Identification and characterization of a novel sericin gene expressed in the anterior middle silk gland of the silkworm Bombyx mori

Sericin is a group of proteins expressed in the middle silk gland that covers the surface of fibroin in the cocoon filament of Bombyx mori. Sericin consists of several serine-rich proteins with different molecular masses. Sericin A is one of the proteins and is produced in the anterior portion of the middle silk gland. To identify the gene coding for the protein, we determined the primary structures of its partial peptides, and the gene was searched using the silkworm genomic databases. Three contigs containing the corresponding nucleotide sequences were identified and categorized as one group. The gene structure covering the 5' flanking and the 3' end was determined by PCR fragments from genomic DNA, RT-PCR, and 5' and 3' RACE. The amino acid sequence deduced from the nucleotide sequence mainly consists of two serine-rich regions of 86-amino acid motif and 8-amino acid repeated sequence. The expression of the gene is limited to the anterior and middle parts of the middle silk gland. In addition, because the sericin gene appeared different from the sericin 1 and 2 genes reported earlier, we designated the newly discovered gene as sericin 3.     

Cryoprotective effect of the serine-rich repetitive sequence in silk protein sericin

The silk proteins, fibroin and sericin, are produced in the silk gland of Bombyx mori, and hydrophilic sericin envelops fibroin with successive sticky layers in the formation of a cocoon. To study the biological functions of sericin, we focused on the serine-rich sericin peptide consisting of 38 amino acids, which is a highly conserved and internally repetitive sequence of a sericin protein. The corresponding gene was chemically synthesized, and the PCR-amplified gene was ligated to oligomerize sericin peptide and fused at the amino terminus to a His-tagged and proteolytic cleavage sequence in an inducible expression vector. When the dimers of sericin peptides were overexpressed in Escherichia coli, the transformants showed a prominent increase in cell viability after freezing in medium. Further, the purified dimeric sericin peptide from E. coli was found to be effective in protecting lactate dehydrogenase from denaturation caused by freeze-thaw. Both of these protective effects against freezing stress in cells and proteins were also observed with sericin hydrolysate. These results indicate that this unique sericin peptide, like sericin, has a high cryoprotective activity and will be valuable as a new biomaterial for industrial use.     

Structural analysis of repetitive DNA sequences in the bovine corticotropin-beta-lipotropin precursor gene region.

Repetitive DNA sequences in the bovine corticotropin-beta-lipotropin precursor gene region have been mapped and subjected to nucleotide sequence analysis. Two of the four repetitive DNA segments found are located in the 5'-flanking region, and one each within the intervening sequences. Each repetitive DNA segment contains one to three highly homologous unit sequences with an approximate length of 120 base pairs. All the unit sequences are flanked on the 3' side by tandem repeats. There are about 10(5) copies of the repetitive DNA in the bovine genome. Comparison of the bovine repetitive sequences with those of other mammalian species reveals the presence of a homologous segment of approximately 40 base pairs. This segment and the region preceding it in the bovine repetitive DNA exhibit sequence homology with the region encompassing the origin of DNA replication in papovaviruses.     

The DNA sequence of Bombyx mori fibroin gene including the 5' flanking, mRNA coding, entire intervening and fibroin protein coding regions.

Sequence analysis of the cloned genomic fibroin gene and cDNA containing the sequence complementary to fibroin mRNA has been carried out for the regions covering the 5′ flanking, mRNA coding, entire intervening sequence and its borders, and fibroin coding sequences. The sequences determined on the gene extend from nucleotide ?552 to +1497 (assigning +1 to the cap locus); sequence analysis of the cDNA has confirmed our previous mapping of the cap locus (Tsujimoto and Suzuki, 1979). Comparison of the nucleotide sequence of the genomic gene with that of cDNA has confirmed the existence of an intervening sequence 970 bases long. The sequence comparison also pinpointed the 5′ coding-intervening junction at +64?66 and the 3′ intervening-coding junction at +1034?1036. Both the 5′ and 3′ junctions of the fibroin gene (insect) share homologous segments of about 10 nucleotides each with the published sequences of β-globin (mammal), immunoglobulin (mammal) and ovalbumin (avian) genes. A long inverted repeat sequence (17 of 23 base match) has been found next to the junctions within the intervening sequence of the fibroin gene. The repetitious sequence that codes for the Gly-Ala peptide characteristic of fibroin protein begins at position +1448. The characteristics of the N terminal portion of fibroin protein (or its precursor) are discussed, as are the features of the 5′ flanking sequence of the gene and the mRNA sequence (with special attention to the putative promoter sequence for the gene), the possible secondary structure and a sequence complementary to the 3′ end of 18S ribosomal RNA at the 5′ proximal region of fibroin mRNA.     

