Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence where the horizontal arrows indicate the locations of the two 21-bp “core? operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for EcoKL, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro. 相似文献
Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators. 相似文献
A 55-bp DNA segment carrying the wild-type lactose operator sequence has been cloned. Its sequence is: (Formula: see text). With the exceptions of the bases at positions 19 and 41, 26 and 34, and 28 and 32, the sequence is a perfect inverted repeat about base pair 30. This segment was obtained from the wild-type lactose promoter and operator region of lambda h80dlac phage DNA by a combination of in vitro and in vivo steps. Up to four direct-repeat copies of this segment have been cloned in plasmid pMB9 and pBR325. Repressor affinity for this 55-bp fragment does not differ significantly from that for a 40-bp synthetic operator fragment cloned previously, even though the 55-bp fragment contains the complete set of sequence symmetries associated with the natural operator, whereas the 40-bp fragment does not. An improved procedure for operator purification is described: this was used to prepare 14 mg of the 55-bp fragment over a 2-month period. 相似文献
A rat liver cDNA library was prepared from total polyribosomal poly(A)+ RNA extracted from phenobarbital-treated animals. A cDNA clone coding for a phenobarbital-inducible cytochrome P-450 (PB P-450) was identified by differential colony hybridization to cDNAs synthesized from liver poly(A)+RNAs isolated from phenobarbital-treated rats for positive selection and cDNAs from either untreated rats or beta-naphthoflavone-treated rats as negative controls, followed by hybrid-selected translation and analysis of the translation products by immunoprecipitation. As the cloning and screening strategies involve no prior enrichment for specific mRNAs, they also permit the identification of sequences coding for phenobarbital-induced proteins other than cytochromes P-450. This relatively straightforward approach is generally applicable to the molecular cloning of sequences coding for other inducible cytochromes P-450. Nucleic acid sequencing data indicated that the cloned PB P-450 cDNA codes for a cytochrome P-450 variant [designated P-450e(U.C.)] that is very similar, but not identical, to P-450e. Sequence analysis of the section of cDNA specifying the 3'-non-coding region of the mRNA revealed that it lacked the usual poly(A) addition site signal sequence but contained three inverted repeat structures. Solution hybridization analysis demonstrated that PB P-450 mRNA is increased 20-fold by phenobarbital treatment and decreased 3-fold by beta-naphthoflavone treatment. 相似文献
Several unit-length minicircles from the kinetoplast DNA of Leishmania tarentolae were cloned into pBR322 and into M13 phage vectors. The complete nucleotide sequences of three different partially homologous minicircles were obtained. The molecules contained a region of approx. 80% sequence homology extending for 160–270 bp and a region unique to each minicircle. A 14-mer was found to be conserved in all kinetoplast minicircle sequences reported to date. The frequency distributions of various minicircle sequence classes in L. tarentolae were obtained by quantitative gel electrophoresis and by examination of the “T ladder” patterns of minicircles randomly cloned into M13 at several sites. By these methods we could assign approx. 50% of the total minicircle DNA into a minimum of five sequence classes. A sequence-dependent polyacrylamide gel migration abnormality was observed with several minicircle fragments both cloned and uncloned. The abnormality was dependent on the presence of a portion of the conserved region of the minicircle. 相似文献
The cAMP receptor protein (CRP) requires cAMP for an allosteric change and regulates more than 150 genes in Escherichia coli. In this study, the modular half of cAMP receptor protein was used to investigate the allosteric signal transmission pathway induced by cAMP binding. The activation of CRP upon cAMP binding is indicated to be realignment of the two subunits within the CRP dimer. The interaction of loop 3 and Phe136 do not involve in signal transmission. 相似文献
Polysome immuno-adsorption, with immunoglobulin G directed against two 3-methylcholanthrene-induced mouse liver cytochrome P-450 proteins, was used to enrich mRNA from 3-methylcholanthrene-treated C57BL/6N mouse liver. cDNA transcribed from the P-450-enriched mRNA was then cloned into the Okayama-Berg vector. Two cDNA classes were detected upon differential screening of the clone bank with [32P]cDNA derived from 3-methylcholanthrene-induced immuno-enriched versus control mRNA. Several representatives of these two classes were judged to be near full length by comparison with their corresponding mRNA mobilities on denaturing agarose gels. A continuous reading-frame near the 5' end of one cDNA class (P1-450) corresponds to a protein having 15 of 17 residues the same as the published N-terminal sequence of rat P-450c. A continuous reading frame near the 5' end of the other class (P3-450) corresponds exactly to the first 25 amino acids of the published N-terminal sequence of rat P-450d. The P1-450 cDNA is at least 700 bp longer than the P3-450 cDNA. Heteroduplex analysis and Southern blot hybridization demonstrate that these mRNAs share approx. 1100 bp of sequence homology. Genomic P1-450 and P3-450 clones were isolated from a gene library constructed from C57BL/6N mouse liver DNA. By heteroduplex analysis with the corresponding cDNA, the P1-450 gene spans about 6 kb and the P3-450 gene about 7 kb. The intron-exon patterns are very similar, with the second and seventh exons being much larger than the other five. The 3' terminal exon of P1-450 is about 500 bp longer than that of P3-450. These data suggest that both P1-450 and P3-450 have diverged from a common ancestral gene. 相似文献
