A general framework for the numerical implementation of anisotropic hyperelastic material models including non-local damage

The highly nonlinear mechanical behaviour of soft tissues solicited within the physiological range usually involves degradation of the material properties. Mechanically, having these biostructures undergoing such stretch patterns may bring about pathological conditions related to the steady deterioration of both collagen fibres and material’s ground substance. Tissue and subject variability observed in the phenomenological mechanical characterisation of soft tissues often hinder the choice of the computational constitutive model. Therefore, this contribution brings forth a detailed overview of the constitutive implementation in a computational framework of anisotropic hyperelastic materials with damage. Surmounting the challenge posed by the mesh dependency pathology requires the incorporation of an integral-type non-local averaging, which seeks to include the effects of the microstructure in order to limit the localisation phenomena of the damage variables. By adopting this approach, one can make use of multiple developed material models available in the literature, a combination of those, or even propose new models within the same numerical framework. The numerical examples of three-dimensional displacement and force-driven boundary value problems highlight the possibility of using multiple material models within the same numerical framework. Particularities concerning the considered material models and the damage effect implications to represent the Mullins effect, induced anisotropy, hysteresis, and mesh dependency are discussed.     

Parameter estimation and sensitivity analysis of a nonlinearly elastic static lung model

A model for the static pressure-volume behavior of the lung parenchyma based on a pseudo-elastic strain energy function was tested. Values of the model parameters and their variances were estimated by an optimal least-squares fit of the model-predicted pressures to the corresponding data from excised, saline-filled dog lungs. Although the model fit data from twelve lungs very well, the coefficients of variation for parameter values differed greatly. To analyze the sensitivity of the model output to its parameters, we examined an approximate Hessian, H, of the least-squares objective function. Based on the determinant and condition number of H, we were able to set formal criteria for choosing the most reliable estimates of parameter values and their variances. This in turn allowed us to specify a normal range of parameter values for these dog lungs. Thus the model not only describes static pressure-volume data, but also uses the data to estimate parameters from a fundamental constitutive equation. The optimal parameter estimation and sensitivity analysis developed here can be widely applied to other physiologic systems.     

Toward a molecular understanding of the anisotropic response of proteins to external forces: insights from elastic network models

With recent advances in single-molecule manipulation techniques, it is now possible to measure the mechanical resistance of proteins to external pulling forces applied at specific positions. Remarkably, such recent studies demonstrated that the pulling/stretching forces required to initiate unfolding vary considerably depending on the location of the application of the forces, unraveling residue/position-specific response of proteins to uniaxial tension. Here we show that coarse-grained elastic network models based on the topology of interresidue contacts in the native state can satisfactory explain the relative sizes of such stretching forces exerted on different residue pairs. Despite their simplicity, such models presumably capture a fundamental property that dominates the observed behavior: deformations that can be accommodated by the relatively lower frequency modes of motions intrinsically favored by the structure require weaker forces and vice versa. The mechanical response of proteins to external stress is therefore shown to correlate with the anisotropic fluctuation dynamics intrinsically accessible in the folded state. The dependence on the overall fold implies that evolutionarily related proteins sharing common structural features tend to possess similar mechanical properties. However, the theory cannot explain the differences observed in a number of structurally similar but sequentially distant domains, such as the fibronectin domains.     

Strain measurement in biaxially loaded inhomogeneous, anisotropic elastic membranes

 This paper considers the problem of measuring the strain field in biaxially loaded elastic membranes, such as soft biological tissue. Cross-correlation of intrinsic or applied speckle patterns were used to calculate the 2D displacements of small regions on the surface of a deforming membrane. This method was able to resolve 2D displacements to within a twentieth of a pixel. A finite-element model with bicubic-Hermite interpolation was used to represent the geometry of the membrane in the undeformed state. This model was fitted to the measured displacements to obtain the geometry of the membrane in the deformed state, and the strain field was calculated from the change in geometry. The strain fields were measured in both an inhomogeneous isotropic rubber membrane and a section of sheep diaphragm. Received: 15 March 2002 / Accepted: 18 August 2002 We would like to acknowledge several people who contributed to the early stages of this project: Marjolein van der Glas and Henri Brouers from the University of Eindhoven contributed while on student exchange visits to Auckland and Peter Apperley helped with instrumentation development for his Masters thesis on biaxial testing. We are also grateful to the reviewers for their extremely useful suggestions. We also gratefully acknowledge the support given by the New Zealand New Economy Research Fund (NERF contract number: UOAX9905).     

Anisotropic elastic bending models of DNA

Simplified elastic rod models of DNA were developed in which the rigidity of DNA is sequence dependent and asymmetrical, i.e. the bending is facilitated towards the major groove. By subjecting the models to bending load in various directions perpendicular to the longitudinal axis of DNA, the bending deformation and the average conformation of the models can be estimated using finite element methods. Intrinsically curved sequence motifs [(aaaattttgc)_n, (tctctaaaaaatatataaaaa)_n] are found to be curved by this modelling procedure whereas the average conformation of homopolymers and straight motifs [(a)_n, (atctaatctaacacaacaca)_n] show negligible or no curvature. This suggests that sequence dependent asymmetric rigidity of DNA can provide an explanation in itself for intrinsic DNA curvature. The average rigidity of various DNA sequences was calculated and a good correlation was found with such quantities as the free energy change upon the binding of the Cro repressor, the base stacking energy and the thermal fluctuations at room temperature.     

