共查询到20条相似文献,搜索用时 15 毫秒
1.
William S. Modi 《Journal of molecular evolution》1993,37(1):48-56
The evolutionary history of a 160-bp tandem satellite array, originally described from Microtus chrotorrhinus and called MSAT-160, was examined in related species of arvicolid rodents by sequence analyses, quantitative dot blotting, and Southern blotting. Results indicate that MSAT-160 is present in 12 of the 20 species and subspecies of Microtus assayed, but not in species belonging to any of the eight other genera examined. DNA from each species containing MSAT-160 was digested with 12 restriction endonucleases and restriction patterns were obtained reflecting the variable extent of homogenization of any given variant in different species. For example, with MboI digestion, M. chrotorrhinus produced a type A ladder pattern where most monomers contain the restriction site, M. ochrogaster generated a type B pattern where most monomers lack the site, and M. agrestis yielded a pattern intermediate between the A and B types. Further, dot blotting revealed copy-number differences between species. These findings indicate that changes in the periodic structure and amount of satellite DNA have occured since these species last shared a common ancestor. In addition, various species-pacific patterns were documented, illustrating that mechanism other than genomewide homogenization, such as stochastic mutation, out-of-register crossing over, deletion, and random amplification also play a role in structuring tandem arrays. Stochastic mutation and homogenization rates in satellite DNA, levels of species diversity, and magnitudes of chromosomal divergence differ significantly in Microtus, Mus, and Ctenomys, the three rodent lineages examined. 相似文献
2.
William S. Modi 《Chromosoma》1993,102(7):484-490
A novel satellite DNA family (called MSAT-2570) was isolated and characterized from the rodent Microtus chrotorrhinus. With a length of 2,570 bp the repeat unit is among the largest yet reported in mammals and comprises a series of short direct and inverted repeats. These repeat motifs may prevent nucleosome formation or represent an endless source of genetic variation. Restriction enzyme digestion using the two pairs of isoschizomers HpaII/MspI and MboI/Sau3AI demonstrated tissue specific differences in satellite DNA methylation that may reflect variable chromatin conformation or differences in patterns of gene expression. The sex chromosomes of M. chrotorrhinus are unusually large in size among mammals, comprising 15%–20% of the karyotype and containing large blocks of heterochromatin. In situ hybridization of the satellite DNa revealed chromosomal localization predominantly to sex chromosome heterochromatin. A survey of related rodents including three congeneric species also with giant sized sex chromosomes demonstrated that MSAT-2570 is present only in the genome of M. chrotorrhinus. However, another previously reported satellite DNA also isolated from M. chrotorrhinus has been shown to reside on sex chromosome heterochromatin in one of the other three species, indicating that these giant blocks of heterochromatin are complex in structure and comprise multiple, unrelatined satellite DNA families. 相似文献
3.
RANJANA NAGPAL TANVIR H. DAR SOOM N. RAINA 《Botanical journal of the Linnean Society. Linnean Society of London》2008,157(3):545-557
DNA restriction endonuclease fragment analysis was used to obtain new information on the genomic organization of ribosomal DNA (rDNA) of Brassica and allied genera. The total genomic DNA of 95 accessions of 52 species representing 16 genera was restricted with six enzymes, and the restriction fragments were probed with three ribosomal clones (pTA71, Ver 18‐6, and Ver 6‐5). Eleven repeat unit length classes were recognized. The repeat unit size classes of 8.9 kb and 9.5 kb were observed most commonly, being represented in 17 and 14 species, respectively. The restriction enzyme SacI produced three to six (generally three) bands with detectable hybridization to the probe pTA71. This probe–enzyme combination indicated a remarkable uniformity amongst Brassica and allied genera in the coding region of repeat units. By contrast, an extensive size variation in the restriction fragments could be localized in the intergenic spacer (IGS) region. Eleven IGS‐containing length variants were detected. Complex hybridization patterns, resulting from extensive repeat unit heterogeneity and taxon‐specific methylation of one or more cleavage sites, were obtained with the EcoRI + pTA71 combination. The relative homologies between the coding regions were evident from the presence of 1.5 kb in all the taxa, and 0.4‐, 1.3‐, and 1.7‐kb fragments in 33, 27, and 24 species, respectively. The SacI + pTA71 and EcoRI + pTA71 combinations were generally able to distinguish taxa both within and between genera. Three restriction endonuclease digests probed with three ribosomal clones yielded essentially identical fragmentation patterns across all the accessions within the cultivated species Brassica campestris, B. oleracea, and B. juncea. In B. napus, three and seven accessions exhibited restriction profiles similar to one and both diploid progenitor species, respectively. Overall, rDNA repeat unit length polymorphism showed good correlation with the cytodeme‐based classification of Brassica and allied genera. © 2008 The Linnean Society of London, Botanical Journal of the Linnean Society, 2008, 157 , 545–557. 相似文献
4.
