FANCJ helicase defective in Fanconia anemia and breast cancer unwinds G-quadruplex DNA to defend genomic stability

FANCJ mutations are associated with breast cancer and genetically linked to the bone marrow disease Fanconi anemia (FA). The genomic instability of FA-J mutant cells suggests that FANCJ helicase functions in the replicational stress response. A putative helicase with sequence similarity to FANCJ in Caenorhabditis elegans (DOG-1) and mouse (RTEL) is required for poly(G) tract maintenance, suggesting its involvement in the resolution of alternate DNA structures that impede replication. Under physiological conditions, guanine-rich sequences spontaneously assemble into four-stranded structures (G quadruplexes [G4]) that influence genomic stability. FANCJ unwound G4 DNA substrates in an ATPase-dependent manner. FANCJ G4 unwinding is specific since another superfamily 2 helicase, RECQ1, failed to unwind all G4 substrates tested under conditions in which the helicase unwound duplex DNA. Replication protein A stimulated FANCJ G4 unwinding, whereas the mismatch repair complex MSH2/MSH6 inhibited this activity. FANCJ-depleted cells treated with the G4-interactive compound telomestatin displayed impaired proliferation and elevated levels of apoptosis and DNA damage compared to small interfering RNA control cells, suggesting that G4 DNA is a physiological substrate of FANCJ. Although the FA pathway has been classically described in terms of interstrand cross-link (ICL) repair, the cellular defects associated with FANCJ mutation extend beyond the reduced ability to repair ICLs and involve other types of DNA structural roadblocks to replication.     

Simian virus 40 large T-antigen G-quadruplex DNA helicase inhibition by G-quadruplex DNA-interactive agents

On the basis of growing evidence for G-quadruplex DNA structures in genomic DNA and the presumed need to resolve these structures for DNA replication, the G-quadruplex DNA unwinding ability of a prototypical replicative helicase, SV40 large T-antigen (T-ag), was investigated. Here, we demonstrate that this G-quadruplex helicase activity is robust and comparable to the duplex helicase activity of T-ag. Analysis of the SV40 genome demonstrates the presence of sequences that may form intramolecular G-quadruplexes, which are the presumed natural substrates for the G-quadruplex helicase activity of T-ag. A number of G-quadruplex-interactive agents as well as new perylene diimide (PDI) derivatives have been investigated as inhibitors of both the G-quadruplex and the duplex DNA helicase activities of T-ag. A unique subset of these G-quadruplex-interactive agents inhibits the G-quadruplex DNA unwinding activity of T-ag, relative to those reported to inhibit G-quadruplex DNA unwinding by RecQ-family helicases. We also find that certain PDIs are both potent and selective inhibitors of the G-quadruplex DNA helicase activity of T-ag. Surface plasmon resonance and fluorescence spectroscopic G-quadruplex DNA binding studies of these T-ag G-quadruplex helicase inhibitors have been carried out, demonstrating the importance of attributes in addition to binding affinity for G-quadruplex DNA that may be important for inhibition. The identification of potent and selective inhibitors of the G-quadruplex helicase activity of T-ag provides tools for probing the specific role of this activity in SV40 replication.     

ATP-dependent G-quadruplex unfolding by Bloom helicase exhibits low processivity

Various helicases and single stranded DNA (ssDNA) binding proteins unfold G-quadruplex (GQ) structures. However, the underlying mechanisms of this activity have only recently come to focus. We report kinetic studies on Bloom (BLM) helicase and human telomeric GQ interactions using single-molecule Förster resonance energy transfer (smFRET). Using partial duplex DNA (pdDNA) constructs with different 5′ ssDNA overhangs, we show that BLM localizes in the vicinity of ssDNA/double-stranded DNA (dsDNA) junction and reels in the ssDNA overhang in an ATP-dependent manner. A comparison of DNA constructs with or without GQ in the overhang shows that GQ unfolding is achieved in 50–70% of reeling attempts under physiological salt and pH conditions. The unsuccessful attempts often result in dissociation of BLM from DNA which slows down the overall BLM activity. BLM-mediated GQ unfolding is typically followed by refolding of the GQ, a pattern that is repeated several times before BLM dissociates from DNA. BLM is significantly less processive compared to the highly efficient GQ destabilizer Pif1 that can repeat GQ unfolding activity hundreds of times before dissociating from DNA. Despite the variations in processivity, our studies point to possible common patterns used by different helicases in minimizing the duration of stable GQ formation.     

