Synthesis and physical characterization of DNA fragments containing N4-methylcytosine and 5-methylcytosine.

The synthesis of N4-methyl-2'-deoxycytidine and its fully protected mononucleotide, suitable for the oligonucleotide synthesis by phosphotriester method is described. A set of octanucleotides - d(CGCGCGCG), d(CG5mCGCGCG), d(CG4mCGCGCG) and dodecanucleotides - d(GGACCCGGGTCC), d(GGA5mCCCGGGTCC), d(GGA4mCCCGGGTCC) has been synthesized in a solution. Physical characterization of the oligonucleotide duplexes by means of UV and CD spectrometry provides the evidence that 4mC similarly to 5mC favours the B--greater than Z transition, although both of these methylated cytosines inhibit the B--greater than A conformational change. N4-Methylcytosine in contrast to 5-methylcytosine reduces the DNA double helix thermal stability.     

Rapid synthesis of oligodeoxyribonucleotides: a new solid-phase method.

A method is described that makes use of a new polyamide resin for the rapid synthesis of short oligodeoxyribonucleotides. The method is illustrated by the preparation of two heptadeoxyribonucleotides, d(pT6-C) and d(pC-A-G-T-G-A-T) using a phosphodiester approach. A further development involved use of phenyl isocyanate as an in situ drying agent, which obviated the need for solvent co-evaporation prior tothe internucleotidic coupling steps. Improved fractionation of thymidyl oligonucleotides was obtained by use of a new microparticulate, silica-based anion-exchanger.     

Studies on gene control regions. 1. Chemical synthesis of lactose operator deoxyribonucleic acid segments.

The chemical synthesis of lactose operator DNA segments is described. The 31-base-paired duplex contains the DNA recognized by lac repressor protein and twofold rotationally symmetric base pairs on either side of the tight binding region. The synthesis includes the deoxyoligonucleotides d(T-G-T-G-G), d(A-A-T-T-G-T-G-A-G), d(C-G-G-A-T-A-A-C-A-A-T-T), d(T-C-A-C-A), d(T-G-T-G-A-A-A-T-T-G-T), d(T-A-T-C-C-G-C-T-C-A-C), and d(A-A-T-T-C-C-A-C-A). These deoxyoligonucleotides were characterized by two-dimensional sequencing techniques, paper chromatography, and thin-layer chromatography.     

Bacterial cell wall synthesis: new insights from localization studies.

In order to maintain shape and withstand intracellular pressure, most bacteria are surrounded by a cell wall that consists mainly of the cross-linked polymer peptidoglycan (PG). The importance of PG for the maintenance of bacterial cell shape is underscored by the fact that, for various bacteria, several mutations affecting PG synthesis are associated with cell shape defects. In recent years, the application of fluorescence microscopy to the field of PG synthesis has led to an enormous increase in data on the relationship between cell wall synthesis and bacterial cell shape. First, a novel staining method enabled the visualization of PG precursor incorporation in live cells. Second, penicillin-binding proteins (PBPs), which mediate the final stages of PG synthesis, have been localized in various model organisms by means of immunofluorescence microscopy or green fluorescent protein fusions. In this review, we integrate the knowledge on the last stages of PG synthesis obtained in previous studies with the new data available on localization of PG synthesis and PBPs, in both rod-shaped and coccoid cells. We discuss a model in which, at least for a subset of PBPs, the presence of substrate is a major factor in determining PBP localization.     

Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.

Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.     

Large scale chemical synthesis, purification and crystallization of RNA-DNA chimeras.

RNA-DNA chimeras, in which both DNA and RNA monomers are site-specifically substituted in the same strand, may be prepared only by chemical synthesis. Biochemical studies have revealed a number of surprising and subtle effects resulting from the insertion of either a ribonucleotide into a DNA strand or a deoxyribonucleotide into an RNA strand. The availability of large quantities of these chimeras allows for their crystallization and subsequent x-ray structure determination. We describe a flexible and efficient method for the large-scale preparation of these compounds, their purification, and their crystallization. The methodology is based on a combination of existing DNA phosphoramidite synthons and those recently introduced for the preparation of biochemically active RNA1. We demonstrate that these two different synthons are compatible, produce large quantities of nucleic acid needed for physical studies, and that high resolution diffraction quality crystals may be grown from these chimeras. Of the duplex chimeras synthesized and crystallized, [r(G)d(CGTATACGC)]2, [d(GCGT)r(A)d(TACGC)]2 and [r(GCG)d(TATACCC) + d(GGGTATACGC)] form A-helices and d(CG)r(CG)d(CG)]2 forms a left-handed Z-helix.     