Polymorphism of mitochondrial DNA in pigs based on restriction endonuclease cleavage patterns 总被引:6,自引:0,他引:6
Tomomasa Watanabe Yukimasa Hayashi Nobuaki Ogasawara Takeshi Tomoita 《Biochemical genetics》1985,23(1-2):105-113
Restriction endonuclease cleavage patterns of mitochondrial DNA (mtDNA) of pigs and Japanese wild boars were analyzed using 17 enzymes which recognize six nucleotides. The map of cleavage sites was made by double-digestion methods. Polymophism of mtDNA was detected in the digestion by BglII, EcoRV, ScaI, and StuI. The restriction cleavage patterns were identical among the breeds of Landrace, Hampshire, Duroc I, and Large White I (A type). The patterns of Large White II were the same as those of Japanese wild boars (B type). A difference between the A type and the B type of mtDNA was found in the case of three restriction enzymes, BglII, ScaI, and StuI, and the nucleotide alterations between them were estimated as more than six. On the other hand, a difference between mtDNA from almost all pigs and mtDNA from Duroc II was detected using EcoRV. We suggest that the difference of mtDNA between the A type and the B type of mtDNA could result from the different origin of boars, that is, whether they were of European or Asian origin. 相似文献
5.
C. S. Lee 《Chromosoma》1981,83(3):367-379
The satellite II DNA of Drosophila nasutoides is a highly diverged repetitive DNA, showing about 17% base changes between repeat units (Cordeiro-Stone and Lee, 1976). This DNA is cleaved by four different restriction enzymes to produce multimeric fragmentation patterns, indicating that their restriction sites are regularly arranged. Moreover, all four enzymes produce identical fragment lengths, the size of a monomer being 96 base pairs. Such multimeric patterns are expected for a diverged repetitive DNA, since many restriction sequences could have undergone changes during sequence divergence. Further restriction analyses of this DNA by double digestions and cloning reveal that there are three different sequences in satellite II DNA with respect to the presence and the arrangement of various restriction sites (Fig. 7). As an example, one sequence contains many EcoRI sites and fewer Hinfl sites (20% of EcoRI sites), which are arranged regularly. These observations suggest that satellite II DNA of D. nasutoides might have evolved through different modes of sequence divergence. 相似文献
6.
DNA purified from a Chinese hamster cell line of lung fibroblast origin (DC83F) was analyzed by density gradient centrifugation and by gel electrophoresis after restriction endonuclease digestion in order to fractionate discrete repetitive fractions within the total DNA. No obvious satellite DNAs were resolved using the CsCl or Ag-Cs2SO4 density gradient conditions described herein. However, analysis of the digestion products of a battery of restriction endonucleases indicated that three of these enzymes, EcoR
1, HaeIII, and XhoI, yielded discrete fragments which could be visualized with EtBr staining or identified by scintillation counting of [
3
H] DNA. DNAs from several highly ( hundredfold increased resistance) antifolate-resistant sublines of DC-3F, characterized by a large homogeneously staining region (HSR) in the chromosome complement, were examined with both techniques and compared to the parental, antifolate-sensitive cell line DNA. The density gradient profiles and electrophoretic patterns of restriction endonuclease digests were identical among all the cell lines examined and were indistinguishable from those of the parental DC-3F DNA.This work was supported in part by grants to the Sloan-Kettering Institute and to J.L.B. and P.W.M. by the National Institutes of Health and the Fairchild New Frontiers Fund. Portions of this study were presented at the 18th Annual Meeting of the American Society for Cell Biology held in San Antonio, Texas, November 4–8, 1978. 相似文献
7.