The FANCJ helicase unfolds DNA-protein crosslinks to promote their repair

1. Download : Download high-res image (148KB)
2. Download : Download full-size image

     

DNA replication through G-quadruplex motifs is promoted by the Saccharomyces cerevisiae Pif1 DNA helicase

G-quadruplex (G4) DNA structures are extremely stable four-stranded secondary structures held together by noncanonical G-G base pairs. Genome-wide chromatin immunoprecipitation was used to determine the in?vivo binding sites of the multifunctional Saccharomyces cerevisiae Pif1 DNA helicase, a potent unwinder of G4 structures in?vitro. G4 motifs were a significant subset of the high-confidence Pif1-binding sites. Replication slowed in the vicinity of these motifs, and they were prone to breakage in Pif1-deficient cells, whereas non-G4 Pif1-binding sites did not show this behavior. Introducing many copies of G4 motifs caused slow growth in replication-stressed Pif1-deficient cells, which was relieved by spontaneous mutations that eliminated their ability to form G4 structures, bind Pif1, slow DNA replication, and stimulate DNA breakage. These data suggest that G4 structures form in?vivo and that they are resolved by Pif1 to prevent replication fork stalling and DNA breakage.     

FANCJ is a structure-specific DNA helicase associated with the maintenance of genomic G/C tracts

Fanconi anemia (FA) is a heritable human cancer-susceptibility disorder, delineating a genetically heterogenous pathway for the repair of replication-blocking lesions such as interstrand DNA cross-links. Here we demonstrate that one component of this pathway, FANCJ, is a structure-specific DNA helicase that dissociates guanine quadruplex DNA (G4 DNA) in vitro. Moreover, in contrast with previously identified G4 DNA helicases, such as the Bloom's helicase (BLM), FANCJ unwinds G4 substrates with 5'-3' polarity. In the FA-J human patient cell line EUFA0030 the loss of FANCJ G4 unwinding function correlates with the accumulation of large genomic deletions in the vicinity of sequences, which match the G4 DNA signature. Together these findings support a role for FANCJ in the maintenance of potentially unstable genomic G/C tracts during replication.     

A fluorescence-based helicase assay: application to the screening of G-quadruplex ligands

Helicases, enzymes that unwind DNA or RNA structure, are present in the cell nucleus and in the mitochondrion. Although the majority of the helicases unwind DNA or RNA duplexes, some of these proteins are known to resolve unusual structures such as G-quadruplexes (G4) in vitro. G4 may form stable barrier to the progression of molecular motors tracking on DNA. Monitoring G4 unwinding by these enzymes may reveal the mechanisms of the enzymes and provides information about the stability of these structures. In the experiments presented herein, we developed a reliable, inexpensive and rapid fluorescence-based technique to monitor the activity of G4 helicases in real time in a 96-well plate format. This system was used to screen a series of G4 structures and G4 binders for their effect on the Pif1 enzyme, a 5′ to 3′ DNA helicase. This simple assay should be adaptable to analysis of other helicases and G4 structures.     

Selective recognition of a DNA G-quadruplex by an engineered antibody

Particular guanine rich nucleic acid sequences can fold into stable secondary structures called G-quadruplexes. These structures have been identified in various regions of the genome that include the telomeres, gene promoters and UTR regions, raising the possibility that they may be associated with biological function(s). Computational analysis has predicted that intramolecular G-quadruplex forming sequences are prevalent in the human genome, thus raising the desire to differentially recognize genomic G-quadruplexes. We have employed antibody phage display and competitive selection techniques to generate a single-chain antibody that shows >1000-fold discrimination between G-quadruplex and duplex DNA, and furthermore >100-fold discrimination between two related intramolecular parallel DNA G-quadruplexes. The amino acid sequence composition at the antigen binding site shows conservation within the light and heavy chains of the selected scFvs, suggesting sequence requirements for G-quadruplex recognition. Circular dichroism (CD) spectroscopic data showed that the scFv binds to the prefolded G-quadruplex and does not induce G-quadruplex structure formation. This study demonstrates the strongest discrimination that we are aware of between two intramolecular genomic G-quadruplexes.     

