共查询到20条相似文献,搜索用时 31 毫秒
1.
Artificial microRNA (amiRNA) has become a powerful tool for gene silencing in plants. A new method for easy and rapid construction
of rice artificial miRNA vector is described. The procedure involved modification of the pCAMBIA1300-UR vector by insertion
of a ‘vector modification fragment’. This was prepared from the precursor of Os- amiR528 by eliminating the central miRNA-containing region while simultaneously creating an AfeI restriction site. The fragment was then introduced to the destination vector to produce a multipurpose ‘Highly Efficient
gene Silencing Compatible vector’ (HESC vector). AfeI was used to produce linearized HESC vectors, and a blunt end PCR product that included amiRNA sequence was cloned into this
site by a single ligation reaction to create the completed amiRNA vector. Tests showed that the method was highly efficient,
and greatly reduced the time needed for vector construction and resulted in a DNA sequence identical to that of the current
method, making it particularly suitable for use in a systems biology approach to functional genomic research. 相似文献
2.
Profiling of carbohydrate structures on cell membranes has been difficult to perform because of the complexity and the variations
of such structures on cell surface glycans. This study presents a novel method for rapid profiling of cell surface glycans
for terminal N-acetyllactosamines (Galβ1-(3)4GlcNAc-R) that are uncapped, capped with sialic acid as SA-Galβ1-(3)4GlcNAc-R, or with α1,3galactosyls
as the α-gal epitope- Galα1-3Galβ1-(3)4GlcNAc-R. This method includes two enzymatic reactions: (1) Terminal sialic acid is
removed by neuraminidase, and (2) α-gal epitopes are synthesized on the exposed N-acetyllactosamines by α1,3galactosyltransferase. Existing and de novo synthesized α-gal epitopes on cells are quantified by a modification of radioimmunoassay designated as “ELISA inhibition
assay,” which measures binding of the monoclonal anti-Gal antibody M86 to α-gal epitopes. This binding is proportional to
the number of cell surface α-gal epitopes. The amount of free M86 antibody molecules remaining in the solution is determined
by ELISA using synthetic α-gal epitopes linked to albumin as solid phase antigen. The number of α-gal epitopes on cells is
estimated by comparing binding curves of M86 incubated with the assayed cells, at various concentrations of the cells, with
the binding of M86 to rabbit red cells expressing 2 × 10 6 α-gal epitopes/cell. We could demonstrate large variations in the number of sialic acid capped N-acetyllactosamines, α-gal epitopes and uncapped N-acetyllactosamines on different mammalian red blood cells, and on nucleated cells originating from a given tissue in various
species. This method may be useful for rapid identification of changes in glycosylation patterns in cells subjected to various
treatments, or in various states of differentiation. 相似文献
3.
Proteins from bioptates and autoptates of human skeletal muscle m. vastus lateralis were separated by O’Farrell two-dimensional gel electrophoresis (2DE). MALDI-TOF MS and MS/MS enabled identification of 89
protein spots as expression products of 55 genes. A modification of the O’Farrell’s method including non-equilibrium electrophoresis
in a pH gradient allowed detection — among major sarcomeric, mitochondrial, and cytosolic proteins — of several proteins,
such as PDZ- and LIM domain-containing ones (p I > 8.70), fragments of known proteins, and a stable complex of heavy and light ferritin chains. The data underlie further
studies of human skeletal muscle proteins in terms of molecular mechanisms of some physiological and pathological processes. 相似文献
4.
The CRISPR/Cas9 system now allows for unprecedented possibilities of genome editing. However, there are some limitations, including achieving efficient one-step multiple genome targeting to save costs, time, and ensure high quality. In the present study, we investigated the efficiency of one-step multiple gene modification by electroporation in porcine zygotes using pooled guide RNAs (gRNAs) targeting CMAH, GHR, GGTA1, and PDX1. We first selected the best-performing gRNA from three different designs for each gene based on the effect on embryo development and mutation efficiency. The three gRNAs showed equivalent effects on the rates of blastocyst formation in each targeted gene; however, gRNAs CMAH #2, GHR #3, GGTA1 #3, and PDX1 #3 showed the highest biallelic mutation rate, although the total mutation rate of PDX1 #3 was significantly lower than that of PDX1 #1. Therefore, CMAH #2, GHR #3, GGTA1 #3, and PDX1 #1 were used as a mixture in electroporation to further clarify whether multiple genes can be targeted simultaneously. Individual sequencing of 43 blastocysts at the target sites of each gene showed mutations in one and two target genes in twenty-four (55.8%) and nine (20.9%) blastocysts, respectively. No mutation was detected in any target gene in ten (23.3%) blastocysts and no blastocysts had a mutation in three or more target genes. These results indicate that electroporation could effectively deliver multiple gRNAs and Cas9 protein into porcine zygotes to target multiple genes in a one-step process. However, the technique requires further development to increase the success rate of multiple gene modification. 相似文献
5.
Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO)
GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH 3)CH 2(RCl)(II-PS) and (RCl)CH 2N(CH 3)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C 6H 4N(CH 3)(CH 2CH 2Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity
of the target modification. The maximum degree of the target modification (at t→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH 3)CH 2(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA.
Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of
the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated
both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target
modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature
dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification,
the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide
duplex.
For Part III, see [1]. 相似文献
6.
Clavulanic acid is a secondary metabolite produced by Streptomyces clavuligerus. It possesses a clavam structure and a characteristic 3 R,5 R stereochemistry essential for action as a β-lactamase inhibitory molecule. It is produced from glyceraldehyde-3-phosphate
and arginine in an eight step biosynthetic pathway. The pathway is carried out by unusual enzymes, such as (1) the enzyme
condensing both precursors, N
2-(2-carboxyethyl)-arginine (CEA) synthetase, (2) the β-lactam synthetase cyclizing CEA and (3) the clavaminate synthetase,
a well-characterized multifunctional enzyme. Genes for biosynthesis of clavulanic acid and other clavams have been cloned
and characterized. They offer new possibilities for modification of the pathway and for obtaining new molecules with a clavam
structure. The state of the regulatory proteins controlling clavulanic acid biosynthesis, as well as the relationship between
the biosynthetic pathway of clavulanic acid and other clavams, is discussed.
Received: 9 February 2000 / Received revision: 10 May 2000 / Accepted: 12 May 2000 相似文献
7.
A three-step biotin-anti-biotin gold-detection system (method A) has been applied for ultraimmunocytochemistry using ultrasmall
colloidal gold (0.8 nm) linked to anti-biotin antibodies which were visualized and enhanced by silver reduction. The reactivity
for glucagon in human pancreatic islets and for cytochrome- c oxidase in heart mitochondria has been compared to a two-step ultrasmall immunogold technique (method B). For both antigens,
method A provided significantly higher labelling indices ( P<0.001): the labelling density for cytochrome- c oxidase was 223/μm 2 using method A and 78/μm 2 using method B. For glucagon, the labelling density was 1455/μm 2 with method A and 322/μm 2 with method B. The results demonstrate that the silver-intensified biotin-anti-biotin gold-detection system is a valuable
immunocytochemical method for signal enhancement. The method utilizes biotinylated antibodies from different species, allowing
its broad application at the electron microscopic level.
Accepted: 24 June 1997 相似文献
8.
Methoxypoly(ethylene glycol) (PEG) modification of Escherichia coliβ-glucuronidase (βG) was examined as a method to improve the stability and pharmacokinetics of antibody-βG conjugates for
the targeted activation of glucuronide prodrugs at tumor cells. Introduction of 3 PEG molecules did not affect βG activity
whereas higher degrees of PEG modification produced progressively greater loss of enzymatic activity. The enzyme was found
to be stable in serum regardless of PEG modification. PEG-modified βG was coupled via a thioether bond to mAb RH1, an IgG 2a antibody that binds to the surface of AS-30D hepatoma cells, to produce conjugates with 3 (RH1-βG-3PEG), 5.2 (RH1-βG-5PEG)
or 9.8 (RH1-βG-10PEG) PEG molecules per βG with retention of 75%, 45% and 40% of the combined antigen-binding and enzymatic
activity of the unmodified conjugate RH1-βG. In contrast to the rapid serum clearance of RH1-βG observed in mice, the PEG-modified
conjugates displayed extended serum half-lives. RH1-βG-3PEG and RH1-βG-5PEG also exhibited reduced spleen uptake and greater
tumor accumulation than RH1-βG. BHAMG, the glucuronide prodrug of p-hydroxyaniline mustard (pHAM), was relatively nontoxic in vivo. Injection of 6 mg/kg or 12 mg/kg pHAM i.v. depressed white
blood cell numbers by 46% and 71% whereas 80 mg/kg BHAMG reduced these levels by 22%. Although the tumor/blood ratio of RH1-βG-5PEG
was adversely affected by slow clearance from serum, combined therapy of small solid hepatoma tumors with this conjugate,
followed 4 and 5 days later with i.v. injections of BHAMG, cured all of seven mice with severe combined immunodeficiency.
