between the water network around poly(dG).poly(dC) and poly(dG-dC).poly(dG-dC) on the basis of Monte Carlo computations

A computational method is elaborated for studying the water environment around regular polynucleotide duplexes; it allows rigorous structural information on the hydration shell of DNA to be obtained. The crucial aspect of this Monte Carlo simulation is the use of periodical boundary conditions. The output data consists of local maxima of water density in the space near the DNA molecule and the properties of one- and two-membered water bridges as function of pairs of polar groups of DNA. In the present paper the results for poly(dG).poly(dC) and poly(dG-dC).poly(dG-dC) are presented. The differences in their hydration shells are of a purely structural nature and are caused by the symmetry of the polar groups of the polymers under study, the symmetry being reflected by the hydration shell. The homopolymer duplex hydration shell mirrors the mononucleotide repeat. The water molecules contacting the polynucleotide in the minor groove are located nearly in the plane midway between the planes of successive base pairs. One water molecule per base pair forms a water bridge facing two polar groups of bases from adjacent base pairs and on different strands making a "spine"-like structure. In contrast, the major groove hydration is stabilized exclusively by two-membered water bridges; the water molecules deepest in the groove are concentrated near the plane of the corresponding base pair. The alternating polymer is characterized by a marked dyad symmetry of the hydration shell corresponding to the axis between two successive base pairs. The minor groove hydration of the dCpdG step resembles the characteristic features of the homopolymer, but the bridge between the O2 oxygens of the other base-stacking type is formed by two water molecules. The major groove hydration is characterized by high probability of one-membered water bridges and by localization of a water molecule on the dyad axis of the dGpdC step. The found structural elements are discussed as reasonable invariants of a dynamic hydration shell.     

Sequence-dependent variation in DNA minor groove width dictates orientational preference of Hoechst 33258 in A-tract recognition: solution NMR structure of the 2:1 complex with d(CTTTTGCAAAAG)(2)

The solution structure of the dodecamer duplex d(CTTTTGCAAAAG)₂ and its 2:1 complex with the bis-benzimidazole Hoechst 33258 has been investigated by NMR and NOE-restrained molecular dynamics (rMD) simulations. Drug molecules are bound in each of the two A-tracts with the bulky N-methylpiperazine ring of each drug located close to the central TG (CA) step, binding essentially to the narrow minor groove of each A-tract. MD simulations over 1 ns, using an explicit solvation model, reveal time-averaged sequence-dependent narrowing of the minor groove from the 3′-end towards the 5′-end of each TTTT sequence. Distinct junctions at the TpG (CpA) steps, characterised by large positive roll, low helical and propeller twists and rapid AT base pair opening rates, add to the widening of the groove at these sites and appear to account for the bound orientation of the two drug molecules with the N-methylpiperazine ring binding in the wider part of the groove close to the junctions. Comparisons between the free DNA structure and the 2:1 complex (heavy atom RMSD 1.55 Å) reveal that these sequence-dependent features persist in both structures. NMR studies of the sequence d(GAAAAGCTTTTC)₂, in which the A-tracts have been inverted with the elimination of the TpG junctions, results in loss of orientational specificity of Hoechst 33258 and formation of multiple bound species in solution, consistent with the drug binding in a number of different orientations.     

Dependence of the hydration shell structure in the minor groove of the DNA double helix on the groove width as revealed by Monte Carlo simulation.

The hydration shell of several conformations of the polynucleotides poly(dA).poly(dT), poly(dA).poly(dU), and poly(dA-dI).poly(dT-dC) has been simulated using the Monte Carlo method (Metropolis sampling). Calculations have shown that the structure of the hydration shell of the minor groove greatly depends on its width. In conformations with a narrowed minor groove, the first layer of the hydration shell of this groove has only one molecule per nucleotide pair that forms H bonds with purine N3 of one pair and pyrimidine O2 of the next pair. The second layer of the hydration shell of such conformations contains molecules that form H bonds between two adjacent molecules of the first layer. The probability of formation of hydration spine is about 20% while the bridges of the first layer are formed with a probability of about 70%. In the first layer of the minor groove of the B-DNA conformation with wide minor groove there are approximately two water molecules per base pair that form H bonds with purine N3 or pyrimidine O2 and with the sugar ring oxygen of the adjacent nucleotide. The probability of simultaneous H bonding of a water molecule with N3 (or O2) and O of sugar ring is about 30%. The results of simulation suggest that hydration spine proposed for the narrowed minor groove of oligonucleotide crystals [H. R. Drew, and R. E. Dickerson (1981) Journal of Molecular Biology, Vol. 151, pp. 535-556] can be formed in fibers of poly(dA).poly(dT), poly(dA).poly(dU), and poly(dA-dI).poly(dT-dC) as well as in DNA fragments of these sequences in solution.(ABSTRACT TRUNCATED AT 250 WORDS)     

Water spines and networks in G-quadruplex structures

Quadruplex DNAs can fold into a variety of distinct topologies, depending in part on loop types and orientations of individual strands, as shown by high-resolution crystal and NMR structures. Crystal structures also show associated water molecules. We report here on an analysis of the hydration arrangements around selected folded quadruplex DNAs, which has revealed several prominent features that re-occur in related structures. Many of the primary-sphere water molecules are found in the grooves and loop regions of these structures. At least one groove in anti-parallel and hybrid quadruplex structures is long and narrow and contains an extensive spine of linked primary-sphere water molecules. This spine is analogous to but fundamentally distinct from the well-characterized spine observed in the minor groove of A/T-rich duplex DNA, in that every water molecule in the continuous quadruplex spines makes a direct hydrogen bond contact with groove atoms, principally phosphate oxygen atoms lining groove walls and guanine base nitrogen atoms on the groove floor. By contrast, parallel quadruplexes do not have extended grooves, but primary-sphere water molecules still cluster in them and are especially associated with the loops, helping to stabilize loop conformations.     

Binding of Hoechst 33258 to the minor groove of B-DNA

An X-ray crystallographic structure analysis has been carried out on the complex between the antibiotic and DNA fluorochrome Hoechst 33258 and a synthetic B-DNA dodecamer of sequence C-G-C-G-A-A-T-T-C-G-C-G. The drug molecule, which can be schematized as: phenol-benzimidazole-benzimidazole-piperazine, sits within the minor groove in the A-T-T-C region of the DNA double helix, displacing the spine of hydration that is found in drug-free DNA. The NH groups of the benzimidazoles make bridging three-center hydrogen bonds between adenine N-3 and thymine O-2 atoms on the edges of base-pairs, in a manner both mimicking the spine of hydration and calling to mind the binding of the auti-tumor drug netropsin. Two conformers of Hoechst are seen in roughly equal populations, related by 180 degrees rotation about the central benzimidazole-benzimidazole bond: one form in which the piperazine ring extends out from the surface of the double helix, and another in which it is buried deep within the minor groove. Steric clash between the drug and DNA dictates that the phenol-benzimidazole-benzimidazole portion of Hoechst 33258 binds only to A.T regions of DNA, whereas the piperazine ring demands the wider groove characteristic of G.C regions. Hence, the piperazine ring suggests a possible G.C-reading element for synthetic DNA sequence-reading drug analogs.