Molecular cloning, nucleotide sequence and expression of the tufB gene encoding elongation factor Tu from Thermus thermophilus HB8

The tufB gene encoding elongation factor Tu (EF-Tu) of Thermus thermophilus HB8 was cloned and expressed. Compared with the known tufA gene of T. thermophilus, nucleotide differences were found at 10 positions out of 1221 nucleotides, and amino acid substitutions were found at 4 positions out of 406 amino acids. The tufB product was 70.9% homologous to the corresponding sequence of the tufB product of E. coli. The G+C content of the third base of the codon in the tufB gene was 84.8% and G was especially preferred in this position.     

Molecular cloning and sequence determination of the tuf gene coding for the elongation factor Tu of Thermus thermophilus HB8

The tuf gene, which encodes the elongation factor Tu (EF-Tu) of Thermus thermophilus HB8, and its flanking regions were cloned and sequenced. The gene encoding EF-G was found upstream of the 5' end of the tuf gene. The tuf gene of T. thermophilus HB8 had a very high G + C content and 84.5% of the third base in codon usage was either G or C. The deduced primary structure of the EF-Tu was composed of 405 amino acid residues with a Mr = 44658. A comparison of the amino acid sequence of EF-Tu from T. thermophilus HB8 with those of Escherichia coli and Saccharomyces cerevisiae mitochondria showed a very high sequence homology (65-70%). Two Cys residues out of the three found in E. coli EF-Tu had been replaced with Val in T. thermophilus HB8 EF-Tu. An extra amino acid sequence of ten residues, consisting predominantly of basic amino acids (Met-182-Gly-191), which does not occur in EF-Tu of E. coli, was found in T. thermophilus HB8.     

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.     

Molecular multiplicity of nuclease TT1 from Thermus thermophilus HB8

Purified nuclease TT1 from Thermus thermophilus HB8 has multimolecular weight forms, each of which is composed of three different subunits, alpha (10.8 x 10(4)), beta (7.8 x 10(4)), and gamma (4.1 x 10(4)). The molecular weights of this enzyme were estimated by gel filtration, polyacrylamide gel electrophoresis and equilibrium sedimentation. It was found that most of the enzyme has a molecular weight of about 22 x 10(4) being a monomer having the subunit composition of alpha beta gamma. The remaining part of the enzyme has larger molecular weights and is considered to be size-isomers of alpha beta gamma. The alpha-helical content, 5.5--6.5%, and the beta-structure, about 28%, were estimated from the CD spectrum at 4 degrees C.     

Plasmid-associated aggregation in Thermus thermophilus HB8

Thermus thermophilus HB8, a moderate thermophile, exhibits visible aggregation when growing on a rich broth. Strain HB8 also contains two cryptic plasmids. We isolated cured strains from HB8 and observed that loss of the 47-MDa plasmid was correlated with loss of aggregation. An enrichment procedure was developed for aggregating cells and used to demonstrate that aggregation was restored upon transformation of a cured strain with plasmid DNA. The aggregation phenotype of transformed cells was variably stable; most did not retain either the plasmid or the phenotype for prolonged periods of growth. Hybridization experiments using a partial sequence from the 47-MDa plasmid suggested the presence of a repeated DNA sequence on this plasmid and on the chromosome. This is the first report of a phenotype associated with a plasmid from a Thermus strain.     

Amino acid sequence of cytochrome c-552 from Thermus thermophilus HB8

The complete amino acid sequence of thermophilic cytochrome c-552 from Thermus thermophilus HB8 is presented. The 131-residue sequence was derived by analysis of three cyanogen bromide fragments of the S-carboxymethylated apo-protein and their subpeptides. The sequence is homologous to c-type cytochromes, especially in the heme-binding region.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

Rapid and sensitive amino-acid sequencing of cloning Thermus thermophilus HB8 ferredoxin by proteomics

Recombinant holo Thermus thermophilus [7Fe-8S] ferredoxin was synthesized by cloning from Thermus thermophilus HB8 gene. A specific sequence (Pro-His-Val-Ile) at the N-terminus of the recombinant ferredoxin was determined by a rapid and highly sensitive mass spectral method using a novel Ru(II) Edman reagent, [(tpy)Ru(tpy-C6H4-NCS)](PF6)2 (tpy=terpyridine). The formation of the recombinant holoTtFd was established by the characteristic absorptions and CD extrema as [7Fe-8S] ferredoxin. The catalytic electron-transfer reactivity of the [7Fe-8S] ferredoxin between ferredoxin-NADP+ reductase and cytochrome c was recognized.     