G-quadruplex DNA recognition by nucleophosmin: New insights from protein dissection

Background

Nucleophosmin (NPM1, B23) is a multifunctional protein that is involved in a variety of fundamental biological processes. NPM1/B23 deregulation is implicated in the pathogenesis of several human malignancies. This protein exerts its functions through the interaction with a multiplicity of biological partners. Very recently it is has been shown that NPM1/B23 specifically recognizes DNA G-quadruplexes through its C-terminal region.

Methods

Through a rational dissection approach of protein here we show that the intrinsically unfolded regions of NPM1/B23 significantly contribute to the binding of c-MYC G-quadruplex motif. Interestingly, the analysis of the ability of distinct NPM1/B23 fragments to bind this quadruplex led to the identifications of distinct NPM1/B23-based peptides that individually present a high affinity for this motif.

Results

These results suggest that the tight binding of NPM1/B23 to the G-quadruplex is achieved through the cooperation of both folded and unfolded regions that are individually able to bind it. The dissection of NPM1/B23 also unveils that its H1 helix is intrinsically endowed with an unusual thermal stability.

Conclusions

These findings have implications for the unfolding mechanism of NPM1/B23, for the G-quadruplex affinity of the different NPM1/B23 isoforms and for the design of peptide-based molecules able to interact with this DNA motif.

General observation

This study sheds new light in the molecular mechanism of the complex NPM1/G-quadruplex involved in acute myeloid leukemia (AML) disease.     

Inhibition of BACH1 (FANCJ) helicase by backbone discontinuity is overcome by increased motor ATPase or length of loading strand

The BRCA1 associated C-terminal helicase (BACH1) associated with breast cancer has been implicated in double strand break (DSB) repair. More recently, BACH1 (FANCJ) has been genetically linked to the chromosomal instability disorder Fanconi Anemia (FA). Understanding the roles of BACH1 in cellular DNA metabolism and how BACH1 dysfunction leads to tumorigenesis requires a comprehensive investigation of its catalytic mechanism and molecular functions in DNA repair. In this study, we have determined that BACH1 helicase contacts with both the translocating and the non-translocating strands of the duplex are critical for its ability to track along the sugar phosphate backbone and unwind dsDNA. An increased motor ATPase of a BACH1 helicase domain variant (M299I) enabled the helicase to unwind the backbone-modified DNA substrate in a more proficient manner. Alternatively, increasing the length of the 5′ tail of the DNA substrate allowed BACH1 to overcome the backbone discontinuity, suggesting that BACH1 loading mechanism is critical for its ability to unwind damaged DNA molecules.     

G-quadruplex formation at the 3' end of telomere DNA inhibits its extension by telomerase, polymerase and unwinding by helicase

Telomere G-quadruplex is emerging as a promising anti-cancer target due to its inhibition to telomerase, an enzyme expressed in more than 85% tumors. Telomerase-mediated telomere extension and some other reactions require a free 3' telomere end in single-stranded form. G-quadruplex formation near the 3' end of telomere DNA can leave a 3' single-stranded tail of various sizes. How these terminal structures affect reactions at telomere end is not clear. In this work, we studied the 3' tail size-dependence of telomere extension by either telomerase or the alternative lengthening of telomere (ALT) mechanism as well as telomere G-quadruplex unwinding. We show that these reactions require a minimal tail of 8, 12 and 6 nt, respectively. Since we have shown that G-quadruplex tends to form at the farthest 3' distal end of telomere DNA leaving a tail of no more than 5 nt, these results imply that G-quadruplex formation may play a role in regulating reactions at the telomere ends and, as a result, serve as effective drug target for intervening telomere function.     

Molecular basis of BACH1/FANCJ recognition by TopBP1 in DNA replication checkpoint control

The diverse roles of TopBP1 in DNA replication and checkpoint signaling are associated with the scaffolding ability of TopBP1 to initiate various protein-protein interactions. The recognition of the BACH1/FANCJ helicase by TopBP1 is critical for the activation of the DNA replication checkpoint at stalled replication forks and is facilitated by the C-terminal tandem BRCT7/8 domains of TopBP1 and a phosphorylated Thr(1133) binding motif in BACH1. Here we provide the structural basis for this interaction through analysis of the x-ray crystal structures of TopBP1 BRCT7/8 both free and in complex with a BACH1 phospho-peptide. In contrast to canonical BRCT-phospho-peptide recognition, TopBP1 BRCT7/8 undergoes a dramatic conformational change upon BACH1 binding such that the two BRCT repeats pivot about the central BRCT-BRCT interface to provide an extensive and deep peptide-binding cleft. Additionally, we provide the first structural mechanism for Thr(P) recognition among BRCT domains. Together with systematic mutagenesis studies, we highlight the role of key contacts in governing the unique specificity of the TopBP1-BACH1 interaction.     

