Sequence of a plant cDNA from Vicia faba encoding a novel Ran-related GTP-binding protein

A clone obtained from a broad bean (Vicia faba) developing cotyledon cDNA library contained the complete coding sequence of a polypeptide with very high homology to the small GTP-binding proteins Ran from human cells and Spi1 from yeast. These proteins belong to the ras superfamily of proteins involved in different basic cellular processes. The Ran/Spi1 proteins interact with a protein bound to DNA (RCC1) and are thought to function in the regulation of the cell cycle. The amino acid sequence of the obtained plant Ran-homologue, designated Vfa-ran, is 74% and 76% identical to Ran and Spi1, respectively. The five functional, conserved domains of ras-related proteins are present in the Vfa-ran sequence. However, as in Ran/Spi1 the C-terminus of Vfa-ran is very acidic and lacks the Cys motif for isoprenylation.Northern blotting revealed a corresponding mRNA expression in broad bean roots, leaves, and cotyledons with the highest level in roots.     

Isolation and characterization of a cDNA clone encoding the anti-viral protein from Phytolacca americana

Phytolacca anti-viral protein (PAP) was purified from Phytolacca leaves and the N-terminal was sequenced. A cDNA library was made from mRNAs isolated from Phytolacca leaves and cDNA clones for PAP were identified using oligonucleotide probes derived from the N-terminal amino acid sequence. The PAP-cDNA clone was sequenced from both directions. The predicted amino acid sequence of PAP was compared with the amino acid sequences of other ribosome-inactivating proteins. The identities of these proteins to PAP ranged from 29 to 38%, and a region was found in each with a sequence similar to the PAP sequence (AIQMVSEAARFKYI). Southern blot analysis indicates that PAP is encoded by a multi-gene family.Abbreviations MAP Mirabilis jalapa anti-viral protein - PAP Phytolacca anti-viral protein - SO6 30 kDa ribosome-inactivating protein from the seeds of Saponaria officinalis     

Isolation and characterization of a rice cDNA clone encoding ATP/ADP translocator

We isolated a rice cDNA clone which encodes an open reading frame of 382 amino acids. Its deduced amino acid sequence corresponds to an ATP/ADP translocator protein. Its homology with a maize ATP/ADP translocator was 83.9% in nucleotide sequence, and 90.2% of the amino acid level. Expression of this gene is regulated by such external stresses as salinity and low temperature.     

Sequence of a cDNA encoding nitrite reductase from the tree Betula pendula and identification of conserved protein regions

Summary The sequence of an mRNA encoding nitrite reductase (NiR, EC 1.7.7.1.) from the tree Betula pendula was determined. A cDNA library constructed from leaf poly(A)⁺ mRNA was screened with an oligonucleotide probe deduced from NiR sequences from spinach and maize. A 2.5 kb cDNA was isolated that hybridized to an mRNA, the steady-state level of which increased markedly upon induction with nitrate. The nucleotide sequence of the cDNA contains a reading frame encoding a protein of 583 amino acids that reveals 79% identity with NiR from spinach. The transit peptide of the NiR precursor from birch was determined to be 22 amino acids in size by sequence comparison with NiR from spinach and maize and is the shortest transit peptide reported so far. A graphical evaluation of identities found in the NiR sequence alignment revealed nine well conserved sections each exceeding ten amino acids in size. Sequence comparisons with related redox proteins identified essential residues involved in cofactor binding. A putative binding site for ferredoxin was found in the N-terminal half of the protein.These sequence data appear in the EMBL/GenBank/DDBJ nucleotide sequence data bases under the accession number X60093     

N-Glycans mediate the apical sorting of a GPI-anchored, raft-associated protein in Madin-Darby canine kidney cells.

Glycosyl-phosphatidylinositol (GPI)- anchored proteins are preferentially transported to the apical cell surface of polarized Madin-Darby canine kidney (MDCK) cells. It has been assumed that the GPI anchor itself acts as an apical determinant by its interaction with sphingolipid-cholesterol rafts. We modified the rat growth hormone (rGH), an unglycosylated, unpolarized secreted protein, into a GPI-anchored protein and analyzed its surface delivery in polarized MDCK cells. The addition of a GPI anchor to rGH did not lead to an increase in apical delivery of the protein. However, addition of N-glycans to GPI-anchored rGH resulted in predominant apical delivery, suggesting that N-glycans act as apical sorting signals on GPI-anchored proteins as they do on transmembrane and secretory proteins. In contrast to the GPI-anchored rGH, a transmembrane form of rGH which was not raft-associated accumulated intracellularly. Addition of N-glycans to this chimeric protein prevented intracellular accumulation and led to apical delivery.     