Molecular cloning and sequence analysis of the lysR gene from the extremely thermophilic eubacterium, Thermus thermophilus HB27

We have isolated a lysine-auxotrophic and kanamycin-resistant mutant from an extreme thermophile, Thermus thermophilus HB27. This mutant showed the lysA⁻ or lysR⁻ genotype since it could not grow on the minimal plate which contained diaminopimelic acid. Sequence analysis of the clones which could rescue the Lys⁻ mutant indicated the lysR gene. The lysR gene overlapped with the rimK gene for the modification enzyme of ribosomal protein S6. In the Lys⁻ mutant, the lysR gene was disrupted and the C-terminus region of the RimK protein was different from that of the wild-type, which contributed to the Lys⁻ and kanamycin-resistant phenotype. The deduced amino acid sequence of the lysR gene showed 20.9% identity with the LysR protein of Escherichia coli. The percentage of use of cytosine or guanine in the third letter of the codons in the lysR gene was only 67.4%. We also determined that the argC gene encoding N-acetyl-γ-glutamyl phosphate reductase and the argB gene encoding acetylglutamate kinase were located immediately upstream of the lysR gene.     

Molecular cloning of the Lon protease gene from Thermus thermophilus HB8 and characterization of its gene product.

The gene encoding Lon protease was isolated from an extreme thermophile, Thermus thermophilus HB8. Sequence analysis demonstrated that the T. thermophilus Lon protease gene (TT-lon) contains a protein-coding sequence consisting of 2385 bp which is approximately 56% homologous to the Escherichia coli counterpart. As expected, the G/C content of TT-lon was 68%, which is significantly higher than that of the E. coli lon gene (52% G/C). The amino acid sequence of T. thermophilus Lon protease (TT-Lon) predicted from the nucleotide sequence contained several unique sequences conserved in other Lon proteases: (a) a cysteine residue at the position just before the putative ATP-binding domain; (b) motif A and B sequences required for composition of the ATP-binding domain; and (c) a serine residue at the proteolytic active site. Expression of TT-lon under the control of the T7 promoter in E. coli produced an 89-kDa protein with a yield of approximately 5 mg.L-1. Recombinant TT-Lon (rTT-Lon) was purified to homogeneity by sequential column chromatography. The peptidase activity of rTT-Lon was activated by ATP and alpha-casein. rTT-Lon cleaved succinyl-phenylalanyl-leucyl-phenylalanyl-methoxynaphthylamide much more efficiently than succinyl-alanyl-alanyl-phenylalanyl-methoxynaphthylamide, whereas both peptides were cleaved with comparable efficiencies by E. coli Lon. These results suggest that there is a difference between TT-Lon and E. coli Lon in substrate specificity. rTT-Lon most effectively cleaved substrate peptides at 70 degrees C, which was significantly higher than the optimal temperature (37 degrees C) for E. coli Lon. Together, these results indicate that the TT-lon gene isolated from T. thermophilus HB8 actually encodes an ATP-dependent thermostable protease Lon.     

Cloning and sequence of IS1000, a putative insertion sequence from Thermus thermophilus HB8

The complete nucleotide sequences of two copies of a putative insertion sequence IS1000 from Thermus thermophilus HB8 are presented. IS1000 is 1196 base pairs long, contains a long open reading frame which could code for a protein of 317 amino acids, and has imperfect terminal inverted repeats of 6 base pairs (confirmed by the terminal sequencing of 4.5 copies of IS1000), but does not cause a target site duplication. There are at least 6 copies of IS1000 in the genome of T. thermophilus HB8. A search of the GEN-EMBL data base revealed that the putative 317 amino acid protein had significant homology with open reading frames in the transposable elements IS110 of Streptomyces coelicolor and IS492 of Pseudomonas atlantica.     

Structure of peptidoglycan from Thermus thermophilus HB8.