K. Fritzsche M. Metzlaff R. Melzer R. Hagemann 《TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik》1987,74(5):589-594
Summary A phyletic tree of the genus Beta has been constructed based on EcoRI and PstI plastid DNA restriction patterns of eight species from three sections of the genus. In contrast to the remarkable morphological variability of the varieties of B. vulgaris the restriction patterns of the plastid DNA of this species were found to be almost identical. The comparison of plastic DNAs of B. vulgaris crassa fertile and sterile lines with 13 different restriction enzymes revealed only a single fragment polymorphism in the HindIII patterns. Hybridization analyses in the plastidal rDNA region revealed an interesting loss of an EcoRI restriction site in all cultivated B. vulgaris varieties in contrast to wild species. The results of the construction of clone banks for SalI and BamHI fragments of plastid DNA from fertile B. vulgaris crassa are reported and difficulties in the cloning of specific fragments are discussed. 相似文献
8.
Several species of tsetse fly within the Morsitans and Fusca subgenera of Glossina contain supernumerary (B) chromosomes. Previous studies on the meiotic behaviour of chromosomes (Southern and Pell, 1973) and the C-band patterns (Jordan et al., 1977) have indicated a close similarity between the Y chromosome and the supernumeraries. The distributions of the highly abundant families of DNA (satellite DNAs) between the autosomes, sex chromosomes and B chromosomes of G.m. morsitans, G. austeni and G. pallidipes have been examined by in situ hybridisation. In addition, the organisation and sequence homologies of satellite DNAs have been examined by restriction enzymes and heterologous hybridisations in in situ and Southern transfer conditions. The majority of satellite sequences that are homologous between species are distributed in several different arrangements between A and B chromosome telomeres with minority sequences at some centromeric and intercalary locations. There is no extensive satellite DNA similarity between the Y and B chromosomes. We suggest that the Y and B chromosome associations and synchronous allocycly during meiosis are the result of extensive heterochromatinisation of these two chromosome types, that is probably a reflection of two separate stages involved in the generation of the B chromosomes in the genus. The independent evolution of satellites and supernumeraries is discussed. 相似文献
9.
M. A. Fregene J. Vargas J. Ikea F. Angel J. Tohme R. A. Asiedu M. O. Akoroda W. M. Roca 《TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik》1994,89(6):719-727
Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability. 相似文献
10.
We have used a human C4 cDNA probe to investigate the complement component C4 gene in four members of the family Balaenopteridae: fin whale (Balaenoptera physalus), sei whale (B. borealis), minke whale (B. acutorostrata), and bryde's whale (B. edeni). Restriction mapping of genomic DNA from the first three species suggests the presence of only one locus in these species, and also shows that the C4 genes in the three species are very similar. We have used 14 restriction endonucleases to investigate the restriction fragment length polymorphism (RFLP) of fin whales, 13 enzymes for sei whales, and 8 enzymes for the minke whale. No polymorphism was seen in DNA from the five minke whale samples, but Rsa I and Taq I restriction enzymes gave polymorphism in fin and sei whales whereas Hind III and Msp I restriction enzymes showed polymorphism in sei whales only. Only one bryde's whale sample was available for investigation. The study of DNA available from mother-fetus pairs from the two polymorphic species demonstrated a simple, two-allele transmission of RFLP alleles. 相似文献
11.
