Epstein-Barr virus BZLF1 protein binds to mitotic chromosomes

Epstein-Barr virus (EBV) is a human herpesvirus that causes infectious mononucleosis and is associated with several types of cancers, including nasopharyngeal carcinoma and Burkitt's lymphoma. An EBV protein that plays an integral role during lytic replication is the immediate-early protein BZLF1. Our laboratory has found that BZLF1 (Z) localizes to host chromosomes during mitosis. Two Z-interacting proteins are also found localized to mitotic chromosomes in the presence of Z. The association between Z and mitotic chromosomes may lead to the sequestering of Z-interacting proteins within the cell and potentially cause an alteration of chromosome compaction or chromatin structure.     

Plasma cell-specific transcription factor XBP-1s binds to and transactivates the Epstein-Barr virus BZLF1 promoter

Epstein-Barr virus (EBV) in vivo is known to establish persistent infection in resting, circulating memory B cells and to productively replicate in plasma cells. Until now, the molecular mechanism of how EBV switches from latency to lytic replication in vivo was not known. Here, we report that the plasma cell differentiation factor, XBP-1s, activates the expression of the master regulator of EBV lytic activation, BZLF1. Using reporter assays, we observed that XBP-1s was able to transactivate the BZLF1 promoter, Zp, in a plasma cell line and other lymphoid cell lines but, interestingly, not in epithelial cell lines. We have identified an XBP-1s binding site on the ZID/ZII region of Zp, which when abolished by site-directed mutagenesis led to abrogation of XBP-1s binding and promoter activation. Using the chromatin immunoprecipitation assay, we observed direct binding of XBP-1s to endogenous Zp in an EBV-infected plasma cell line. Finally, in the same cell line, we observed that overexpression of XBP-1s resulted in increased expression of BZLF1, while knockdown of XBP-1s with short hairpin RNA drastically reduces BZLF1 expression. We suggest that EBV harnesses the B-cell terminal differentiation pathway via XBP-1s as a physiological signal to reactivate and begin viral replication. We are currently investigating other signals, such as the endoplasmic reticulum stress response proteins, which act upstream of XBP-1s, to identify other interacting factors that initiate and/or amplify the lytic switch.     

Epstein-Barr virus BZLF1 trans activator induces the promoter of a cellular cognate gene, c-fos.

The Epstein-Barr virus BZLF1 gene product ZEBRA is a DNA-binding protein that is partially homologous to c-Fos, binds specifically to AP-1 sites, and can induce the lytic cycle in latently infected B lymphocytes. Induction of the viral lytic cycle can also be achieved by treatment with the phorbol ester 12-O-tetrade-canoylphorbol-13-acetate, a reagent which activates gene expression in part through AP-1 (Jun/Fos). In this article the interrelationship between ZEBRA and AP-1 is extended by the demonstration that ZEBRA can induce c-Fos expression through AP-1 and "AP-1-like" sites present in the c-fos promoter. Induction of c-Fos may be necessary for the expression of other viral lytic genes and perhaps cellular genes whose products are required for viral replication.     

The Epstein-Barr virus BMLF1 promoter contains an enhancer element that is responsive to the BZLF1 and BRLF1 transactivators.

We have previously shown that the Epstein-Barr virus (EBV) immediate-early gene product, BZLF1, can activate expression of the EBV BMLF1 immediate-early promoter in EBV-positive, but not EBV-negative, B cells, suggesting that the BZLF1 effect may be mediated through another EBV gene product (S. Kenney, J. Kamine, E. Holley-Guthrie, J.-C. Lin, E.-C. Mar, and J. S. Pagano, J. Virol. 63:1729-1736, 1989). Here, we show that the EBV BRLF1 immediate-early gene product transactivates the BMLF1 promoter in either EBV-positive or EBV-negative B cells. Deletional analysis revealed that both the BZLF1-responsive region and the BRLF1-responsive region of the BMLF1 promoter are contained within the same 140-base-pair FokI-PvuII fragment located 300 base pairs upstream of the mRNA start site. This FokI-PvuII fragment functions as an enhancer element in the presence of the BRLF1 transactivator and contains the sequence CCGTGGAGA ATGTC, which is strikingly similar to the BRLF1-responsive region of the EBV DR/DL enhancer (A. Chevallier-Greco, H. Gruffat, E. Manet, A. Calender, and A. Sergeant, J. Virol. 63:615-623, 1989). The effect of BZLF1 on the BMLF1 promoter is likely to be indirect and mediated through the BRLF1 transactivator.     