Pulse velocities in cylindrical,tapered and curved anisotropic elastic arteries

Modified Moens-Korteweg formulae have been developed for the pulse velocities in anisotropic elastic arteries of varying geometries. In particular, cylindrical straight, tapered and curved tubes have been considered. Numerical results indicate that the cylindrical tube formula can be applied in all cases and that the circumferential elastic modulus is the dominant elastic parameter.     

Directionality of stripes formed by anisotropic reaction-diffusion models

Turing mechanism explains the formation of striped patterns in a uniform field in which two substances interact locally and diffuse randomly. In a twin paper, to explain the directionality of stripes on fish skin in closely related species, we studied the effect of anisotropic diffusion of the two substances on the direction of stripes, in the cases in which both substances have high diffusivity in the same direction. In this paper, we study the direction of stripes in more general situations in which the diffusive direction may differ between the two substances. We derive a formula for the direction of stripes, based on a heuristic argument of unstable modes of deviation from the uniform steady state. We confirm the accuracy of the formula by computer simulations. When the diffusive direction is different between two substances, the directions of stripes in the spatial pattern change smoothly with the magnitude of anisotropy of two substances. When the diffusive direction of the two substances is the same, the stripes are formed either parallel or perpendicular to the common diffusive direction, depending on the relative magnitude of the anisotropy. The transition between these two phases occurs sharply.     

Ultrasound propagation in anisotropic soft tissues: the application of linear elastic theory

Linear elastic theory has served well in modeling the mechanical properties of numerous materials. In modeling ultrasonic wave propagation in biological soft tissues, an isotropic model has usually been employed. Many tissues, however, possess a lower order of symmetry, and the speed of sound in muscle is known to vary with the direction of propagation. In this study, by applying linear regression to acoustic microscopic data from seven frog sartorius specimens, four observable elastic constants associated with a transversely isotropic model were obtained. The average values of these constants were c11 = 2.64, c13 = 3.39 and c33 = 4.40 Nm-2 for resting muscles and c11 = 2.65, c13 = 3.43 and c33 = 4.57 Nm-2 for muscles undergoing tetanic contraction, where '1' and '3' represent the transverse and longitudinal axes, respectively. In all cases, c44 was 0, indicating a minimal contribution from longitudinal shear. For all seven specimens, the model of transverse isotropy provided a better fit of the data than that of isotropy.     

Evaluation of elastic properties of atomistic DNA models

A number of intriguing aspects in dynamics of double-helical DNA is related to the coupling between its macroscopic and microscopic states. A link between the elastic properties of long DNA chains and their atom-level dynamics can be established by comparing the worm-like chain model of polymer DNA with the conformational ensembles produced by molecular dynamics simulations. This problem is complicated by the complexity of the DNA structure, the small size of DNA fragments, and relatively short trajectory durations accessible in computer simulations of microscopic DNA dynamics. A careful study of all these aspects has been performed by using longer DNA fragments and increased durations of MD trajectories as compared to earlier such investigations. Special attention is paid to the necessary conditions and criteria of time convergence, and the possibility to increase the sampling by using constrained DNA models and simplified simulation conditions. It is found that dynamics of 25-mer duplexes with regular sequences agrees well with the worm-like chain theory and that accurate evaluation of DNA elastic parameters requires at least two turns of the double helix and approximately 20-ns duration of trajectories. Bond length and bond-angle constraints affect the estimates within numerical errors. In contrast, simplified treatment of solvation can strongly change the observed elastic parameters of DNA. The elastic parameters evaluated for AT- and GC-alternating duplexes reasonably agree with experimental data and suggest that, in different basepair sequences, the torsional and stretching elasticities vary stronger than the bending stiffness.     

Buckling of adaptive elastic bone-plate: theoretical and numerical investigation

During day-to-day activities, many bones in the axial and appendicular skeleton are subjected to repetitive, cyclic loading that often results directly in an increased risk of bone fracture. In clinical orthopedics, trabecular fatigue fractures are observed as compressive stress fractures in the proximal femur, vertebrae, calcaneus and tibia, that are often preceded by buckling and bending of microstructural elements (Müller et al. in J Biomechanics 31:150 1998; Gibson in J Biomechanics 18:317-328 1985; Gibson and Ashby in Cellular solids 1997; Lotz et al. in Osteoporos Int 5:252-261 1995; Carter and Hayes in Science 194:1174-1176 1976). However, the relative importance of bone density and architecture in the etiology of these fractures are poorly understood and consequently not investigated from a biomechanical point of view. In the present contribution, an attempt is made to formulate a bone-plate buckling theory using Cowin's concepts of adaptive elasticity (Cowin and Hegedus in J Elast 6:313-325 1976; Hegedus and Cowin J Elast 6:337-352 1976). In particular, the buckling problem of a Kirchhoff-Love bone plate is investigated numerically by using the finite difference method and an iterative solving approach (Chen in Comput Methods Appl Mech Eng 167:91-99 1998; Hildebland in Introduction to numerical analysis 1974; Richtmyer and Morton in Difference methods for initial-value problems 1967).     

