The nucleotide sequence of spinach chloroplast tryptophan transfer RNA

Spinach chloroplast tRNATrp, purified by column chromatography and two-dimensional gel electrophoresis, has been sequenced using in vitro labeling techniques. The sequence is : pG-C-G-C-U-C-U-U-A-G-U-U-C-A-G-U-U-C-Gm-G-D-A-G-A-A-C-m2G-psi-G-G-G-psi-C-U-C-A-A*-A-A-C-C-C-G-A-U-G-N-C-G-U-A-G-G-T-psi-C-A-A-G-U-C-C-U-A-C-A-G-A-G-C-G-U-G -C-C-AOH. Like the E. coli suppressor tRNA psu+UGA which translates both the opal terminator codon U-G-A and the tryptophan codon U-G-G, spinach chloroplast tRNATrp has C-C-A as an anticodon and contains an A-U pair in the D-stem.     

The nucleotide sequence of the major glutamate transfer RNA from Schizosaccharomyces pombe.

The nucleotide sequence of glutamate tRNA1 from Schizosaccharomyces pombe was determined to be pU-C-C-G-U-U-G-U-m1G-G-U-C-C-A-A-C-G-G-C-D-A-G-G-A-U-U-C-G-U-C-G-C-U-U-U*-C-A-C-C-G-A-C-G-G-G-A-G-m5C-G-G-G-G-T-psi-C-G-A-C-U-C-C-C-C-G-C-A-A-C-G-G-A-G-C-C-AOH. The sequence differs markedly from that of S. cerevisiae tRNAGlu. S. pombe glutamate tRNA1 can be aminoacylated by the homologous glutaminyl-tRNA synthetase as well as by the corresponding enzyme from S. cerevisiae.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

The nucleotide sequence of the rat cytoplasmic beta-actin gene.

The nucleotide sequence of the rat beta-actin gene was determined. The gene codes for a protein identical to the bovine beta-actin. It has a large intron in the 5' untranslated region 6 nucleotides upstream from the initiator ATG, and 4 introns in the coding region at codons specifying amino acids 41/42, 121/122, 267, and 327/328. Unlike the skeletal muscle actin gene and many other actin genes, the beta-actin gene lacks the codon for Cys between the initiator ATG and the codon for the N-terminal amino acid of the mature protein. The usage of synonymous codons in the beta-actin gene is nonrandom, and is similar to that in the rat skeletal muscle and other vertebrate actin genes, but differs from the codon usage in yeast and soybean actin genes.     

The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4.

The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species alpha) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACA G. The nucleotide sequence was determined primarily by nearest-neighbor analysis of RNA synthesized in vitro using [alpha-32P]nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labeled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbor data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules.     

Nucleotide sequence of phenylalanine transfer RNA from Schizosaccharomyces pombe: implications for transfer RNA recognition by yeast phenylalanyl-tRNA synthetase.

The nucleotide sequence of Schizosaccharomyces pombe tRNAPhe was determined to be pG-U-C-G-C-A-A-U-G**-G*-U-G-psi-A-G-D-D-G-G-G-A-G-C-A-psi-G*-A-C-A-G-A-Cm-U-Gm-A-A-Y-A-psi-m5C-U-G-U-U-G-m7G-U*-C-A-U-C-G-G-T-psi-C-G-A-U-C-C-C-G-G-U-U-U-G-U-G-A-C-A-C-C-AOH. This sequence differs from that of S. cerevisiae tRNAPhe in 27 nucleotides. Saccharomyces cerevisiae phenylalanyl-tRNA synthetase aminoacylates both the homologous tRNAPhe and S. pombe t-NAPhe; the reactions have similar Km and Vmax values. However, the nucleotide sequence in the D stem is different in the two tRNAs. This region was proposed by Roe, B., et al. [(1973) Biochemistry 12, 4146--4154] to be the major recognition site for yeast phenylalanyl-tRNA synthetase, but the present results cast doubt on the validity of this hypothesis.     

The nucleotide sequence of phenylalanine tRNA from the cytoplasm of Neurospora crassa.

The phenylalanine tRNA from the cytoplasm of Neurospora crassa has been purified and sequenced. The sequence is: pGCGGGUUUAm2GCUCA (N) GDDGGGAGAGCm22GpsiCAGACmUGmAAYApsim5CUGAAGm7GDm5CGUGUGTpsiCGm1AUCCACACAAACCGCACCAOH. Both in the nature of modified nucleotides which are present in this tRNA and in the overall sequence, this tRNA resembles more closely phenylalanine tRNAs of eukaryotic cytoplasm than those of prokaryotes. The sequence of this tRNA differs from those of the corresponding tRNAs of wheat germ and yeast by only 6 and 7 nucleotides respectively out of 76 nucleotides.U     

The nucleotide sequence of the chick cytoplasmic beta-actin gene

The nucleotide sequence of the chick beta-actin gene was determined. The gene contains 5 introns; 4 interrupt the translated region at codons 41/42, 120/122, 267, 327/328 and a large intron occurs in the 5' untranslated region. The gene has a 97 nucleotide 5'-untranslated region and a 594 nucleotide 3'-untranslated region. A slight heterogeneity in the position of the poly A addition site exists; polyadenylation can occur at either of two positions two nucleotides apart. The gene codes for an mRNA of 1814 or 1816 nucleotides, excluding the poly(A) tail. In contrast to the chick skeletal muscle actin gene the beta-actin gene lacks the Cys codon between the initiator ATG and the codon for the N-terminal amino acid of the mature protein. In the 5' flanking DNA, 15 nucleotides downstream from the CCAAT sequence, is a tract of 25 nucleotides that is highly homologous to the sequence found in the same region of the rat beta-actin gene.     

