Change in cytosolic calmodulin activity of density (age) separated human erythrocytes towards membrane Ca2+/Mg2+ ATPase

The membrane $\text{Ca}{}^{\mathrm{2+}}\text{Mg}{}^{\mathrm{2+}}$ ATPase of density (age) separated human erythrocytes was examined for its stimulation by the cytosols of these cell groups. On the assumption that the stimulatory activity in the cytosol is only calmodulin, it was consistently observed that the young cytosol had a significantly higher activity towards the membrane $\text{Ca}{}^{\mathrm{2+}}\text{Mg}{}^{\mathrm{2+}}$ ATPase activity (from any age group) than did the old cell cytosol. The data clearly demonstrates decided differences in the expression of calmodulin activity in cytosols from young and old erythrocytes and would support the conclusion that calmodulin activity is altered during $\text{in vivo}$ aging of these cells. Possible mechanisms for these alterations are discussed.     

How does lysozyme penetrate through the bacterial outer membrane?

Lysozyme fails to penetrate through the outer membrane of stationary phase cells of Escherichia coli when it is simply added to suspensions of plasmolyzed cells. Lysozyme penetrates the outer membrane only when these cells are exposed to a mild osmotic shock in the presence of EDTA and lysozyme.In the presence of Mg²⁺, the outer membrane is stabilized sufficiently so that there is no lysozyme penetration during osmotic shock. If Mg²⁺ is added after an osmotic shock has been used to cause lysozyme to penetrate a destabilized outer membrane, the outer membrane is stabilized once again. In this case however, cells are converted to spheroplasts by the lysozyme which has gained access to the murein layer prior to the addition of Mg²⁺. Mg²⁺ stabilizes the outer membranes of these spheroplasts sufficiently so that they remain immune to lysis even in the absence of osmotic stabilizers such as sucrose.These results are discussed in terms of current information on the structure of the murein layer and the outer membrane.     

Carbohydrate-induced modulation of cell membrane. VIII. Agglutination with mammalian lectin galectin-1 increases osmofragility and membrane fluidity of trypsinized erythrocytes

Interaction of lectins with cell surface determinants may alter membrane properties. Using trypsinized rabbit erythrocytes as model we tested the capacity of an endogenous lectin in this respect. Galectin-1 is a member of an adhesion/growth-regulatory family known to interact for example with ganglioside GM(1) and also the hydrophobic tail of oncogenic H-Ras. Assays on membrane fluidity and osmofragility detect galectin-1's capacity to increase the parameters. Moreover, it increases susceptibility of erythrocytes to radical damage. These observations indicate the potential of this endogenous lectin to affect membrane properties beyond the immediate interaction with cell surface epitopes.     

Variants of a cloned synthetic lactose operator: I. A palindromic dimer lactose operator derived from one strand of the cloned 40-base pair operator

Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence

where the horizontal arrows indicate the locations of the two 21-bp “core? operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for EcoKL, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro.     

Cloning of chicken globin cDNA in bacterial plasmids

Chicken globin cDNA was prepared from mRNA isolated from phenylhydrazine-treated chicken reticulocytes, and cloned into the tetracycline-resistance gene of plasmid pMB9. Restriction enzyme analysis indicates that there are at least two classes of clones isolated. Nucleotide sequence data have shown that these classes corresponded to the chicken α- and β-globin genes.     

3-Aminobenzamide stimulates unscheduled DNA synthesis and rejoining of strand breaks in human lymphocytes

The effects of unilateral microsurgical denervation on the activity of lipoprotein lipase in rat epididymal adipose tissue have been investigated. This technique provides successful denervation in 30–70% of the operations. Lipoprotein lipase activities were not different from those on the non-operated side, although the concentrations of norepinephrine were at least ten times lower. It is concluded that lipoprotein lipase of rat adipose tissue is unlikely to be regulated by an adrenergic nervous mechanism.     