Specimen-specific multi-scale model for the anisotropic elastic constants of human cortical bone

The anisotropic elastic constants of human cortical bone were predicted using a specimen-specific micromechanical model that accounted for structural parameters across multiple length scales. At the nano-scale, the elastic constants of the mineralized collagen fibril were estimated from measured volume fractions of the constituent phases, namely apatite crystals and Type I collagen. The elastic constants of the extracellular matrix (ECM) were predicted using the measured orientation distribution function (ODF) for the apatite crystals to average the contribution of misoriented mineralized collagen fibrils. Finally, the elastic constants of cortical bone tissue were determined by accounting for the measured volume fraction of Haversian porosity within the ECM. Model predictions using the measured apatite crystal ODF were not statistically different from experimental measurements for both the magnitude and anisotropy of elastic constants. In contrast, model predictions using common idealized assumptions of perfectly aligned or randomly oriented apatite crystals were significantly different from the experimental measurements. A sensitivity analysis indicated that the apatite crystal volume fraction and ODF were the most influential structural parameters affecting model predictions of the magnitude and anisotropy, respectively, of elastic constants.     

Comment on elastic network models and proteins

Elastic network models have been used to study the properties of coarse grained models of proteins and larger biomolecular complexes. In this comment, we point out that it is important to build rotational symmetry, as well as translational symmetry, into these models that are designed to describe the rigidity, and the associated low-frequency deformations. This leads to strong restrictions on what form of interactions can be used. In particular, the only allowed two-center harmonic interactions are those corresponding to Hooke springs. Additional complexity can be introduced if required by using three-center harmonic interactions.     

The anisotropic material constitutive models for the human cornea

This paper presents an anisotropic analysis model for the human cornea. The model is based on the assumption that the fibrils in the cornea are organised into lamellae, which may have preferential orientation along the superior-inferior and nasal-temporal directions, while the alignment of lamellae with different orientations is assumed to be random. Hence, the cornea can be regarded as a laminated composite shell. The constitutive equation describing the relationships between membrane forces, bending moments, and membrane strains, bending curvatures are derived. The influences of lamella orientations and the random alignment of lamellae on the stiffness coefficients of the constitutive equation are discussed.     

Length-dependence of flexural rigidity as a result of anisotropic elastic properties of microtubules

Unexplained length-dependence of flexural rigidity and Young's modulus of microtubules is studied using an orthotropic elastic shell model. It is showed that vibration frequencies and buckling load predicted by the accurate orthotropic shell model are much lower than that given by the approximate isotropic beam model for shorter microtubules, although the two models give almost identical results for sufficiently long microtubules. It is this inaccuracy of the isotropic beam model used by all previous researchers that leads to reported lower flexural rigidity and Young's modulus for shorter microtubules. In particular, much lower shear modulus and circumferential Young's modulus, which only weaken flexural rigidity of shorter microtubules, are responsible for the observed length-dependence of the flexural rigidity. These results confirm that longitudinal Young's modulus of microtubules is length-independent, and the observed length-dependence of the flexural rigidity and Young's modulus is a result of strongly anisotropic elastic properties of microtubules which have a length-dependent weakening effect on flexural rigidity of shorter microtubules.     

Deficiencies in soviet medicine

On the eve of the 1984 Summer Olympics, a deranged man drove his car at high speed onto a pedestriancrowded sidewalk in a suburb of Los Angeles. The UCLA Medical Center, located two blocks from the scene, received 17 of 51 casualties. One patient arrived in full cardiac arrest and could not be resuscitated. Six had minor injuries or temporary hysteria and did not require admission to hospital. The mean injury severity score of the 10 patients who were admitted was 13.6 (range 3 to 48). Three patients required immediate surgical procedures, and two had delayed orthopedic operations. Specialty consultations were needed in orthopedics, neurosurgery, plastic surgery, otolaryngology, pediatric surgery, and pediatric intensive care. There were no subsequent deaths, although two patients had substantial residual neurologic disability. This episode of unexpected urban violence underscores the need for dedicated trauma services in university centers. Functions of such services include disaster planning, deploying surgical personnel, managing injured patients, and analyzing outcomes.     

Non-linear elastic deformable models for real-time surgery simulation

In this article, we describe the latest developments of the minimally invasive hepatic surgery simulator prototype developed at INRIA. A key problem with such a simulator is the physical modelling of soft tissues. We propose a new deformable model based on non-linear elasticity and the finite element method. This model is valid for large displacements, which means in particular that it is invariant with respect to rotations. This property improves the realism of the deformations and solves the problems related to the shortcomings of linear elasticity, which is only valid for small displacements. We also address the problem of volume variations by adding to our model incompressibility constraints. Finally, we demonstrate the relevance of this approach for the real-time simulation of laparoscopic surgical gestures on the liver.