Chemical synthesis and sequence studies of deoxyribooligonucleotides which constitute the duplex sequence of the lactose operator of Escherichia coli.

We have synthesized the deoxyribooligonucleotide fragments, constituting the sequence of the lac operator of Escherichia coli. Two of these fragments, d(pApApTpTpGpTpTpApT) (nonamer) and d(pApApTpTpGpTpGpApG) (nonamer), corresponding to the 5' termini of lac operator have been synthesized by the phosphodiester method. The remaining four fragments, d(ApCpApApTpT) (hexamer), d(ApTpApApCpApApTpT) (nonamer), d(ApApTpTpGpTpGpApGpCpGpG) (dodecamer), and d(ApApTpTpGpTpTpApTpCpCpGpCpTpC) (pentadecamer), have been synthesized by an improved phosphotriester method. All of the compounds were first characterized by venom and spleen phosphodiesterase digestion to obtain their base composition. The sequence of these oligonucleotides was fully confirmed by the characteristic mobility shifts of their partial venom phosphodiesterase digestion products on two-dimensional homochromatography. A comparative study of the two methods for the synthesis of oligonucleotides has revealed that the phosphotriester method is more convenient than the phosphodiester method because of higher yields and ease of handling large scale preparations.     

Oligonucleotide labeling methods. 3. Direct labeling of oligonucleotides employing a novel, non-nucleosidic, 2-aminobutyl-1,3-propanediol backbone.

Novel CE-phosphoramidite (7a-e) and CPG (8a, c, d, e) reagents have been prepared from a unique 2-aminobutyl-1,3-propanediol backbone. The reagents have been used to directly label oligonucleotides with fluorescein, acridine, and biotin via automated DNA synthesis. The versatile 2-aminobutyl-1,3-propanediol backbone allows for labeling at any position (5', internal, and 3') during solid phase oligonucleotide synthesis. Multiple labels can be achieved by repetitive coupling cycles. Furthermore, the 3-carbon atom internucleotide phosphate distance is retained when inserted internally. Using this method, individual oligonucleotides possessing two and three different reporter molecules have been prepared.     

Glutamine synthetase in cultured whole retinas from the embryonic chick. Role of protein and RNA syntheses in 4 degrees C storage enhancement

Glutamine synthetase (GS) activity is enhanced in cultured whole retinas when a 72 h incubation at 37 degrees C is preceded by storage at 4 degrees C for 2-24 h. This enhancement occurs even in the absence of glucocorticoids and is maximal in retinas from 11 to 14 d embryos. In comparison, cortisol-induced increases in retinal GS activity at 37 degrees C are optimal in retinas from 8 to 12 d embryos. This study, using cycloheximide (an inhibitor of protein synthesis) and cordycepin (an inhibitor of RNA synthesis), indicates that both protein and RNA synthesis are required for the 4 degrees C storage enhancement of GS activity. The necessary RNA synthesis occurs within the first 48 h following transfer to 37 degrees C and does not require concomitant protein synthesis. Uridine uptake, but not incorporation into trichloroacetic acid-precipitable material, is increased by initial 4 degrees C storage when compared with whole retina controls incubated at 37 degrees C for the total time. In contrast, both uptake and incorporation of amino acids are increased in 4 degrees C-stored retinas for as long as 72 h subsequent to transfer from 4 to 37 degrees C. This suggests that enhancement GS activity may arise from a combination of elevated general protein synthesis and specific messenger-RNA synthesis following 4 degrees C storage.     

Pyrimidine nucleotide and nucleic acid synthesis in human monocytes and macrophages.

