Plasmids containing many tandem copies of a synthetic lactose operator

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.     

Cloning of chemically synthesized lactose operators.

Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.     

Cloning and characterization of the natural lactose operator

A 55-bp DNA segment carrying the wild-type lactose operator sequence has been cloned. Its sequence is: (Formula: see text). With the exceptions of the bases at positions 19 and 41, 26 and 34, and 28 and 32, the sequence is a perfect inverted repeat about base pair 30. This segment was obtained from the wild-type lactose promoter and operator region of lambda h80dlac phage DNA by a combination of in vitro and in vivo steps. Up to four direct-repeat copies of this segment have been cloned in plasmid pMB9 and pBR325. Repressor affinity for this 55-bp fragment does not differ significantly from that for a 40-bp synthetic operator fragment cloned previously, even though the 55-bp fragment contains the complete set of sequence symmetries associated with the natural operator, whereas the 40-bp fragment does not. An improved procedure for operator purification is described: this was used to prepare 14 mg of the 55-bp fragment over a 2-month period.     

Variants of a cloned synthetic lactose operator: I. A palindromic dimer lactose operator derived from one strand of the cloned 40-base pair operator

Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence

where the horizontal arrows indicate the locations of the two 21-bp “core? operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for EcoKL, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro.     

Transposition of the Streptococcus lactis ssp. lactis Z270 lactose plasmid to pVA797: demonstration of an insertion sequence and its relationship to an inverted repeat sequence isolated by self-annealing

The lactose plasmid pUCL22 of the single plasmid strain Streptococcus lactis ssp. lactis Z270 was demonstrated to fuse with the heterologous conjugative plasmid pVA797. The fusion of pUCL22 with pVA797 occurred by recombination between a specific sequence of pUCL22 and different sites of pVA797. The cointegrates of pUCL22::pVA797 were unstable: in the absence of lactose selection, they segregated plasmids that corresponded to pVA797 enlarged by one sequence of 1.2 kb, common to all derivative plasmids. This resolution sequence (RS) was shown to originate in the 9.7 kb BstEII restriction fragment of pUCL22 and to duplicate during replicon fusion. In addition, after nuclease S1 treatment of pUCL22 DNA, a self-annealing sequence was isolated; the two copies of this inverted repeat (IR) sequence were located on the 18 kb BamHI segment of the plasmid. This latter sequence was distinct from the RS with which it hybridized weakly. The RS was responsible for the transposition of the entire lactose plasmid; the role of the IR remains to be elucidated.     

Influence of sequence and distance between two operators on interaction with the lac repressor

The influence of additional operator or pseudooperator sequences on the lactose repressor-operator interaction has been investigated. Results of kinetic and equilibrium binding measurements suggest an important in vivo role for the Z-gene pseudooperator in repressor-operator binding; the formation of a ternary, looped complex is indicated by the influence of secondary operator sites on binding parameters. Although the binding affinity of the Z-gene pseudooperator [Oz] is only approximately 1/30 that observed for the primary operator [O], the binding affinity to DNA containing both Oz and O is significantly higher than either sequence alone or the sum of the two. This synergistic effect is enhanced further by replacing the pseudooperator sequence [Oz] with the primary operator sequence and results in an even stronger ternary complex in plasmids with duplicate primary sites. The distance between the center of the two primary operators affects the formation of a ternary complex in the linear DNA molecules. Decreased dissociation rate constants were observed with spacing of operator-like sequences between 300 and 500 base pairs (bp). Minimal influence of the second operator on repressor binding is observed when the operators are separated by approximately 4000 or approximately 100 bp. The significant influence of distance on kinetic and equilibrium parameters was demonstrated by measurements on plasmid pRW1511 [Oi-O-PL-Oz] cleaved with restriction enzymes either in the polylinker region to place Oi-O and Oz on opposite ends of the linear plasmid or outside this region to maintain the sites within 500 bp. These results are consistent with the formation of operator-repressor-pseudooperator ternary complex to generate a looped DNA structure.     