Molecular cloning of cDNAs encoding a putative cell wall protein from Zea mays and immunological identification of related polypeptides

Copy DNAs corresponding to a highly repetitive, proline-rich protein from maize have been cloned by differential screening of a coleoptile cDNA library. The deduced amino acid sequence contains a single repetitive element of carrot extensin (Ser-Pro-Pro-Pro-Pro). The related mRNAs have a defined distribution in tissues of the plant and are accumulated mainly in the coleoptile node and root tip. A peptide that corresponds to one of the repetitive elements of the protein has been synthesized and antisera have been obtained in rabbits. These antibodies react against crude preparations of coleoptile cell wall and against polypeptides extracted following the protocols described for the extraction of extensin. From these data it is concluded that the cDNAs correspond to a family of cell wall glycoproteins from maize.     

Attachment of Madin-Darby canine kidney cells to extracellular matrix: role of a laminin binding protein related to the 37/67 kDa laminin receptor in the development of plasma membrane polarization.

Madin-Darby canine kidney (MDCK) cells have been extensively used as a model for the study of epithelial polarization. The contacts between the cell and extra-cellular matrix (ECM) provide a signal for the polarization of apical membrane markers. In order to study the molecular basis of these contacts, MDCK cells extracts in Triton X-100 were affinity-purified on laminin, yielding polypeptides of 100-110 and 36 kDa, but only the second one could be enzymatically iodinated from the cell surface. This protein was also recognized by an antibody against the 37/67-kDa laminin/elastin family of proteins. Different polypeptides were purified by the same method on type I collagen. An antibody developed against the polypeptides purified on laminin recognized also a 67-kDa protein, blocked 125I-laminin binding to a population of high affinity (1.5 nM KD) binding sites and caused a significant decrease in cell attachment and spreading to laminin or endogenous ECM. This antibody did not interfere with MDCK cell attachment to fibronectin or collagen matrices, but still impaired cell spreading. An apical MDCK plasma membrane protein (184 kDa), fully polarized in untreated cells, was partially mispolarized after treatment with anti-36 kDa antibody. These results are consistent with a model of various ECM receptors operating together in these cells, and show an important role of a non-integrin 36-kDa laminin binding protein related to the 67-kDa laminin receptor family in cell attachment, spreading and polarization.     

Isolation and characterization of a <Emphasis Type="Italic">Paramecium</Emphasis> cDNA clone encoding a putative serine/threonine protein kinase

Mitogen-activated protein (MAP) kinases, a closely related family of protein kinases, are involved in cell cycle regulation and differentiation in yeast and human cells. They have not been documented in ciliates. We used PCR to amplify DNA sequences of a ciliated protozoan—Paramecium caudatum—using primers corresponding to amino acid sequences that are common to MAP kinases. We isolated and sequenced one putative MAP kinase-like serine/threonine kinase cDNA from P. caudatum. This cDNA, called pcstk1 (Paramecium caudatum Serine/Threonine Kinase 1) shared approximately 35% amino acid identity with MAP kinases from yeast. MAP kinases are activated by phosphorylation of specific threonine and tyrosine residues. These two amino acid residues are conserved in the PCSTK1 sequence at positions Thr 159 and Tyr 161. The PSTAIRE motif, which is characteristic of the CDK2 gene family, cannot be found in ORF of PCSTK1. The highest homology score was to human STK9, which contains MAP type kinase domains. Comparisons of expression level have shown that pcstk1 is expressed equally in cells at different stages (sexual and asexual). We discussed the possibility, as in other organisms, that a family of MAP kinase genes exists in P. caudatum.     