Epstein-Barr virus recombinants with specifically mutated BCRF1 genes.

Epstein-Barr virus (EBV) recombinants with specifically mutated BCRF1 genes were constructed and compared with wild-type BCRF1 recombinants derived in parallel for the ability to initiate and maintain latent infection and growth transformation in primary human B lymphocytes. A stop codon insertion after codon 116 of the 170-codon BCRF1 open reading frame or deletion of the entire gene had no effect on latent infection, B-lymphocyte proliferation into long-term lymphoblastoid cell lines (LCLs), or virus replication. LCLs infected with the stop codon recombinant were indistinguishable from wild-type recombinant-infected LCLs in tumorigenicity in SCID mice. However, mutant BCRF1 recombinant-infected cells differed from wild-type recombinant-infected cells in their inability to block gamma interferon release in cultures of permissively infected LCLs incubated with autologous human peripheral blood mononuclear cells. This is the first functional assay for BCRF1 expression from the EBV genome. BCRF1 probably plays a key role in modulating the specific and nonspecific host responses to EBV infection.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

Differentiation-associated expression of the Epstein-Barr virus BZLF1 transactivator protein in oral hairy leukoplakia.

The BZLF1 protein of Epstein-Barr virus (EBV) is a key immediate-early protein which has been shown to disrupt virus latency in EBV-infected B cells. We have generated a monoclonal antibody, BZ1, to BZLF1 which reacts in immunohistology, immunoblotting, and immunoprecipitation and which recognizes both the active, dimeric form and the inactive, monomeric form of the protein. Biopsies of oral hairy leukoplakia, an AIDS-associated lesion characterized by high-level EBV replication, were examined by immunohistochemistry using the BZ1 monoclonal antibody. A differentiation-associated pattern of BZLF1 expression was observed, BZ1 reacting with nuclei of the upper spinous layer of the lesion. This finding suggests that the BZLF1 promoter may be regulated by the degree of squamous differentiation. A comparison of in situ hybridization to EBV DNA and viral capsid antigen staining with BZ1 reactivity suggested that BZLF1 expression precedes rampant virus replication. The inability to detect EBV in the lower epithelial layers of oral hairy leukoplakia raises questions concerning the nature of EBV latency and persistence in stratified squamous epithelium.     

Functional and physical interaction between p53 and BZLF1: implications for Epstein-Barr virus latency.

The p53 tumor suppressor protein, which is commonly mutated in human cancers, has been shown to interact directly with virally encoded from papillomavirus, adenovirus, and simian virus 40. The disruption of p53 function may be required for efficient replication of certain viruses and may also play a role in the development of virally induced malignancies. Infection with Epstein-Barr virus (EBV) has been associated with the development of B-cell lymphomas and nasopharyngeal carcinoma. Here we show that the EBV immediate-early protein, BZLF1 (Z), which is responsible for initiating the switch from latent to lytic infection, can interact directly in vitro and in vivo with the tumor suppressor protein, p53. This interaction requires the coiled-coil dimerization domain of the Z protein and the carboxy-terminal portion of p53. Overexpression of wild-type p53 inhibits the ability of Z to disrupt viral latency. Likewise, Z inhibits p53-dependent transactivation in lymphoid cells. The direct interaction between Z and p53 may play a role in regulating the switch from latent to lytic viral infection.