Combined treatment with a control antibody-βG conjugate and BHAMG delayed tumor growth and cured two of six mice while treatment
with pHAM or BHAMG alone was ineffective.
Received: 27 February 1997 / Accepted: 6 May 1997 相似文献
9.
Procedures have been developed allowing recombinant DNA work with Clostridium acetobutylicum DSM 792. Electroporation was used to introduce plasmid DNA into exponentially growing clostridial cells and 6 × 10 2 transformants/μg DNA could be obtained at a time constant of 5.5 ms, 1.8 kV, 50 μF, and 600 Ω. The method also allowed the
taxonomic group IV strain NI-4082 to be transformed (10 1 transformants/μg DNA). Plasmid preparation from recombinant clostridia was optimal when a modification of the alkaline lysis
method was employed. It was also important to use cells from the mid-logarithmic growth phase. Recombinant strains could be
easily preserved as spore suspensions; under all conditions tested plasmids were maintained.
Received: 17 March 1998 / Received revision: 17 August 1998 / Accepted: 26 August 1998 相似文献
10.
The improvement of nutritional quality is one potential application for the genetic modification of plants. One possible target
for such manipulation is the modification of fatty acid metabolism. In this work, expression of a borage Δ 6-desaturase cDNA in tomato ( Lycopersicon esculentum L.) has been shown to produce γ-linolenic acid (GLA; 18:3 Δ 6,9,12) and octadecatetraenoic acid (OTA; 18:4 Δ 6,9,12,15) in transgenic leaf and fruit tissue. This genetic modification has also, unexpectedly, resulted in a reduction in the percentage
of linoleic acid (LA 18:2 Δ 9,12) and a concomitant increase in the percentage of α-linolenic acid (ALA; 18:3 Δ 9,12,15) in fruit tissue. These changes in fatty acid composition are thought to be beneficial for human health. 相似文献
11.
Effect of various inhibitors on the (NH 4
+ + Na +)-activated ATPase of an anaerobic alkaliphile, Ep01(a strain of Amphibacillus xylanus), was examined. Among the chemicals tested, the enzyme was drastically inactivated by p-chloromercuribenzoic acid and diethyl pyrocarbonate. The ATPase activity of the enzyme, which was inactivated by p-chloromercuribenzoic acid and diethyl pyrocarbonate, was remarkably restored by β-mercaptoethanol and hydroxylamine, respectively,
suggesting the involvement of cysteine and histidine residues in the enzyme activity. Analysis of the inhibition kinetics
by diethyl pyrocarbonate indicated that modification of a single histidine residue per ATPase molecule was sufficient to inactivate
the enzyme.
Received: 2 June 1997 / Accepted: 7 July 1997 相似文献
12.
Oligonucleotide analogues containing one or a few glycine, L-, and D-alanine residues instead of phosphodiester internucleotide linkages were synthesized (C3′-NH-C(O)-CH(X)-NH-C(O)-C4′, where
X = H, ( S)-CH 3, and ( R)-CH 3. The stability of the duplexes of modified oligonucleotides with their wild-type complements was studied. The incorporation
of glycine and L-alanine residues into internucleotide linkages was shown to noticeably decrease the stability of modified duplexes as compared
to that of native ones (Δ T
m∼−2°C per modification), whereas analogues containing D-alanine linkers form duplexes with increased stability (Δ T
m∼+2°C per modification). 相似文献
13.