Euglena gracilis chloroplast transfer RNA transcription units. Nucleotide sequence analysis of a tRNAThr-tRNAGly-tRNAMet-tRNASer-tRNAGln gene cluster

The arrangement and the nucleotide sequence of the tRNA genes in the 2.0-kilobase-pair EcoRI restriction fragment EcoQ of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA have been determined. This fragment, cloned in pBR325 to form the plasmid pEZC300, contains five tRNA genes. The DNA insert of this plasmid, a known tRNA gene locus (Orozco, E.M., Jr., and Hallick, R.B. (1982) J. Biol. Chem. 257, 3258-3264) has been mapped by Southern gel analysis using a 32P-labeled oligodeoxynucleotide tRNA gene probe. The DNA sequence of 870 base pairs (bp) from EcoQ containing the entire tRNA gene locus was determined. The organization of this tRNA gene cluster on the E. gracilis chloroplast chromosome is tRNAUUGGln-14-BP spacer-RNAGCUSer-175-bp spacer-tRNACAUMet-12-bp spacer-tRNAGCCGly-5-bp spacer-tRNAUGUThr. The tRNAUUGGln and tRNAGCUSer gene sequences are of the opposite polarity as the other three gene sequences, but of the same polarity as the rRNA genes. The tRNAMet gene is a putative initiator tRNA. The five tRNA genes are separated and flanked by A-T-rich spacer sequences. This gene arrangement is consistent with the model that E. gracilis chloroplast tRNA genes are transcribed into multicistronic tRNA precursors. The DNA sequences have been used to deduce the primary and secondary structures of the tRNAs.     

The nucleotide sequence of phenylalanine tRNA from Mycoplasma sp. (Kid)

The nucleotide sequence of Mycoplasma sp. (Kid) phenylalanine tRNA was determined to be pG-G-U-C-G-U-G-U-A-G-C-U-C-A-G-U-C-G-G-D-A-G-A-G-C-A-G-C- A-G-A-C-U-G-A-A-m(1)G-C-Psi-C-U-G-C-G-U-m(7)G-U-C-G-G-C-G-G-U-Psi-C-A-A-U-U-C-C-G-U-C-C-A-C-G-A-C-C-A-C-C-A(OH). It is characterized by the absence of ribothymidine and the presence of only few modified nucleotides.     

Euglena gracilis chloroplast transfer RNA transcription units. II. Nucleotide sequence analysis of a tRNAVal-tRNAAsn-tRNAArg-tRNALeu gene cluster

The tRNA-coding locus of the 8.2-kilobase pair (kbp) Eco RI fragments Eco G of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA was chosen for detailed analysis. Two recombinant plasmids, pPG14, containing Eco G and the vector pMB9, and pEZC23, containing the chloroplast DNA fragment HindIII B cloned in pBR322 were employed for the study. The tRNA locus was mapped to an 0.8-kbp region of Eco G also present in HindIII B. The DNA sequence of a 1.6 kbp from HindIII B, containing the entire tRNA gene locus was determined. Four tRNA genes were identified from the DNA sequence. The gene organization is tRNAVal-16 bp spacer-tRNAAsn-3 bp spacer-tRNAArg-45 bp spacer-tRNALeu. The tRNALeu gene is of the opposite polarity as the other three genes. This is the first evidence of such a tRNA cluster for a chloroplast genome. Also evident from the DNA sequence, 132 bp from the 5'-end of the tRNALeu gene, is a putative gene or pseudogene for a chloroplast protein.     

The nucleotide sequence of tobacco vein mottling virus RNA.

The nucleotide sequence of the RNA of tobacco vein mottling virus, a member of the potyvirus group, was determined. The RNA was found to be 9471 residues in length, excluding a 3'-terminal poly(A) tail. The first three AUG codons from the 5'-terminus were followed by in-frame termination codons. The fourth, at position 206, was the beginning of an open reading frame of 9015 residues which could encode a polyprotein of 340 kDa. No other long open reading frames were present in the sequence or its complement. This AUG was present in the sequence AGGCCAUG, which is similar to the consensus initiation sequence shared by most eukaryotic mRNAs. The chemically-determined amino acid compositions of the helper component and coat proteins were similar to those predicted from the nucleotide sequence. Amino acid sequencing of coat protein from which an amino-terminal peptide had been removed allowed exact location of the coat protein cistron. A consensus sequence of V-(R or K)-F-Q was found on the N-terminal sides of proposed cleavage sites for proteolytic processing of the polyprotein.