Effect of plasmid copy number and lac operator sequence on antibiotic-free plasmid selection by operator-repressor titration in Escherichia coli

The Escherichia coli strain DH1lacdapD enables plasmid selection and maintenance that is free from antibiotics and selectable marker genes. This is achieved by using only the lac operator sequence as a selectable element. This strain is currently used to generate high copy number plasmids with no antibiotic resistance genes for use as DNA vaccines and for expression of recombinant proteins. Until now these have been limited to pUC-based plasmids containing a high copy number pMB1-derived origin of replication, and the principle lacO(1) and auxiliary lacO(3) operators. In this study we have shown that this system can also be used to select and maintain pBR322-based plasmids with the lower copy number pMB1 origin of replication, and that lacO(1) alone or a palindromic version of lacO(1) can provide a sufficient level of repressor titration for plasmid selection. This is advantageous for recombinant protein production, where low copy number plasmids are often used and plasmid maintenance is important. The degree of repressor titration due to these plasmids was measured using the natural lactose operon in E. coli DH1 as a model.     

In vitro gene fusions that join an enzymatically active beta-galactosidase segment to amino-terminal fragments of exogenous proteins: Escherichia coli plasmid vectors for the detection and cloning of translational initiation signals.

We report the construction and use of a series of plasmid vectors suitable for the detection and cloning of translational control signals and 5' coding sequences of exogenously derived genes. In these plasmids, the first eight codons of the amino-terminal end of the lactose operon beta-galactosidase gene, lacZ, were removed, and unique BamHI, EcoRI, and SmaI (XmaI) endonuclease cleavage sites were incorporated adjacent to the eighth codon of lacZ. Introduction of deoxyribonucleic acid fragments containing appropriate regulatory signals and 5' coding sequences into such lac fusion plasmids led to the production of hybrid proteins consisting of the carboxyl-terminal segment of a beta-galactosidase remnant plus a peptide fragment that contained the amino-terminal amino acids encoded by the exogenous deoxyribonucleic acid sequence. These hybrid peptides retained beta-galactosidase enzymatic activity and yielded a Lac+ phenotype. Such hybrid proteins are useful for purifying peptide sequences encoded by exogenous deoxyribonucleic acid fragments and for studies relating the structure and function of specific peptide segments.     

Genetic and physical characterization of recombinant plasmids associated with cell aggregation and high-frequency conjugal transfer in Streptococcus lactis ML3.

Restriction mapping was employed to characterize the 104-kilobase (kb) cointegrate lactose plasmids from 15 independent transconjugants derived from Streptococcus lactis ML3 as well as the 55-kb lactose plasmid ( pSK08 ) and a previously uncharacterized 48.4-kb plasmid ( pRS01 ) from S. lactis ML3. The data revealed that the 104-kb plasmids were cointegrates of pSK08 and pRS01 and were structurally distinct. The replicon fusion event occurred within adjacent 13.8- or 7.3-kb PvuII fragments of pSK08 and interrupted apparently random regions of pRS01 . Correlation of the transconjugants' clumping and conjugal transfer capabilities with the interrupted region of pRS01 identified pRS01 regions coding for these properties. In the 104-kb plasmids, the pRS01 region was present in both orientations with respect to the pSK08 region. The replicon fusion occurred in recombination-deficient (Rec-) strains and appeared to introduce a 0.8 to 1.0-kb segment of DNA within the junction fragments. The degeneration of the cointegrate plasmids was monitored by examining the lactose plasmids from nonclumping derivatives of clumping transconjugants. These plasmids displayed either precise or imprecise excision of pRS01 sequences or had dramatically reduced copy numbers. Both alterations occurred by rec-independent mechanisms. Alterations of a transconjugant 's clumping phenotype also occurred by rec-independent inversion of a 4.3-kb KpnI-PvuII fragment within the pRS01 sequences of the cointegrate plasmid.     

Monitoring Plasmid Replication in Live Mammalian Cells over Multiple Generations by Fluorescence Microscopy