Polypeptide phosphorylation and sialylation of the glycan moieties contribute to the charge heterogeneity of the class I
major histocompatibility complex glycoproteins. The present study demonstrates that a unique acidic modification unrelated
to phosphorylation or glycosylation also affects the charge heterogeneity of the H2-K k heavy chain of BW5147 lymphoma cells. In vitro cultivation of BW5147 cells results in changes in charge heterogeneity of
the H2-K k heavy chains due to the unique acidic modification. Sequential papain digestion of the 45 000 M
r
H2-K k glycoprotein yields a 42 500 M
r
glycopolypeptide initially, followed by production of a 39 000 M
r
glycopolypeptide. Results from experiments designed to localize and characterize the novel acidic modification suggest that
the modification resides in the segment of the H2-K k polypeptide located between the two papain cleavage sites. This portion of the polypeptide consists of the transmembrane
region and part of the cytoplasmic domain of the H2-K k heavy chain. At steady state, 25% of the total cell surface H2-K k possesses this modification. In addition, the modification is mutually exclusive with the phosphorylation of the H2-K k heavy chain at Ser-333. The possible biological significance of the novel modification of class I antigens is discussed.
Received: 27 May 1997 / Revised: 10 September 1997 相似文献
15.
To develop a new system for inducible male sterility without any modification of the floral architecture in tobacco plants, a mutated ethylene receptor gene Cm-ERS1/H70A was fused either to the tobacco Nin88 promoter known to function mainly in the tapetum and microspore or to the CaMV 35S promoter known to be a constitutive promoter. The fusion genes pNin88::Cm-ERS1/H70A and p35S::Cm-ERS1/H70A were introduced in tobacco plants, which generated two independent transformants. Transformants with 35S::Cm-ERS1/H70A produced less normal pollen and had modified floral architecture while those with Nin88::Cm-ERS1/H70A produced less normal pollen without modification of floral architecture. Histological observations of anthers at stage 2 showed that tapetum degeneration in NH70A #8 and H70A #2 transformants occurred later than in wild types, strongly indicating that the expression of the mutated gene was involved in this delay. These results suggest that the tapetum-specific expression of a mutated ethylene receptor gene is a potential strategy for inducing male sterility in transgenic plants. 相似文献
16.
Previously, we achieved approximately 30-fold enhanced secretion of the protease-sensitive model protein human growth hormone
(hGH) by multiple gene deletion of seven obstructive proteases in the fission yeast Schizosaccharomyces pombe. However, intracellular retention of secretory hGH was found in the resultant multiprotease-deficient strains. As a solution,
genetic modification of the intracellular trafficking pathway that is related to intracellular retention of hGH was attempted
on a protease octuple deletant strain. Vacuolar accumulation of the intracellularly retained hGH was identified by secretory
expression of hGH fused with EGFP, and three vacuolar protein sorting ( vps)-deficient strains, vps10Δ, vps22Δ, and vps34Δ, were determined on account of their hGH secretion efficiency. The mutant vps10Δ was found to be effective for hGH secretion, which suggested a role for vps10 in the vacuolar accumulation of the intracellularly retained hGH. Finally, vps10 deletion was performed on the protease octuple deletant strain, which led to an approximately 2-fold increase in hGH secretion.
This indicated the possible application of secretory-pathway modification and multiple protease deletion for improving heterologous
protein secretion from the fission yeast S. pombe. 相似文献
17.
Eight reagents specifically modifying amino acids were applied to cells of a standard Escherichia coli colicin indicator strain to follow in vivo changes of its binding capacity for colicins E1–E3 and hence the binding domains (epitopes) for them in the outer membrane
receptor protein BtuB. The effect of these reagents was also investigated in a mutant strain carrying an extensive BtuB deletion.
The following differences of the binding epitopes could be ascertained. Colicin E1: Blockage of OH-groups, just as N-substitution of His and modification of Arg and Trp enhance binding of colicin E1. In the
deleted receptor, also abolition of carboxylic anion bonds enhances its affinity for colicin E1. It follows that colicin E1
is bound, most of all, to the hydrophobic domain A (loops 1+2) of BtuB. Colicins E2 and E3: both exert rather analogous binding parameters. In contrast to E1, O-substitution of Ser and Thr dramatically decreases
the E2 and E3 binding, similarly to modification of Lys. There is also a clear difference in the binding affinity of the domain
for E2 and/or E3 and for E1 following modifications of their Arg and His. Colicins E2 and E3 are rather bound to the hydrophilic
domain B (loops 5–7) of the receptor. In this respect, interactions of colicins E2 and E3 with deeper parts of A and B domains
(Trp, several Arg, Lys and His residues) exhibited subtle differences. Acidic pH (4.5–6.0) shows a positive, while pH 7.0–8.5
a rather negative impact on the receptor-binding function for the colicins. It was clearly demonstrated that there is just
a partial difference between the binding behavior of colicins E1, E2 and/or E3. 相似文献
18.
