Chloroplastic and cytoplasmic valyl- and leucyl-tRNA synthetases from Euglena gracilis. Comparative study of their structural properties

Chloroplastic and cytoplasmic valyl- and leucyl-tRNA synthetases purified from Euglena gracilis show a monomeric structure. The molecular weights of the two valyl-tRNA synthetases are identical (126,000) while those of the leucyl-tRNA synthetases are different (100 000 for the chloroplastic and 116 000 for the cytoplasmic enzyme). The tryptic maps and the amino acid compositions reveal differences between the chloroplastic valyl- and leucyl-tRNA synthetases and their cytoplasmic homologues. These results suggest that a chloroplastic aminoacyl-tRNA synthetase and its cytoplasmic counterpart are coded for by distinct genes.     

Euglena gracilis chloroplast transfer RNA transcription units. Nucleotide sequence analysis of a tRNAThr-tRNAGly-tRNAMet-tRNASer-tRNAGln gene cluster

The arrangement and the nucleotide sequence of the tRNA genes in the 2.0-kilobase-pair EcoRI restriction fragment EcoQ of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA have been determined. This fragment, cloned in pBR325 to form the plasmid pEZC300, contains five tRNA genes. The DNA insert of this plasmid, a known tRNA gene locus (Orozco, E.M., Jr., and Hallick, R.B. (1982) J. Biol. Chem. 257, 3258-3264) has been mapped by Southern gel analysis using a 32P-labeled oligodeoxynucleotide tRNA gene probe. The DNA sequence of 870 base pairs (bp) from EcoQ containing the entire tRNA gene locus was determined. The organization of this tRNA gene cluster on the E. gracilis chloroplast chromosome is tRNAUUGGln-14-BP spacer-RNAGCUSer-175-bp spacer-tRNACAUMet-12-bp spacer-tRNAGCCGly-5-bp spacer-tRNAUGUThr. The tRNAUUGGln and tRNAGCUSer gene sequences are of the opposite polarity as the other three gene sequences, but of the same polarity as the rRNA genes. The tRNAMet gene is a putative initiator tRNA. The five tRNA genes are separated and flanked by A-T-rich spacer sequences. This gene arrangement is consistent with the model that E. gracilis chloroplast tRNA genes are transcribed into multicistronic tRNA precursors. The DNA sequences have been used to deduce the primary and secondary structures of the tRNAs.     

Actin Gene Sequence from Euglena gracilis

ABSTRACT The full length coding sequence of the Euglena gracilis actin gene was determined by RT-PCR of Euglena gracilis mRNA. Conserved regions in the actin amino acid sequence were used as guides for the synthesis of degenerate primers. Sequence was obtained for 1.238 nucleotides, of which 1.131 were coding for 377 amino acids. Sequence comparisons showed a similarity with other actins of 56% to 80%. Even though most of the actin amino acid sequence was conserved, some regions showed high divergence, i.e. the DNase I-binding loop at the N-terminal region. The construction of a phylogenetic tree based on actin sequences from different organisms placed Euglena gracilis in a cluster with Trypanosoma brucei and Leishmania major.     

Comparative base compositions of chloroplast and cytoplasmic tRNAPhe''s from Euglena gracilis.

The nucleoside compositions of chloroplast and cytoplasmic tRNAPhe's from Euglena gracilis have been determined. The modified nucleoside compositions of these two tRNAs indicate that tRNAPheChl is more similar to procaryotic (E. coli) tRNAPhe than to either the Euglena cytoplasmic tRNAPhe or other eucaryotic cytoplasmic tRNAPhe's.     

Nucleotide sequence of a Euglena gracilis chloroplast gene coding for the 16S rRNA: homologies to E. coli and Zea mays chloroplast 16S rRNA

The nucleotide sequence of 16S rDNA from Euglena gracilis chloroplasts has been determined representing the first complete sequence of an algal chloroplast rRNA gene. The structural part of the 16S rRNA gene has 1491 nucleotides according to a comparative analysis of our sequencing results with the published 5'- and 3'-terminal "T1-oligonucleotides" from 16S rRNA from E. gracilis. Alignment with 16S rDNA from Zea mays chloroplasts and E. coli reveals 80 to 72% sequence homology, respectively. Two deletions of 9 and 23 nucleotides are found which are identical in size and position with deletions observed in 16S rDNA of maize and tobacco chloroplasts and which seem to be characteristic for all chloroplast rRNA species. We also find insertions and deletions in E. gracilis not seen in 16S rDNA of higher plant chloroplasts. The 16S rRNA sequence of E. gracilis chloroplasts can be folded by base pairing according to the general 16S rRNA secondary structure model.     