A highly repeated DNA (designated satellite IA) was isolated from cultured cells of Muntiacus muntjak vaginalis and its organization analyzed by the use of restriction nucleases and hybridization experiments with cloned DNA-fragments. Several restriction nucleases cleave the satellite IA DNA into a series of fragments, which are multiples of a basic repeat unit of 800 bp. Sequences homologous to the satellite IA DNA were also found in a second highly repetitive DNA component of Muntiacus muntjak vaginalis (satellite IB). Its organization is more complex than the one of satellite IA and does not conform to a simple periodicity of a basic repeat unit. — Hybridization in situ revealed, that both satellites are confined in their entirety to the X-chromosome, where they are located at both arms close to the centromere. No satellite DNA was found at the Y1-chromosome, which is considered to be homologous to the long arm of the X-chromosome. These results have interesting implications for the evolution of the X-chromosome. 相似文献
12.
C. S. Lee 《Chromosoma》1978,65(2):103-114
Chromatin structure can be probed by cross-linking DNA in situ using trioxsalen and irradiation with UV light. Presumably DNA within a nucleosome is protected from cross-linking so that this region appears as a single-strand loop in the electron microscope under a condition in which single-strands and double-strands are distinguished. Unprotected regions appear as duplex due to cross-linking.We have used this approach to investigate the structure of chromatins containing satellite DNAs of Drosophila nasutoides. We have previously shown that D. nasutoides has an unusually large autosome pair which is almost entirely heterochromatic. Its nuclear DNA reveals four major satellite components amounting up to 60% of the total genome. All of them are localized in this large heterochromatic chromosome. We wish to ask whether chromatins containing different satellite sequences have different arrangements of nucleosomes. Our results from cross-linking experiments show that all DNA components including main band DNA have different patterns of protected and unprotected regions: (a) The length distributions of protected regions show multiple peaks with the smallest unit lengths being 200 nucleotides for main band DNA, 180 for satellites I, II and III, and 160 for satellite IV. (b) The amounts of unprotected regions, presumably internucleosome DNA, vary from 16% for main band DNA to 60% for satellite IV, suggesting that satellite chromatins have fewer nucleosomes per given length of chromatin than main band DNA chromatin. The spacings between nucleosomes appear to be random in satellite chromatins. 相似文献
13.
Cytological and biochemical experiments were undertaken in order to characterize the action of several restriction enzymes on fixed chromosomes of Tenebrio molitor (Coleoptera). EcoRI cuts the satellite DNA of this organism into suunit monomers of 142 bp in naked DNA and acts on fixed chromosomes cleaving and extracting these tandemly repeated sequences present in median centromeric heterochromatin. AluI, in contrast, is unable to attack the satellite sequences but does cut the main band DNA both in naked DNA and in fixed chromosomes. These enzymes therefore permit the in situ localization of satellite DNA or main band DNA in T. molitor. Other enzymes such HinfI or Sau3A do not produce longitudinal differentiation in chromosomes because of the extraction of DNA from satellite and main band DNA regions. In situ hybridization with a satellite DNA probe from T. molitor confirms that the DNA extracted from the chromosomes is the abundant and homogenous highly repeated DNA present in pericentromeric regions. These results plus the analysis of the DNA fractions retained on the slide and solubilized by the action of the restriction enzymes in situ provide evidence that: (a) as an exception to the rule EcoRI (6 bp cutter) is able to produce chromosome banding; (b) the size of the fragments produced by in situ digestion of satellite DNA with EcoRI is not a limiting factor in the extraction; (c) there is a remarkable accord between the action of EcoRI and AluI on naked DNA and on DNA in fixed chromosomes, and (d) the organization of specific chromosome regions seems to be very important in producing longitudinal differentiation on chromosomes.by E.R. Schmidt 相似文献
14.