In most cell types, the production of deoxynucleotides is tightly coupled to the pace of cell division, and nearly all deoxynucleotides are used for semiconservative DNA synthesis. The capacity of peripheral blood monocytes and macrophages to proliferate is controversial. However, these cells have been reported to produce and release thymidine, which can serve as a precursor or regulator of DNA synthesis by lymphocytes and other cells. To determine to what extent de novo pyrimidine nucleotide synthesis is linked to cell division in peripheral blood monocytes and macrophages, compared to human U937 promonocytes and CEM lymphoblasts, we used a precise precursor-product labeling method. The results showed that in all three cell types, the pace of pyrimidine deoxynucleotide production, and of thymidylate synthesis, was in proportion to the rate of DNA synthesis. The human blood monocytes and macrophages, in contrast to U937 cells, had extraordinarily low deoxyribonucleotide pools (less than 1 pmol/10(6) cells) and synthesized neither thymidylate nor DNA de novo during 7 days culture. Colony-stimulating factors augmented RNA synthesis in monocyte-derived macrophages, and enhanced cell survival, without inducing either DNA or thymidylate synthesis. We conclude that the thymidine released by macrophages derives from dead or dying cells, and not from de novo synthesis.     

Pre-activation strategy for oligodeoxyribonucleotide synthesis using triaryloxydichlorophosphoranes in the phosphotriester method.

Triaryloxydichlorophosphoranes were tested as condensing agents for oligodeoxyribonucleotide synthesis in the phosphotriester method. Tris(2,4,6-tribromophenoxy)dichlorophosphorane (BDCP) was found to be a relatively stable crystalline material which could be used as a chemical reagent. A notable feature of the BDCP-promoted condensation reaction was studied by 31P-NMR. A small amount of BDCP compared to the conventional condensing agent was effective for the generation of active nucleotide intermediates and BDCP itself was quantitatively converted into an inert material, tris(2,4,6-tribromophenyl)phosphate (2). Thus, BDCP enabled us to separate the activation step from the condensation process in the phosphotriester method. This preactivation method was applied to the solid-phase synthesis.     

Synthesis of the enzymes of the mandelate pathway by Pseudomonas putida. I. Synthesis of enzymes by the wild type

Hegeman, G. D. (University of California, Berkeley). Synthesis of the enzymes of the mandelate pathway by Pseudomonas putida. I. Synthesis of enzymes by the wild type. J. Bacteriol. 91:1140-1154. 1966.-The control of synthesis of the five enzymes responsible for the conversion of d(-)-mandelate to benzoate by Pseudomonas putida was investigated. The first three compounds occurring in the pathway, d(-)-mandelate, l(+)-mandelate, and benzoylformate, are equipotent inducers of all five enzymes. A nonmetabolizable inducer, phenoxyacetate, also induces synthesis of these enzymes; but, unlike the metabolizable inducer-substrates, it does not elicit synthesis of enzymes that mediate steps in the pathway beyond benzoate. Under conditions of semigratuity, dl-mandelate elicits immediate synthesis at a steady rate of the first two enzymes of the pathway, but two enzymes which act below the level of benzoate are synthesized only after a considerable lag. Succinate and asparagine do not significantly repress the synthesis of the enzymes responsible for mandelate oxidation.     

Synthesis of cytoplasmic membrane during growth and division of Escherichia coli. Dispersive behaviour of respiratory nitrate reductase.

We have used the penicillin selection method of Autissier & Kepes [(1972) Biochimie 54, 93--101] to study the segregation of membrane-bound respiratory nitrate reductase (EC 1.9.6.1) in Escherichia coli for the three generations after cessation of nitrate reductase synthesis caused by withdrawal of nitrate from the growth medium. We also included a physical separation procedure that permitted direct assay for nitrate reductase activity among all fractions produced by the penicillin selection method. We conclude that the segregation of nitrate reductase after cell division is dispersive, and not semi-conservative as proposed by Autissier & Kepes (1972).     