G2/M cell cycle arrest and induction of apoptosis by a stilbenoid, 3,4,5-trimethoxy-4'-bromo-cis-stilbene, in human lung cancer cells

Stilbenoids, including resveratrol (3,5,4'-trihydroxy-trans-stilbene) which is a naturally occurring phytoalexin abundant in grapes and several plants, have been shown to be active in inhibiting proliferation and inducing apoptosis in human cancer cell lines. Using resveratrol as the prototype, we have synthesized various analogs and evaluated their growth inhibitory effects in cultured human cancer cells. In the present study, we show that one of the stilbenoids, 3,4,5-trimethoxy-4'-bromo-cis-stilbene (BCS), was more effective than its corresponding trans-isomer and resveratrol on the inhibition of cancer cell growth. Prompted by the strong growth inhibitory activity of BCS (IC50; 0.03 microM) compared to its trans-isomer (IC50; 6.36 microM) and resveratrol (IC50; 33.0 microM) in cultured human lung cancer cells (A549), we investigated its mechanism of action. BCS induced arrest at the G2/M phase cell cycle in the early time and subsequently increased in the sub-G1 phase DNA contents in a time-dependent manner, indicating induction of apoptosis. Morphological observation with round-up shape and DNA fragmentation was also revealed the apoptotic phenomena. BCS treatment elevated the expression levels of the pro-apoptotic protein p53, the cyclin-dependent kinase inhibitor p21, and the release of cytochrome c in the cytosol. The down-regulation of checkpoint protein cyclin B1 by BCS was well correlated with the cell cycle arrest at G2/M. These data suggest the potential of BCS to serve as a cancer chemotherapeutic or chemopreventive agent by virtue of arresting the cell cycle and induction of apoptosis of human lung cancer cells.     

Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress

Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress.     

An RNA electrophoretic mobility shift and mutational analysis of rnp-4f 5′-UTR intron splicing regulatory proteins in Drosophila reveals a novel new role for a dADAR protein isoform

Alternative splicing greatly enhances the diversity of proteins encoded by eukaryotic genomes, and is also important in gene expression control. In contrast to the great depth of knowledge as to molecular mechanisms in the splicing pathway itself, relatively little is known about the regulatory events behind this process. The 5′-UTR and 3′-UTR in pre-mRNAs play a variety of roles in controlling eukaryotic gene expression, including translational modulation, and nearly 4000 of the roughly 14,000 protein coding genes in Drosophila contain introns of unknown functional significance in their 5′-UTR. Here we report the results of an RNA electrophoretic mobility shift analysis of Drosophila rnp-4f 5′-UTR intron 0 splicing regulatory proteins. The pre-mRNA potential regulatory element consists of an evolutionarily-conserved 177-nt stem-loop arising from pairing of intron 0 with part of adjacent exon 2. Incubation of in vitro transcribed probe with embryo protein extract is shown to result in two shifted RNA–protein bands, and protein extract from a dADAR null mutant fly line results in only one shifted band. A mutated stem-loop in which the conserved exon 2 primary sequence is changed but secondary structure maintained by introducing compensatory base changes results in diminished band shifts. To test the hypothesis that dADAR plays a role in intron splicing regulation in vivo, levels of unspliced rnp-4f mRNA in dADAR mutant were compared to wild-type via real-time qRT-PCR. The results show that during embryogenesis unspliced rnp-4f mRNA levels fall by up to 85% in the mutant, in support of the hypothesis. Taken together, these results demonstrate a novel role for dADAR protein in rnp-4f 5′-UTR alternative intron splicing regulation which is consistent with a previously proposed model.     

Telomere length analysis of human mesenchymal stem cells by quantitative PCR

Human mesenchymal stem cells (hMSCs) have attracted much attention for tissue repair and wound healing because of their self-renewal capacity and multipotentiality. In order to mediate an effective therapy, substantial numbers of cells are required, which necessitates extensive sub-culturing and expansion of hMSCs. Throughout ex vivo expansion, the cells undergo telomere shortening, and critically short telomeres can trigger loss of cell viability. Telomeres are nucleoprotein structures that cap the ends of chromosomes, and serve to protect the DNA from the degradation which occurs due to the end-replication problem in all eukaryotes. As hMSCs have only a finite ability for self-renewal like most somatic cells, assaying for telomere length in hMSCs provides critical information on the replicative capacity of the cells, an important criterion in the selection of hMSCs for therapy. Telomere length is generally quantified by Southern blotting and fluorescence in situ hybridization, and more recently by PCR-based methods. Here we describe the quantification of hMSC telomere length by real-time PCR; our results demonstrate the effect of telomere shortening on the proliferation and clonogenicity of hMSCs. Thus, this assay constitutes a useful tool for the determination of relative telomere length in hMSCs.