Evidence for the late origin of introns in chloroplast genes from an evolutionary analysis of the genus Euglena.

The origin of present day introns is a subject of spirited debate. Any intron evolution theory must account for not only nuclear spliceosomal introns but also their antecedents. The evolution of group II introns is fundamental to this debate, since group II introns are the proposed progenitors of nuclear spliceosomal introns and are found in ancient genes from modern organisms. We have studied the evolution of chloroplast introns and twintrons (introns within introns) in the genus Euglena. Our hypothesis is that Euglena chloroplast introns arose late in the evolution of this lineage and that twintrons were formed by the insertion of one or more introns into existing introns. In the present study we find that 22 out of 26 introns surveyed in six different photosynthesis-related genes from the plastid DNA of Euglena gracilis are not present in one or more basally branching Euglena spp. These results are supportive of a late origin for Euglena chloroplast group II introns. The psbT gene in Euglena viridis, a basally branching Euglena species, contains a single intron in the identical position to a psbT twintron from E.gracilis, a derived species. The E.viridis intron, when compared with 99 other Euglena group II introns, is most similar to the external intron of the E.gracilis psbT twintron. Based on these data, the addition of introns to the ancestral psbT intron in the common ancester of E.viridis and E.gracilis gave rise to the psbT twintron in E.gracilis.     

An Ultrastructural Comparison of Euglena gracilis Klebs, Bleached Euglena and Astasia longa Pringsheim

SYNOPSIS. Some of the cytologic features of Euglena gracilis Klebs, Euglena gracilis var. bacillaris Gross (colorless), and Astasia longa Pringsheim were compared in an electron-microscope study. E. gracilis was readily differentiated from the colorless forms by the presence of chloroplasts. The 2 colorless forms were structurally similar; however, it was possible to differentiate bleached Euglena from Astasia longa by the presence of irregular plate-like aggregates of paramylum in the former; similar forms of paramylum were not seen in chloroplast-containing E. gracilis or in A. longa .     

Activity of Euglena gracilis chloroplast ribosomes with procaryotic and eucaryotic initiation factors

A method that permits the preparation of Euglena gracilis chloroplast 30 S ribosomal subunits that are largely free of endogenous initiation factors and that are active in the binding of fMet-tRNA in response to poly(A, U, G), has been developed. These 30 S subunits have been tested for activity in initiation complex formation with initiation factors from both procaryotes and eucaryotes. We have observed that Escherichia coli IF-2 binds fMet-tRNA nearly as well to Euglena chloroplast ribosomal subunits as it does to its homologous subunits. Neither wheat germ eIF-2 nor Euglena eIF-2A can bind fMet-tRNA efficiently to Euglena chloroplast or E. coli 30 S subunits although both are active with wheat germ 40 S ribosomal subunits. Euglena chloroplast 68 S ribosomes will also bind the initiator tRNA. Both E. coli IF-2 and E. coli IF-3 stimulate this reaction on chloroplast ribosomes with approximately the same efficiency as they do on their homologous ribosomes. E. coli IF-1 enhances the binding of fMet-tRNA to the chloroplast 68 S ribosomes when either IF-2 or IF-3 is limiting. The chloroplast ribosomes unlike E. coli ribosomes show considerable activity over a broad range of Mg2+ ion concentrations.     

Nucleotides that contribute to the identity of Escherichia coli tRNA(Phe)

A series of sequence variants of amber suppressor genes of tRNA(Phe) were synthesized in vitro and cloned in Escherichia coli to examine the contributions of individual nucleotides to identity for amino acid acceptance. Three different but complementary types of tRNA variants were constructed. The first involved the substitution of base-pairs on the cloverleaf stem regions of the E. coli tRNA(Phe). The second type of variant involved total gene synthesis based on wild-type tRNA(Phe) sequences found in Bacillus subtilis and in Halobacterium volcanii. In the third type of variant, the identity of E. coli tRNALys was changed to that of tRNA(Phe). The nucleotides which are important for tRNA(Phe) identity in E. coli are located on the corner of the L-shaped tRNA molecule, where the dihydrouridine loop interacts with the T loop, and extend to the interior opening of the anticodon stem and the adjoining variable loop. The nucleotide sequence on the dihydrouridine stem region, which joins the corner and stem regions, was not successfully studied though it may contribute to tRNA(Phe) identity. The fourth nucleotide from the 3' end of tRNA(Phe) has some importance for identity.     