Characterization of a highly repeated satellite DNA from the cyprinid fish Notropis lutrensis 总被引:1,自引:0,他引:1
S P Moyer D P Ma T L Thomas J R Gold 《Comparative biochemistry and physiology. B, Comparative biochemistry》1988,91(4):639-646
1. A highly repeated, satellite DNA family from the North American cyprinid fish, Notropis lutrensis, was identified as a fragment band following restriction endonuclease enzyme digestion and agarose gel electrophoresis of genomic DNA; evidence of a tandem arrangement of the satellite in the genome was demonstrated by the formation of "ladders" in partial restriction endonuclease digests. 2. The satellite family was estimated densitometrically to comprise 7-8% of the N. lutrensis genome; mapping experiments using isolated and purified monomer repeat units of the satellite uncovered nine sites for seven different restriction enzymes. 3. A monomeric repeat unit of the satellite was cloned and sequenced, and found to be 174 base pairs in length and to have a base composition of 47% G + C (guanine + cytosine); computer analysis of the sequence revealed 13 new restriction sites for 12 additional enzymes. 4. Computer analysis also revealed that a large degree of internal redundancy in the monomer unit exists in the form of both direct and inverted repeating units, and that the entire sequence, starting with one base in either orientation, constitutes an open reading frame. In all but the last characteristic, the N. lutrensis satellite DNA is very similar to satellite DNAs in other eukaryotes. 相似文献
15.
S. W. Ratcliff J. Luh A. T. Ganesan B. Behrens R. Thompson M. A. Montenegro G. Morelli T. A. Trautner 《Molecular & general genetics : MGG》1979,168(2):165-172
Summary SPP1 DNA was cleaved by the restriction endonucleases, BglI, BglII, EcoRI, KpnI, SmaI, and SalI. The molecular weights of the DNA fragments obtained by single enzyme digestion or by consecutive digestion with two enzymes were determined by electron microscopic measurements of contour length and by gel electrophoresis. The major fragments from the six digests could be ordered to give a consistent restriction map of SPP1. The electropherograms of several digests indicated that certain fragments occurred in less than stoichiometric amounts or were heterogeneous in size. Such bands carried a major part of radioactivity, when SPP1 DNA was terminally labelled with P32 prior to degradation by restriction enzymes. These results, and studies of the effect of exonuclease III treatment on restriction enzyme patterns define the terminal restriction fragments. All data obaained support the conclusion drawn in the preceding paper (Morelli et al., 1978b) that the SPP1 genome is terminally redundant and partially circularly permuted.Part of this work is from the doctoral dissertations to be submitted to Stanford University1 and the Freie Universität Berlin2 相似文献
16.
S. Datta R. G. Choudhary Md. Shamim Vishwa Dhar 《Archives Of Phytopathology And Plant Protection》2013,46(6):558-566
Fusarium species causing wilt diseases in different plants were characterised by comparing nonpathogenic and different pathogenic species using rDNA RFLP analysis. The ITS (internal transcribed spacer) region of 12 isolates belonging to the section Elegans, Laseola, Mortiella, Discolor, Gibbosum, Lateritium and Sporotrichiella were amplified by universal ITS primers (ITS-1 and ITS-4) using polymerase chain reaction (PCR). Amplified products, which ranged from 522 to 565 bp were obtained from all 12 Fusarium isolates. The amplified products were digested with seven restriction enzymes, and restriction fragment length polymorphism (RFLP) patterns were analysed. A dendrogram derived from PCR-RFLP analysis of the rDNA region divided the Fusarium isolates into three major groups. Assessment of molecular variability based on rDNA RFLP clearly indicated that Fusarium species are heterogeneous and most of the forma speciales have close evolutionary relationships. 相似文献
17.