The composition and structure of peptidoglycan (murein) extracted from the extreme thermophilic eubacterium Thermus thermophilus HB8 are presented. The structure of 29 muropeptides, accounting for more than 85% of total murein, is reported. The basic monomeric subunit consists of N-acetylglucosamine-N-acetylmuramic acid-L-Ala-D-Glu-L-Orn-D-Ala-D-Ala, acylated at the delta-NH2 group of Orn by a Gly-Gly dipeptide. In a significant proportion (about 23%) of total muropeptides, the N-terminal Gly is substituted by a residue of phenylacetic acid. This is the first time phenylacetic acid is described as a component of bacterial murein. Possible implications for murein physiology and biosynthesis are discussed. Murein cross-linking is mediated by D-Ala-Gly-Gly peptide cross-bridges. Glycan chains are apparently terminated by (1-->6) anhydro N-acetylmuramic acid residues. Neither reducing sugars nor murein-bound macromolecules were detected. Murein from T. thermophilus presents an intermediate complexity between those of gram-positive and gram-negative organisms. The murein composition and peptide cross-bridges of T. thermophilus are typical for a gram-positive bacterium. However, the murein content, degree of cross-linkage, and glycan chain length for T. thermophilus are closer to those for gram-negative organisms and could explain the gram-negative character of Thermus spp.     

Amino-acid sequence of a tetrameric, manganese superoxide dismutase from Thermus thermophilus HB8

The amino-acid sequence of a tetrameric manganese superoxide dismutase from Thermus thermophilus HB8 has been determined. The protein was cleaved with cyanogen bromide (BrCN) into four peptides and their alignment was deduced through the fragment of partial cleavage with BrCN and the peptides were produced by cleavage of the protein with o-iodosobenzoic acid. Most of the peptides were sequenced by solid phase Edman degradation. Some of the peptides were sequenced by the Edman dansyl method after sub-fragmentation by proteinase digestion. The amino-acid sequence consists of 203 residues corresponding to a subunit molecular weight of 23,144.     

Isolation and crystallization of phenylalanyl-tRNA-synthetase from Thermus thermophilus HB8

Method of isolation of phenylalanyl-tRNA synthetase from Thermus thermophilus HB8 is described, including chromatography on DEAE-sepharose, ammonium sulfate fractionation, hydrofobic chromatography on Toyopearl, gel filtration on ultrogel AcA-34, chromatography on phenylalanylaminohexyl-sepharose and heparine-sepharose. Yield of the purified enzyme was 10 mg from 1 kg of T. thermophilus cells. The enzyme is found to consist of two types of subunits with molecular masses 92 and 36 kDa and is likely to be a tetramer protein with molecular mass 250 kDa. Crystals of phenylalanyl-tRNA synthetase suitable for X-ray structural studies have been obtained.     

Phosphoenolpyruvate-insensitive phosphofructokinase isozyme from Thermus thermophilus HB8.

In the previous paper [Xu, J., Oshima, T., & Yoshida, M. (1990) J. Mol. Biol. 215, 597-606], we reported that phosphofructokinase from Thermus thermophilus is allosterically inhibited by phosphoenolpyruvate, which induces dissociation of the active four-subunit enzyme into an inactive two-subunit form. When T. thermophilus was cultured in a glucose-containing medium, another phosphofructokinase (PFK2) appeared in addition to the reported one (PFK1). The molecular weights of the native PFK2 molecule (132,000) and its subunit (34,500), which are slightly smaller than those of PFK1, suggest that PFK2 is also composed of four identical subunits. However, the hyperbolic kinetics and molecular form of PFK2 are not affected at all by phosphoenolpyruvate. The NH2-terminal amino acid sequences of subunits of PFK1 and PFK2 revealed that they are composed of very similar but different polypeptides.     

Terminal heterogeneity and corrections of the nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

The nucleotide sequence of 5S rRNA from an extreme thermophile Thermusthermophilus HB8 has been re-examined and determined as [Formula: see text] The present study could resolve previously ambiguous residues and find two additional residues (G(8 3), C(9 7)), G at position 89 and two terminal heterogeneities which are exactly the same as reported with Thermusaquaticus 5S rRNA.Images