Virus-induced fusion of human erythrocyte ghosts I. Effects of macromolecules on the final stages of the fusion reaction

Human erythrocyte ghosts prepared by hypotonic hemolysis can be fused by Sendai virus, provided that certain macromolecules (bovine serum albumin, dextran and others) are sequestered in the ghosts. Since fusion of the ghosts is dependent on intactness of the F(fusion)-glycoprotein of the virion, and since the other requirements for this reaction are also similar to those for the Sendai virus-induced fusion of intact erythrocytes, this system can be used as a model for the Sendai virus-induced cell fusion reaction. Sequestered macromolecules seem to be required for rounding of locally fused ghosts. Under low osmotic swelling conditions, such as use of ghosts sealed without macromolecules or using bovine serum albumin-loaded ghosts sealed in the presence of external macromolecules, no apparently complete cell fusion (large spherical polyghost formation) could be observed. Even under these conditions, however, occurence of local cell fusion could be demonstrated either by transfer of fluorescent-labeled albumin from one ghost to an other, or by observation of polyghost formation after osmotic swelling in the cold. Thus, final stages of the fusion reaction can be divided into local cell-cell fusion which could not be observed by phase-contrast microscopy, and rounding (i.e. formation of spherical polyghost). For the observation of fusion of ghosts, the last step seems to be important.     

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.     

Cloning and characterization of the natural lactose operator

A 55-bp DNA segment carrying the wild-type lactose operator sequence has been cloned. Its sequence is: (Formula: see text). With the exceptions of the bases at positions 19 and 41, 26 and 34, and 28 and 32, the sequence is a perfect inverted repeat about base pair 30. This segment was obtained from the wild-type lactose promoter and operator region of lambda h80dlac phage DNA by a combination of in vitro and in vivo steps. Up to four direct-repeat copies of this segment have been cloned in plasmid pMB9 and pBR325. Repressor affinity for this 55-bp fragment does not differ significantly from that for a 40-bp synthetic operator fragment cloned previously, even though the 55-bp fragment contains the complete set of sequence symmetries associated with the natural operator, whereas the 40-bp fragment does not. An improved procedure for operator purification is described: this was used to prepare 14 mg of the 55-bp fragment over a 2-month period.     

The expression of Streptomyces and Escherichia coli drug-resistance determinants cloned into the Streptomyces phage phi C31

Lysogens obtained by infecting Streptomyces albus G with a phi C31-pBR322 chimaeric prophage or its delta W12 deletion derivative had increased tetracycline resistance. The ability of the delta W12 derivative to transduce tetracycline resistance was inactivated by inserting a viomycin resistance determinant (vph) into the BamHI site of the pBR322 tet gene, and restored by excising the vph gene. Another deletion mutant (delta W17) of the chimaera, carrying an intact tet gene, was normally unable to transduce tetracycline resistance. This inability was correlated with the finding, by Southern hybridisation analysis, that the att site required for insertion of phi C31 prophage into the host chromosome was located within the delta W17 deletion. Use of phi C31 lysogenic recipient permitted the integration of the att-deleted phage, presumably by homologous recombination, giving tetracycline-resistant double lysogens. This technique was extended to S. coelicolor A3(2) in the detection of derivatives of the att-deleted phage into which a thiostrepton-resistance determinant (tsr) had been inserted in vitro. Phage released from double lysogens were mainly recombinants. One such recombinant is a PstI vector for DNA cloning, able to accommodate up to 6 kb of introduced DNA.     

Molecular analysis of the human interferon-alpha gene family

Fifteen DNA clones containing sequences related to human interferon-alpha cDNA were isolated from a human chromosomal gene bank (Nagata et al., Nature 287 (1980) 401-408) and characterized by restriction mapping, R-loop and heteroduplex analysis. Nine distinct DNA segments hybridized strongly with interferon-alpha 1 cDNA and formed R-loops with poly(A) RNA from interferon-producing human leukocytes; most if not all of these segments represent functional interferon genes. Five segments hybridized weakly with the probe and did not form R-loops with the poly(A) RNA; one of these was characterized as an interferon-alpha pseudogene. Several DNA segments overlap and define a region of 36 kilobase pairs (kb) that contains three strongly and three weakly hybridizing sequences. From our data and those of Goeddel et al. (Nature 290 (1981) 20-25) we conclude that there exist at least 11 distinct genes of gene-like sequences of the interferon-alpha type in the human genome, of which most likely represents an allelic variant, and at least five pseudogenes distantly related to the interferon-alpha genes.     