Expression of Tk antigen, a truncated carbohydrate antigen, was examined in helmith parasites. Using the monoclonal antibody LM389, this antigen was detected in extracts from Taenia hydatigena, Mesocestoides vogae (syn corti), and Taenia crassiceps. No reactivity was observed in Thysanosoma spp., Dipylidium caninum, Fasciola hepatica, and Nyppostrongylus brasiliensis. On the basis of their electrophoretic mobility, different patterns of Tk-bearing glycoproteins were observed among T. hydatigena, M. corti and T. crassiceps by immunoblotting, with certain components resolved as broad bands typical of mucin-like glycoproteins. Most Tk-reactive material remained in the 0.6 N perchloric acid-soluble fraction, confirming that Tk epitopes are carried by mucin-type glycoproteins. Immunohistochemical analysis revealed that in T. hydatigena, Tk antigen is mainly expressed in the tegument, whereas in M. corti the reactivity was principally observed in the subtegumental parenchyma. The presence of a novel tumor-associated carbohydrate antigen in invertebrates, contributes to strengthen the notion that truncated mucin-type O-glycosylation is a normal phenomenon in parasitic worms and may help identify new biological characteristics of helminth parasites. 相似文献
A 74-bp DNA sequence coding for the pre sequence of human preproinsulin and containing EcoRI termini was synthesized by the chemical enzymatic method, joined with previously synthesized proinsulin DNA, and cloned in the M 13mp8 vector. A clone pNB82 -121 was identified by DNA sequence which confirmed the correct orientation of the pre sequence to the proinsulin DNA. The EcoRI site at the junction of pre- and proinsulin DNA was eliminated by removing a triplet ATT using a synthetic 19-mer primer. To simplify preproinsulin isolation and to study its expression in the M 13 system, a 25-bp affinity leader sequence coding for (glu)7 was inserted at the remaining EcoRI site; this put the preproinsulin DNA in a correct reading frame with the AUG initiation codon of beta-galactosidase. Preproinsulin was expressed under lac promoter control as analyzed by a radioimmunoassay (RIA) against C-peptide. 相似文献
The causes of the particular distribution of both Trypanosoma cruzi lineages throughout the American continent remain unknown. In Colombia, T. cruzi I is the predominant group in both domestic and sylvatic cycles. Here, we present the biological characterization of T. cruzi parasites belonging to both T. cruzi I and T. cruzi IIb groups. Our results show the inability of the T. cruzi IIb clones to infect mammalian cells, produce trypomastigotes and replicate in Rhodnius prolixus, the main vector species in this country. Moreover, this result was confirmed when other species from the same genus, such as R. pallescens and R. robustus, were infected with the same TcIIb clone and its parental strain, while the infection in other genera such as Triatoma and Panstrongylus was successful. Furthermore, the growth kinetics and duplication time in vitro suggest that the high prevalence of T. cruzi I in Colombia results from more successful interactions between parasite lineage, vector, and host species. This type of study may help to understand the factors influencing the particular epidemiological patterns of Chagas disease transmission in different endemic regions. 相似文献
A gene coding for xylanase synthesis in Bacillus subtilis was isolated by direct shotgun cloning using Escherichia coli as a host. Following partial digestion of B. subtilis chromosomal DNA with PstI or EcoRI restriction enzymes, fragments ranging from 3 to 7 kb were introduced into the PstI or EcoRI sites of pBR325. Transformed colonies having lost either the ampicillin or chloramphenicol resistance markers were screened directly on 1% xylan plates. Out of 8000 transformants, ten xylanase-positive clones were identified by the clearing zone around lysozyme-treated colonies. Further characterization of one of the clones showed that the xylanase gene was present in a 3.9-kb insert within the PstI site of the plasmid pBR325. Retransformation of E. coli strain with the xylanase-positive hybrid plasmid pRH271 showed 100% transformation to xylanase production. The intracellular xylanase produced by the transformed E. coli was purified by ion exchange and gel permeation chromatography. The electrophoretic mobility of the purified xylanase indicated an Mr of 22 000. 相似文献
Non-specific lipid transfer proteins belonging to LTP1 family represent the most important allergens for non pollen-related allergies to Rosaceae fruits in the Mediterranean area. Peach LTP1 (Pru p 3) is a major allergen and is considered the prototypic allergenic LTP. On the contrary, pear allergy without pollinosis seems to be under-reported when compared to other Rosaceae fruits suggesting that the as-yet-uncharacterized pear LTP1 (Pyr c 3) has in vivo a low allergenicity. We report here on the identification of four cDNAs encoding for LTP1 in pear fruits. The two isoforms exhibiting amino acid sequences most similar to those of peach and apple homologues were obtained as recombinant proteins. Such isoforms exhibited CD spectra and lipid binding ability typical of LTP1 family. Moreover, pear LTP1 mRNA was mainly found in the peel, as previously shown for other Rosaceae fruits. By means of IgE ELISA assays a considerable immunoreactivity of these proteins to LTP-sensitive patient sera was detected, even though allergic reactions after ingestion of pear were not reported in the clinical history of the patients. Finally, the abundance of LTP1 in protein extracts from pear peel, in which LTP1 from Rosaceae fruits is mainly confined, was estimated to be much lower as compared to peach peel. Our data suggest that the two isoforms of pear LTP1 characterized in this study possess biochemical features and IgE-binding ability similar to allergenic LTPs. Their low concentrations in pear might be the cause of the low frequency of LTP-mediated pear allergy. 相似文献