Purification and characterization of the mitochondrial translocase from Euglena gracilis

The Euglena gracilis mitochondrial protein biosynthetic elongation factor G (EF-Gmt) has been purified in four steps to greater than 50% homogeneity by use of a fusidic acid affinity procedure and conventional chromatographic techniques. The purification scheme results in 1100-fold purification with about 3% recovery of the total EF-G activity present in the postribosomal supernatant prepared from whole cell extracts. E. gracilis EF-Gmt has an approximate molecular weight of 76,000, comparable to that observed for procaryotic translocases. As is the case for other translocases which have been examined, pretreatment of E. gracilis EF-Gmt with N-ethylmaleimide results in a loss of polymerization activity, indicating a role for an essential cysteine residue in catalytic activity. GDP partially protects EF-Gmt from N-ethylmaleimide inactivation. E. gracilis EF-Gmt functions well on both Escherichia coli and E. gracilis chloroplast ribosomes, but has negligible activity on wheat germ cytoplasmic ribosomes. In this respect, it differs significantly from the mitochondrial translocase of yeast which has very little activity on chloroplast ribosomes. When assayed on E. coli ribosomes, E. gracilis EF-Gmt is sensitive to the steroid antibiotic, fusidic acid, at levels similar to that required for inactivation of E. coli EF-G. It is less sensitive than E. gracilis chloroplast EF-G, and is more sensitive than Bacillus subtilis EF-G. When assayed on E. gracilis chloroplast ribosomes, the same trends in sensitivities are observed, although the exact level of fusidic acid required for inactivation is slightly altered.     

The nucleotide sequence of phenylalanine tRNA from the cytoplasm of Neurospora crassa.

The phenylalanine tRNA from the cytoplasm of Neurospora crassa has been purified and sequenced. The sequence is: pGCGGGUUUAm2GCUCA (N) GDDGGGAGAGCm22GpsiCAGACmUGmAAYApsim5CUGAAGm7GDm5CGUGUGTpsiCGm1AUCCACACAAACCGCACCAOH. Both in the nature of modified nucleotides which are present in this tRNA and in the overall sequence, this tRNA resembles more closely phenylalanine tRNAs of eukaryotic cytoplasm than those of prokaryotes. The sequence of this tRNA differs from those of the corresponding tRNAs of wheat germ and yeast by only 6 and 7 nucleotides respectively out of 76 nucleotides.U     

Role of Low-Molecular-Weight Substrates in Functional Binding of the tRNAPhe Acceptor End by Phenylalanyl-tRNA Synthetase

The functional roles of phenylalanine and ATP in productive binding of the tRNA(Phe) acceptor end have been studied by photoaffinity labeling (cross-linking) of T. thermophilus phenylalanyl-tRNA synthetase (PheRS) with tRNA(Phe) analogs containing the s(4)U residue in different positions of the 3'-terminal single-stranded sequence. Human and E. coli tRNA(Phe)s used as basic structures differ by efficiency of the binding and aminoacylation with the enzyme under study. Destabilization of the complex with human tRNA(Phe) caused by replacement of three recognition elements decreases selectivity of labeling of the alpha- and beta-subunits responsible for the binding of adjacent nucleotides of the CCA-end. Phenylalanine affects the positioning of the base and ribose moieties of the 76th nucleotide, and the recorded effects do not depend on structural differences between bacterial and eukaryotic tRNA(Phe)s. Both in the absence and presence of phenylalanine, ATP more effectively inhibits the PheRS labeling with the s(4)U76-substituted analog of human tRNA(Phe) (tRNA(Phe)-s(4)U76) than with E. coli tRNA(Phe)-s(4)U76: in the first case the labeling of the alpha-subunits is inhibited more effectively; the labeling of the beta-subunits is inhibited in the first case and increased in the second case. The findings analyzed with respect to available structural data on the enzyme complexes with individual substrates suggest that the binding of phenylalanine induces a local rearrangement in the active site and directly controls positioning of the tRNA(Phe) 3'-terminal nucleotide. The effect of ATP on the acceptor end positioning is caused by global structural changes in the complex, which modulate the conformation of the acceptor arm. The rearrangement of the acceptor end induced by small substrates results in reorientation of the 3'-OH-group of the terminal ribose from the catalytic subunit onto the noncatalytic one, and this may explain the unusual stereospecificity of aminoacylation in this system.     