The dynamics of genome modification that occurred from the initial hybridization event to the stabilization of allopolyploid
species remains largely unexplored. Here, we studied inheritance and expression of rDNA loci in the initial generations of
Brassica napus allotetraploids (2 n = 38, AACC) resynthesized from Brassica oleracea (2 n = 18, CC) and B. rapa (2 n = 20, AA) and compared the patterns to natural forms. Starting already from F1 generation, there was a strong uniparental
silencing of B. oleracea genes. The epigenetic reprogramming was accompanied with immediate condensation of C-genome nucleolar organizer region (NOR)
and progressive transgeneration hypermethylation of polymerase I promoters, mainly at CG sites. No such changes were observed
in the A-genome NORs. Locus loss and gains affecting mainly non-NOR loci after the first allotetraploid meiosis did not influence
established functional status of NORs. Collectively, epigenetic and genetic modifications in synthetic lines resemble events
that accompanied formation of natural allopolyploid species. 相似文献
19.
O-Linked N-acetylglucosamine ( O-GlcNAc) modification of serines/threonines on cytoplasmic proteins is a significant signal regulating cellular processes
such as cell cycle, cell development, and cell apoptosis. O-GlcNAcase (OGA) is responsible for the removal of O-GlcNAc, and it thus plays a critical role in O-GlcNAc metabolism. Interestingly, OGA can be cleaved by caspase-3 into two fragments during apoptosis, producing an N-terminal
fragment (1–413 a.a.), termed nOGA. Here, using 4-MU-GlcNAc (4-methylumbelliferyl 2-acetamido-2-deoxy-β-D-glucopyranoside)
as substrate, we found that the nOGA fragment retains high glycosidase activity. To probe the role of nOGA in apoptosis, it
is essential to develop a potent and specific nOGA inhibitor. However, many reported inhibitors active at nanomolar concentrations
(including PUGNAc, STZ, GlcNAc-statin, and NAG-thiazoline) against full-length OGA were not potent for nOGA. Next, we screened
a small triazole-linked carbohydrate library and first identified compound 4 (4-pyridyl-1-(2′-deoxy-2′-acetamido-β-D-glucopyranosyl)-1,2,3-triazole) as a potent and competitive inhibitor for nOGA. This
compound shows 15-fold selectivity for nOGA ( K
i = 48 μM) over the full-length OGA ( K
i = 725 μM) and 10-fold selectivity over human lysosomal β-hexosaminidase A&B (Hex A&B) ( K
i = 502 μM). These results reveal that compound 4 can be used as a potent and selective inhibitor for probing the role of nOGA in biological systems. 相似文献
20.
The genes encoding the ApaLI (5′-G^TGCAC-3′), NspI (5′-RCATG^Y-3′), NspHI (5′-RCATG^Y-3′), SacI (5′-GAGCT^C-3′), SapI (5′-GCTCTTCN1^-3′, 5′-^N4GAAGAGC-3′) and ScaI (5′-AGT^ACT-3′) restriction-modification systems have been cloned in E.␣coli. Amino acid sequence comparison of M. ApaLI, M. NspI, M. NspHI, and M. SacI with known methylases indicated that they contain the ten conserved motifs characteristic of C5 cytosine methylases. NspI and NspHI restriction-modification systems are highly homologous in amino acid sequence. The C-termini of the NspI and NlaIII (5′-CATG-3′) restriction endonucleases share significant similarity. 5mC modification of the internal C in a SacI site renders it resistant to SacI digestion. External 5mC modification of a SacI site has no effect on SacI digestion. N4mC modification of the second base in the sequence 5′-GCTCTTC-3′ blocks SapI digestion. N4mC modification of the other cytosines in the SapI site does not affect SapI digestion. N4mC modification of ScaI site blocks ScaI digetion. A DNA invertase homolog was found adjacent to the ApaLI restriction-modification system. A DNA transposase subunit homolog was found upstream of the SapI restriction endonuclease gene.
Received: 15 April 1998 / Accepted: 3 August 1998 相似文献
|