Few naturally-occurring plasmids are maintained in mammalian cells. Among these are genomes of gamma-herpesviruses, including Epstein-Barr virus (EBV) and Kaposi''s Sarcoma-associated herpesvirus (KSHV), which cause multiple human malignancies ^1-3. These two genomes are replicated in a licensed manner, each using a single viral protein and cellular replication machinery, and are passed to daughter cells during cell division despite their lacking traditional centromeres ^4-8.Much work has been done to characterize the replications of these plasmid genomes using methods such as Southern blotting and fluorescence in situ hybridization (FISH). These methods are limited, though. Quantitative PCR and Southern blots provide information about the average number of plasmids per cell in a population of cells. FISH is a single-cell assay that reveals both the average number and the distribution of plasmids per cell in the population of cells but is static, allowing no information about the parent or progeny of the examined cell.Here, we describe a method for visualizing plasmids in live cells. This method is based on the binding of a fluorescently tagged lactose repressor protein to multiple sites in the plasmid of interest ⁹. The DNA of interest is engineered to include approximately 250 tandem repeats of the lactose operator (LacO) sequence. LacO is specifically bound by the lactose repressor protein (LacI), which can be fused to a fluorescent protein. The fusion protein can either be expressed from the engineered plasmid or introduced by a retroviral vector. In this way, the DNA molecules are fluorescently tagged and therefore become visible via fluorescence microscopy. The fusion protein is blocked from binding the plasmid DNA by culturing cells in the presence of IPTG until the plasmids are ready to be viewed.This system allows the plasmids to be monitored in living cells through several generations, revealing properties of their synthesis and partitioning to daughter cells. Ideal cells are adherent, easily transfected, and have large nuclei. This technique has been used to determine that 84% of EBV-derived plasmids are synthesized each generation and 88% of the newly synthesized plasmids partition faithfully to daughter cells in HeLa cells. Pairs of these EBV plasmids were seen to be tethered to or associated with sister chromatids after their synthesis in S-phase until they were seen to separate as the sister chromatids separated in Anaphase¹⁰. The method is currently being used to study replication of KSHV genomes in HeLa cells and SLK cells. HeLa cells are immortalized human epithelial cells, and SLK cells are immortalized human endothelial cells. Though SLK cells were originally derived from a KSHV lesion, neither the HeLa nor SLK cell line naturally harbors KSHV genomes¹¹. In addition to studying viral replication, this visualization technique can be used to investigate the effects of the addition, removal, or mutation of various DNA sequence elements on synthesis, localization, and partitioning of other recombinant plasmid DNAs.     

Complete sequences of four plasmids of Lactococcus lactis subsp. cremoris SK11 reveal extensive adaptation to the dairy environment

Lactococcus lactis strains are known to carry plasmids encoding industrially important traits. L. lactis subsp. cremoris SK11 is widely used by the dairy industry in cheese making. Its complete plasmid complement was sequenced and found to contain the plasmids pSK11A (10,372 bp), pSK11B (13,332 bp), pSK11L (47,165 bp), and pSK11P (75,814 bp). Six highly homologous repB-containing replicons were found, all belonging to the family of lactococcal theta-type replicons. Twenty-three complete insertion sequence elements segment the plasmids into numerous modules, many of which can be identified as functional units or containing functionally related genes. Plasmid-encoded functions previously known to reside on L. lactis SK11 plasmids were now mapped in detail, e.g., lactose utilization (lacR-lacABCDFEGX), the proteolytic system (prtM-prtP, pepO, pepF), and the oligopeptide permease system (oppDFBCA). Newly identified plasmid-encoded functions could facilitate the uptake of various cations, while the pabA and pabB genes could be essential for folate biosynthesis. A competitive advantage could be obtained by using the putative flavin adenine dinucleotide-dependent d-lactate dehydrogenase and oxalate:formate antiporter for enhanced ATP synthesis, while the activity of the predicted alpha-acetolactate decarboxylase may contribute to the formation of an additional electron sink. Various stress response proteins are plasmid encoded, which could enhance strain robustness. A substantial number of these "adaptation" genes have not been described before on L. lactis plasmids. Moreover, several genes were identified for the first time in L. lactis, possibly reflecting horizontal gene transfer.     

4',4' adenyltransferase activity on conjugative plasmids isolated from Staphylococcus aureus is encoded on an integrated copy of pUB110.

In staphylococci, linked resistance to the aminoglycosides kanamycin, neomycin, paromomycin, and tobramycin (KmNmPmTmr) is generally mediated by an aadD determinant which encodes production of an adenyltransferase aminoglycoside modifying enzyme, AAD(4',4'). The aadD resistance determinant is located on small multicopy plasmids such as pUB110, and has also been found on large multiresistance plasmids and on the chromosome in some strains. Examination of two conjugative plasmids from strains of Staphylococcus aureus isolated in North America indicated that the aadD determinant on these plasmids is located on an integrated copy of pUB110. The integrated pUB110 is flanked by direct repeats of the staphylococcal insertion sequence IS257. Analysis of the conjugative plasmid pSK41 showed an 8-bp duplication of the pUB110 sequence immediately adjacent to flanking IS257 elements, suggesting that integration of pUB110 was mediated by IS257.     