Chloroplastic and cytoplasmic valyl- and leucyl- tRNA synthetases from Euglena gracilis: Comparative study of their structural properties

Chloroplastic and cytoplasmic valyl- and leucyl-tRNA synthetases purified from Euglena gracilis show a monomeric structure. The molecular weights of the two valyl-tRNA synthetases are identical (126 000) while those of the leucyl-tRNA synthetases are different (100 000 for the chloroplastic and 116 000 for the cytoplasmic enzyme). The tryptic maps and the amino acid compositions reveal differences between the chloroplastic valyl- and leucyl-tRNA synthetases and their cytoplasmic homologues. These results suggest that a chloroplastic aminoacyl-tRNA synthetase and its cytoplasmic counterpart are coded for by distinct genes.     

L-myo-lnositol 1-Phosphate Synthase from Plant Sources (Characteristics of the Chloroplastic and Cytosolic Enzymes)

L-myo-inositol 1-phosphate synthase (EC 5.5.1.4) from cyanobacterial (Spirulina platensis), algal (Euglena gracilis), and higher plant (Oryza sativa, Vigna radiata) sources was purified to electrophoretic homogeneity, biochemically characterized, and compared. Both chloroplastic and cytosolic forms of the enzyme were detected in E. gracilis, O. sativa, and V. radiata, whereas only the cytosolic form was detected in streptomycin-bleached or chloroplastic mutants of E. gracilis and in S. platensis. Both the chloroplastic and cytosolic forms from different sources could be purified following the same three-step chromatographic protocol. L-myo-inositol 1-phosphate synthases purified from these different sources do not differ significantly with respect to biochemical and kinetic parameters except for the molecular mass of the chloroplastic and cytosolic native holoenzymes, which appear to be homotetrameric and homotrimeric associations of their constituent subunits, respectively. Monovalent and divalent cations, sugar alcohols, and sugar phosphates are inhibitory to the enzyme activity. N-ethylmaleimide inhibition of synthase activity could be protected by the combined presence of the substrate glucose-6-phosphate and cofactor NAD+. Antibody raised against the cytosolic enzyme from E. gracilis immunoprecipitates and cross-reacts with both chloroplastic and cytosolic forms from the other sources studied.     

Euglena gracilis as source of the antioxidant vitamin E. Effects of culture conditions in the wild strain and in the natural mutant WZSL

The photosynthetic wild type and the spontaneous non-photosynthetic WZSL mutant of the unicellular flagellate Euglena gracilis were grown to investigate the influence of photoheterotrophic and heterotrophic conditions on α-tocopherol (vitamin E) content. HPLC analysis demonstrated a marked enhancement (almost 100%) of tocopherol content in the light in both strains, independent of the presence of chloroplasts. These findings indicate that the formation of vitamin E occurs inside both the mitochondrial and chloroplastic compartment, and that the correlation between light and vitamin E production is not linked to the existence of chlorophyll. This revised version was published online in August 2006 with corrections to the Cover Date.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Molecular cloning and nucleotide sequence of a cDNA encoding Euglena gracilis cytochrome c1

The amino acid sequence of the mature protein of Euglena gracilis cytochrome c1 was determined by sequencing of its cDNA. A cDNA expression library was constructed from Euglena poly(A)+ RNA in phage lambda gt11 and screened with an antiserum raised against cytochrome c1 polypeptide isolated from purified E. gracilis complex III. An isolated cDNA clone consisted of 872 base pairs and encoded the mature protein with 243 amino acids. The deduced amino acid sequence contained the unusual heme binding sequence-Phe-Ala-Pro-Cys-His- (Mukai, K. et al. (1989) Eur. J. Biochem. 178, 649-656) instead of the typical sequence,-Cys-X-Y-Cys-His-, commonly found in C-type cytochromes. Comparison of the sequence with those of several other cytochromes c1 revealed that Euglena cytochrome c1 conserved the residues probably ligating heme-iron, those supposed to interact with cytochrome c and regions anchoring the mitochondrial inner membrane.