S. Santoni A. Bervillé 《TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik》1992,83(5):533-542
Summary The nuclear rDNA units of species belonging to the genus Beta were characterized using heterologous probes of flax (entire unit and 25S) and sunflower (6.1-kb Eco fragment containing the 18S, the entire intergenic spacer (IGS) and a small piece of the 25S). The physical maps of one species from each section of the genus was constructed by localization of the EcoRI, BamHI, HindIII, KpnI and SacI restriction sites. For each species a single individual was used to obtain total DNA. The major unit length is 11 kb, but variant length units at 10.4, 10.7 and 11.3 kb were found as minor forms. However, some individuals carried the 10.4-kb or the 10.7-kb variant length unit as the major form. For the variant length units of one species the restriction sites were conserved, so that the variation in length occurred in the IGS. The EcoRI fragment corresponding to the intergenic spacer appeared to be the best indicator of variation. The variable sequence in the IGS sometimes generated new restriction sites for the Corollinae and mainly, did so, for the Vulgares relative to the Procumbentes. The variable sites were able, to differentiate the three sections and species within the sections. Corollinae species belong to two different groups according to the absence or the presence of the BamHI (B4) site. The Vulgares species contain several unit types. We proposed that all the unit types derived from a unique unit, V-11-2.3, by unequal crossing-overs or conversion. We also supposed a homogenization mechanism because we found individuals homogeneous for every unit type. Among the cultivated beets, all the root beets contain only one rDNA unit type, V-11-2.9. Thus, we supposed that the common unit type of cultivated beets either brings a physiological advantage or is strictly linked to a favorable allele. It is likely that the rDNA unit of B. maritima were eliminated from sugar beet by the breeding process since they were not recovered. Whatever the process, we deduced that all the cultivated forms of beets likely originated in a unique plant ascendant.A phylogenic tree of the genus is proposed, based on the nuclear rDNA maps, and subsequently discussed relative to the systematic tree and other molecular phylogenies.This work was supported by grant No. 9157A between INRA and the companies Deleplanque et Cie, SES France, Maribo France, Graines Franco Suédoises, KWS France and Van der Have France 相似文献
18.
Loh-Chung Yu Daniel Lowensteiner Elsie F. -K. Wong Ikuhisa Sawada Joe Mazrimas Carl Schmid 《Chromosoma》1986,93(6):521-528
A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs. 相似文献
19.
M. Ganal V. Hemleben 《TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik》1986,73(1):129-135
Summary The AT-rich highly repeated satellite DNA of Cucurbita pepo (zucchini) and Cucurbita maxima (pumpkin) were cloned and their DNA structure was investigated. DNA sequencing revealed that the repeat length of satellite DNA in Cucurbita pepo is 349–352 base pairs. The percentage of AT-base pairs is about 61%. This satellite is highly conserved in restriction enzyme pattern and DNA sequence; sequence heterogeneity is about 10%. In contrast, the satellite DNA of Cucurbita maxima has a repeat length of 168–169 base pairs. This satellite is also rich in AT-base pairs (64%), existing in at least three different variants as revealed by restriction enzyme analysis and DNA sequencing. The sequence heterogeneity between these variants is about 15%. The two satellite DNAs showed no cross-hybridization to each other and sequence homology is only limited. Nevertheless, we found in the C. pepo genome a high amount of sequences resembling the satellite of C. maxima. In contrast, the satellite repeat of C. pepo is found in the C. maxima DNA only in a few copies. These observations were discussed with respect to satellite DNA evolution and compared to the data received from monocotyledonous species. 相似文献
20.
Major histocompatiblity complex (MHC) class IV haplotypes were identified in a population of meat-type chickens by restriction fragment length polymorphism (RFLP) analysis. Fourteen different haplotypes were designated on the basis of restriction patterns obtained from Southern blots of PvuII- or BglII-digested DNA, hybridized with the MHC class IV cDNA probe bg32.1. Digestion with each restriction enzyme yielded the same level of polymorphism among individuals. For each haplotype, 4–10 restriction fragments ranging from 0–8 to 8 kb were observed. Such a designation of meat-type chicken MHC class IV haplotypes enables a rapid recognition of previously defined haplotypes, is readily adjustable to additional, newly found restriction patterns and could prove useful in practical breeding programmes. 相似文献