Isolation and subcloning analysis of functional centromere DNA (CEN11) from Saccharomyces cerevisiae chromosome XI.

We have cloned segments of yeast DNA containing the centromere XI-linked MET14 gene. This was done by selecting directly in Saccharomyces cerevisiae for complementation of a met14 mutation after transformation with a hybrid plasmid DNA genomic library. Genetic evidence indicates that functional centromere DNA (CEN11) from chromosome XI is also contained on the segment of S. cerevisiae DNA cloned in pYe(MET14)2. This plasmid is maintained stably in budding S. cerevisiae cultures and segregates predominantly 2+:20- through meiosis. The CEN11 element has been subcloned in vector YRp7' on an S. cerevisiae DNA fragment 900 base pairs in length [pYe(CEN11)10]. The mitotic and meiotic behavior of plasmids containing CEN11 plus a DNA replicator (ars) indicates that the centromere DNA sequences enable these plasmids to function as true minichromosomes in S. cerevisiae.     

Restriction endonuclease analysis of the lactose plasmid in Streptococcus lactis ML3 and two recombinant lactose plasmids.

We investigated the molecular relationship between the 60-megadalton (Mdal) recombinant lactose plasmids in ML 3 x LM2301 lactose-positive (Lac+) transconjugants and the genetic material of Streptococcus lactis ML3. Lactose metabolism is linked to the 33-Mdal plasmid pSK08 in ML3, and the recipient LM2301 is cured of plasmid DNA. The plasmids were analyzed with a series of restriction enzymes. We found that the 60-Mdal plasmids of Lac+ transconjugants contained pSK08 DNA, but were not simply dimers of pSK08. The 60-Mdal plasmids contained a segment of DNA not apparent in pSK08. The restriction patterns of the 60-Mdal plasmid in a Lac+ nonclumping transconjugant and that in a Lac+ clumping transconjugant were different. This suggested that there was a molecular differences between these two recombinant plasmids. We conclude that the segment of DNA in the 60-Mdal plasmids that was not present in pSK08 was the proposed transfer factor responsible for cell aggregation and high-frequency conjugation.     

A synthetic translation-terminator gene: A tool for dissecting the translation direction of a gene

A 41-nucleotide-long duplex DNA, which contains the translation termination codon TAA in six reading frames and lactose operator sequence of Escherichiacoli, has been synthesized. This fragment may be useful not only for producing a truncated protein encoded in a plasmid, but also for the identification of the precise coding region and translation direction of a bacterial gene in the cloned chromosomal segment. The synthetic fragment was inserted into ß-lactamase structural gene in pBR322 in order to test the in vivo activity. The plasmid produced mutant ß-lactamase reduced in size, as expected from the insertion site, and rendered the host bacterium constitutive for ß-galactosidase. Thus, termination codons and lactose operator in synthetic nucleotide appear to be functional in vivo.     

Characterization of a circular plasmid from the yeast Kluyveromyces waltii.

A new plasmid was found in the yeast Kluyveromyces waltii. This high-copy-number plasmid, named pKW1, is a double-stranded circular DNA plasmid of 5619 bp. It has several features characteristic of the 2 mu-type plasmids: presence of two inverted repeats and four open reading frames, as well as the interconversion of two isomeric forms. However, the nucleotide sequence shows little homology with known yeast plasmids. An ARS function was localized within a segment of 545 bp near one of the inverted repeats. Chimeric plasmids carrying this segment efficiently transformed K. waltii. A strain of K. waltii cured of the plasmid (cir degree) was also obtained. In the pKW1 sequence, a functionally neutral region was found at which foreign DNA can be inserted with little effect on plasmid stability. Such constructions carrying the full sequence of pKW1 replicated autonomously in a cir degree host and were particularly stable. pKW1-derived full-sequence plasmids also transformed K. thermotolerans, but not K. lactis.