Synthesis and characterization of an octanucleotide containing the EcoRI recognition sequence with a phosphorothioate group at the cleavage site

The synthesis and characterization of an octanucleotide, d(GGsAATTCC), containing the recognition sequence of the EcoRI restriction endonuclease with a phosphorothioate internucleotidic linkage at the cleavage site are described. Two approaches for the synthesis of the RP and SP diastereomers of this octamer by the phosphite method are presented. The first consists of the addition of sulfur instead of H2O to the phosphite at the appropriate position during chain elongation. This method results in a mixture of diastereomers that can be separated by high-performance liquid chromatography after 5'-terminal phosphorylation. The second uses the presynthesized and diastereomerically pure dinucleoside phosphorothioate d[Gp(S)A] for the addition to the growing oligonucleotide chain as a block. The products are characterized by digestion with nuclease P1, fast atom bombardment mass spectrometry, 31P NMR spectroscopy, and conversion to d(GGAATTCC) by desulfurization with iodine. Only the RP diastereomers of d(GGsAATTCC) and its 5'-phosphorylated derivative are cleaved by EcoRI endonuclease. The rate of hydrolysis is slower than that of the unmodified octamer. The phosphorothioate octamer will be useful for the determination of the stereochemical course of the EcoRI-catalyzed reaction.     

DNA and protein synthesis in cultured lens epithelial cells. II. Activity of synthetic effectors]

Cultivated bovine lens epithelium cells are highly susceptible to inhibitors of DNA-, RNA- and protein synthesis. The strict correlation between inhibition by puromycin of protein and DNA synthesis suggests that, in the cell system investigated, protein synthesis is essential for DNA synthesis to occur. Studies with actinomycin D have shown that in cultivated lens epithelium cells, part of protein synthesis is accomplished through a relatively long-lived mRNA. In long-term cultivation experiments, no further stabilization of mRNA, which is typical of lens fibre cells, could be demonstrated. There are indications that high doses of actinomycin D produce direct inhibition of DNA synthesis. By means of cytosine arabinoside a linear relationship was established between concentration of the effector and inhibition of DNA synthesis. Protein synthesis remains virtually unaffected even after high doses. The strong inhibition of DNA synthesis with protein synthesis continuing ("unbalanced growth") could not be utilized for the synchronization of lens epithelium cells, because it was only partly reversible after changing the medium and applying deoxycytidine.     

Construction of a single-transposon-insertion mutant in Rhizobium sp. strain TAL1145 from a double-insertion mutant

A method for developing a single-transposon-insertion mutant from a double-insertion mutant in Rhizobium is described. An exopolysaccharide (EPS)-defective mutant containing two Tn 5-lacZ insertions was complemented with cloned wild-type DNA for EPS synthesis. One of the Tn 5-lacZ insertions from the mutant was transferred to the complementing plasmid by homologous recombination. The plasmid containing the Tn 5-lacZ insertion in the gene involved in EPS synthesis was transferred into the wild-type strain and the Tn 5-lacZ was homogenized to obtain an EPS-defective mutant with a single Tn 5-lacZ insertion.     

Studies with hydroxyurea. II. Prolonged exposure of Escherichia coli to hydroxyurea

Rosenkranz, Herbert S. (Columbia University, New York, N.Y.), and Howard S. Carr. Studies with hydroxyurea. II. Prolonged exposure of Escherichia coli to hydroxyurea. J. Bacteriol. 92:178-185. 1966.-Concurrent with an inhibition of the synthesis of deoxyribonucleic acid, hydroxyurea devitalized Escherichia coli when exposure to the drug was prolonged to more than 3 hr. Active protein synthesis, but not ribonucleic acid (RNA) production, was a prerequisite for this lethal action. These findings are contrasted to thymineless death, which requires RNA synthesis.     

Amino acid transport in placental slices. Mechanism of increased accumulation by prolonged incubation.

The accumulation of alpha-aminoisobutyric acid by placental slices is increased dramatically upon prior incubation of the slices in amino acid-free, buffered saline. This increase is inhibited by inhibitors of protein synthesis and is accompanied by an increased V for the transport process. While alternative explanations are discussed, these data suggest that the incubation effect may be mediated through an increase in the number of available transport sites which are synthesized during the incubation period. Incubation with an amino acid mixture diminishes the increase as well as general protein synthesis, suggesting that a reduced availability of amino acids may initiate compensatory changes in the synthesis of cellular transport proteins.