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.     

Fast screening and structural elucidation of G-quadruplex ligands from a mixture via G-quadruplex recognition and NMR methods

Currently, there is a considerable interest in discovering G-quadruplex ligands. Plant-derived agents, because of their diversity in structure and bioactivity and low toxicity, may be a very diverse source of G-quadruplex ligands. However, up to now, the screening of G-quadruplex ligands from natural plant extract has not been reported. Herein, in order to develop a simple method for fast identifying G-quadruplex ligands from plant extract, we intended to substitute the spectral shift in the imino region (δ 10–12) in ¹H NMR spectra of G-quadruplex for in vitro bioassay to judge the existence/nonexistence of G-quadruplex ligand(s) in plant extract, and then couple G-quadruplex recognition with NMR based structure elucidation to identify the structure of the ligand(s) without the need of prior separation. In this paper, we successfully screened a G-quadruplex ligand from a simulated plant extract using this approach. This research work provides a promising tactic to find new leading compounds from nature plant extract.     

Amide bond direction modulates G-quadruplex recognition and telomerase inhibition by 2,6 and 2,7 bis-substituted anthracenedione derivatives

G-quadruplex structures of DNA represent a potentially useful target for anticancer drugs. Stabilisation of this arrangement at the ends of chromosomes may inhibit the action of telomerase, an enzyme involved in immortalization of cancer cells. Appropriately substituted amido anthracenediones are effective G-quadruplex stabilizers, but no information is available as yet on the possible modulation of G-quadruplex recognition and telomerase inhibition produced by the direction of the amide bond. To understand the basis of amido anthracenedione selectivity, we have synthesized a number of derivatives bearing the -CO-NH- or -NH-CO- group linked to the planar anthraquinone (AQ) moiety at 2,6 and 2,7 positions. The various isomers were tested in terms of telomerase inhibition, determined by the TRAP assay, G-quadruplex stabilisation measured by the increase in melting temperature of the appropriately folded oligonucleotide using FRET, and conformational and G4 binding properties examined by molecular modelling techniques. In all cases, enzymatic inhibition and G-quadruplex stabilization were directly related, which strongly supports the proposed molecular mechanism of telomerase interference. Interestingly, the AQ-NH-CO- arrangement performs invariantly better than the AQ-CO-NH- arrangement, showing a clear preference among isomeric derivatives. Theoretical calculations suggest that the former amide arrangement is co-planar with the aromatic system, whereas the latter is tilted by about 30 degrees when considering the most stable conformation. A more extended planar surface would allow more efficient stacking interactions with the quadruplex structure, hence more effective telomerase inhibition.     

A critical epitope for substrate recognition by the nucleosome remodeling ATPase ISWI

The ATPase ISWI is the catalytic core of several nucleosome remodeling complexes, which are able to alter histone–DNA interactions within nucleosomes such that the sliding of histone octamers on DNA is facilitated. Dynamic nucleosome repositioning may be involved in the assembly of chromatin with regularly spaced nucleosomes and accessible regulatory sequence elements. The mechanism that underlies nucleosome sliding is largely unresolved. We recently discovered that the N-terminal ‘tail’ of histone H4 is critical for nucleosome remodeling by ISWI. If deleted, nucleosomes are no longer recognized as substrates and do not stimulate the ATPase activity of ISWI. We show here that the H4 tail is part of a more complex recognition epitope which is destroyed by grafting the H4 N-terminus onto other histones. We mapped the H4 tail requirement to a hydrophilic patch consisting of the amino acids R₁₇H₁₈R₁₉ localized at the base of the tail. These residues have been shown earlier to contact nucleosomal DNA, suggesting that ISWI recognizes an ‘epitope’ consisting of the DNA-bound H4 tail. Consistent with this hypothesis, the ISWI ATPase is stimulated by isolated H4 tail peptides ISWI only in the presence of DNA. Acetylation of the adjacent K₁₂ and K₁₆ residues impairs substrate recognition by ISWI.