Two drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F.

One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.     

DNA sequences complementary to human 7 SK RNA show structural similarities to the short mobile elements of the mammalian genome

A complementary DNA clone of 7 SK RNA from HeLa cells was used to study the genomic organization of 7 SK sequences in the human genome. Genomic hybridizations and genomic clones show that 7 SK is homologous to a family of disperse repeated sequences most of which lack the 3' end of the 7 SK RNA sequence. Only few of the genomic K sequences are homologous to both 3' and 5' 7 SK probes and presumably include the gene(s) for 7 SK RNA. The sequence of four genomic 7 SK clones confirms that they are in most cases pseudogenes. Although Alu sequences are frequently found near the 3' and 5' end of K DNA, the sequences immediately flanking the pseudogenes are different in all clones studied. However, direct repeats were found flanking directly the K DNA or the K-Alu unit, suggesting that the K sequences alone or in conjunction with Alu DNA might constitute a mobile element.     

Genomic divergence between human and chimpanzee estimated from large-scale alignments of genomic sequences

To study the genomic divergence between human and chimpanzee, large-scale genomic sequence alignments were performed. The genomic sequences of human and chimpanzee were first masked with the RepeatMasker and the repeats were excluded before alignments. The repeats were then reinserted into the alignments of nonrepetitive segments and entire sequences were aligned again. A total of 2.3 million base pairs (Mb) of genomic sequences, including repeats, were aligned and the average nucleotide divergence was estimated to be 1.22%. The Jukes-Cantor (JC) distances (nucleotide divergences) in nonrepetitive (1.44 Mb) and repetitive sequences (0.86 Mb) are 1.14% and 1.34%, respectively, suggesting a slightly higher average rate in repetitive sequences. Annotated coding and noncoding regions of homologous chimpanzee genes were also retrieved from GenBank and compared. The average synonymous and nonsynonymous divergences in 88 coding genes are 1.48% and 0.55%, respectively. The JC distances in intron, 5' flanking, 3' flanking, promoter, and pseudogene regions are 1.47%, 1.41%, 1.68%, 0.75%, and 1.39%, respectively. It is not clear why the genetic distances in most of these regions are somewhat higher than those in genomic sequences. One possible explanation is that some of the genes may be located in regions with higher mutation rates.     

Nucleotide sequence of the gene for human factor IX (antihemophilic factor B)

Two different human genomic DNA libraries were screened for the gene for blood coagulation factor IX by employing a cDNA for the human protein as a hybridization probe. Five overlapping lambda phages were identified that contained the gene for factor IX. The complete DNA sequence of about 38 kilobases for the gene and the adjacent 5' and 3' flanking regions was established by the dideoxy chain termination and chemical degradation methods. The gene contained about 33.5 kilobases of DNA, including seven introns and eight exons within the coding and 3' noncoding regions of the gene. The eight exons code for a prepro leader sequence and 415 amino acids that make up the mature protein circulating in plasma. The intervening sequences range in size from 188 to 9473 nucleotides and contain four Alu repetitive sequences, including one in intron A and three in intron F. A fifth Alu repetitive sequence was found immediately flanking the 3' end of the gene. A 50 base pair insert in intron A was found in a clone from one of the genomic libraries but was absent in clones from the other library. Intron A as well as the 3' noncoding region of the gene also contained alternating purine-pyrimidine sequences that provide potential left-handed helical DNA or Z-DNA structures for the gene. KpnI repetitive sequences were identified in intron D and the region flanking the 5' end of the gene. The 5' flanking region also contained a 1.9-kb HindIII subfamily repeat. The seven introns in the gene for factor IX were located in essentially the same position as the seven introns in the gene for human protein C, while the first three were found in positions identical with those in the gene for human prothrombin.