Plasmids containing many tandem copies of a synthetic lactose operator

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.     

Cloning and sequence analysis of a rat liver cDNA coding for a phenobarbital-inducible microheterogenous cytochrome P-450 variant: regulation of its messenger level by xenobiotics

A rat liver cDNA library was prepared from total polyribosomal poly(A)+ RNA extracted from phenobarbital-treated animals. A cDNA clone coding for a phenobarbital-inducible cytochrome P-450 (PB P-450) was identified by differential colony hybridization to cDNAs synthesized from liver poly(A)+RNAs isolated from phenobarbital-treated rats for positive selection and cDNAs from either untreated rats or beta-naphthoflavone-treated rats as negative controls, followed by hybrid-selected translation and analysis of the translation products by immunoprecipitation. As the cloning and screening strategies involve no prior enrichment for specific mRNAs, they also permit the identification of sequences coding for phenobarbital-induced proteins other than cytochromes P-450. This relatively straightforward approach is generally applicable to the molecular cloning of sequences coding for other inducible cytochromes P-450. Nucleic acid sequencing data indicated that the cloned PB P-450 cDNA codes for a cytochrome P-450 variant [designated P-450e(U.C.)] that is very similar, but not identical, to P-450e. Sequence analysis of the section of cDNA specifying the 3'-non-coding region of the mRNA revealed that it lacked the usual poly(A) addition site signal sequence but contained three inverted repeat structures. Solution hybridization analysis demonstrated that PB P-450 mRNA is increased 20-fold by phenobarbital treatment and decreased 3-fold by beta-naphthoflavone treatment.     

Effect of heparin on the inhibition of thrombin by alpha 1-proteinase inhibitor.

Heparin interferes with the inhibition of thrombin by α₁-proteinase inhibitor (αPI). The inhibitory effect of heparin is due to its binding to thrombin. Other glycosaminoglycans and carboxyl-modified heparin do not have the same effect as heparin. The results indicate that there are similarities in the structural requirements in heparin, for anticoagulant activity and for the inhibition of αPI interaction with thrombin.     

Selective retention of recombinant plasmids coding for human insulin

Plasmids may be lost from Escherichia coli K-12 hosts that are cultured without selection for plasmid retention. This is particularly true for chimeric plasmids that incorporate genes for human insulin into vectors derived from pBR322. The cIts857 gene of bacteriophage lambda was inserted into the bla gene of the human-insulin-coding plasmids, pIA7 delta 4 delta 1, pIB7 delta 4 delta 1 and pHI7 delta 4 delta 1, generating the new plasmids pPR17, pPR18 and pPR19, respectively, which produced the thermosensitive lambda repressor. The cI gene was downstream from the pM and pbla promoters, so that it may have been expressed from either or both promoters. Separate E. coli K-12 RV308 host strains containing the new recombinants were lysogenized with the repressor-defective bacteriophage lambda cI90. Loss of the plasmid from the lysogens causes concomitant loss of the lambda repressor and cell death, because the prophage is induced to enter the lytic growth cycle. The system effectively forces retention of the plasmid in all viable cells in the culture.     

Recombination between satellite phage P4 and its helper P2. I. In vivo and in vitro construction of P4: :P2 hybrid satellite phage

P4::P2 hybrid satellite phages which carry a portion (including the P2 head gene Q and the cohesive end) of the left end of the P2 chromosome linked to the essential part of the P4 chromosome have been isolated by in vivo as well as in vitro recombination. These hybrids express gene Q and grow in the presence of a P2 helper even if defective in gene Q.